Application of RNF5 in preparation of medicine for preventing and / or treating acute lung injury

Abstract

The invention belongs to the technical field of biological medicine, and discloses application of RNF5 in preparation of medicine for preventing and / or treating acute lung injury. The invention finds that RNF5 gene knock-down significantly improves lung injury, pulmonary edema, lung inflammation and apoptosis under LPS stimulation; the RNF5 serving as a targeting gene can be used for targeted development of drugs for preventing, relieving and / or treating the acute lung injury, and has important significance on clinical treatment of the acute lung injury.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the use of RNF5 in the preparation of medicaments for the prevention and / or treatment of acute lung injury. Background Technology

[0002] Acute lung injury (ALI) is a serious respiratory disease worldwide, characterized by diffuse damage to pulmonary capillaries, increased alveolar-capillary permeability, and widespread pulmonary edema. The main clinical manifestations are acutely progressively worsening dyspnea and refractory hypoxemia. Severe ALI can develop into acute respiratory distress syndrome (ARDS), which can lead to respiratory failure and even multiple organ failure, ultimately endangering the patient's life. It is estimated that approximately 3 million people worldwide suffer from ALI / ARDS annually, accounting for 10% of intensive care unit patients. Currently, there are no truly effective treatments for ALI / ARDS; patients can only be kept alive and their lungs gradually healed through mechanical ventilation and fluid restriction techniques. ALI has a high incidence, rapid onset, rapid progression, severe illness, and is difficult to treat, with a mortality rate as high as 40%. It has become a prominent critical illness in clinical practice, seriously threatening patients' lives and imposing a significant economic burden. Due to a lack of full understanding of the molecular mechanisms driving ALI development, there are currently no specific treatments for ALI. Therefore, exploring the pathogenesis of ALI, actively developing novel intervention targets and effective therapeutic drugs, and curbing or even reversing the pathological progression of ALI are urgently needed. Summary of the Invention

[0003] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of RNF5 in the preparation of medicaments for the prevention and / or treatment of acute lung injury.

[0004] RNF5, or RING finger protein 5, is an 18kDa RING finger E3 ligase located in the endoplasmic reticulum, possessing a RING finger motif and a C-terminal membrane anchoring domain.

[0005] This invention induces acute lung injury (ALI) models in cells and animals by stimulating A549 cells and mice with lipopolysaccharides (LPS) in vitro, and then evaluates the effects of RNF5 gene overexpression or knockout on acute lung injury.

[0006] For in vitro A549 cell experiments: In this invention, A549 cells were infected with lentiviruses that overexpressed or knocked down the RNF5 gene. An acute lung injury model was induced in vitro using LPS stimulation. Western blotting, RT-PCR, and immunofluorescence were then used to analyze the effect of the RNF5 gene on acute lung injury. The results showed that RNF5 overexpression exacerbated apoptosis and inflammation in A549 cells under LPS stimulation, while RNF5 knockdown alleviated apoptosis and inflammation in A549 cells under LPS stimulation. These results confirm that RNF5 is a worsening factor for acute lung injury, and inhibiting RNF5 expression can improve LPS-induced acute lung injury.

[0007] For in vivo mouse experiments: WT and RNF5 KO mice, AAV6-GFP and AAV6-GFP-RNF5 mice were used in this study, and each type of mouse was divided into a sham-operated group and an LPS group. The LPS group received LPS stimulation to establish an ALI model, while the sham-operated group received no treatment. Subsequently, Western blotting, HE staining, bronchoalveolar lavage fluid cell counting, lung wet-to-dry weight ratio, bronchoalveolar lavage fluid protein quantification, TUNEL staining, and RT-PCR experiments were performed. The results showed that the pathological score of lung injury in RNF5 knockout mice was significantly reduced. The total number of cells in bronchoalveolar lavage fluid, the total amount of protein in bronchoalveolar lavage fluid, and the lung wet-to-dry weight ratio all showed significant decreases. Furthermore, the number of TUNEL-positive cells and inflammatory chemokines were significantly reduced, indicating that RNF5 knockout can alleviate acute lung injury in vivo and reduce cell apoptosis and inflammation in mice under LPS stimulation, ultimately improving LPS-induced acute lung injury. These results confirm that RNF5 is a worsening factor for acute lung injury, and inhibiting RNF5 expression can improve LPS-induced acute lung injury.

[0008] To achieve the objectives of this invention, the technical solution adopted is as follows: In a first aspect, the present invention provides an agent for the prevention and / or treatment of acute lung injury, comprising a substance that knocks down or eliminates the expression level of the RNF5 gene or protein. The agent significantly reduces lung injury pathological scores, decreases the total number of cells and total protein in bronchoalveolar lavage fluid (BAFLV), lowers the wet-to-dry weight ratio of the lungs, and alleviates apoptosis and inflammation by inhibiting RNF5 gene expression or reducing RNF5 protein activity, thereby significantly improving acute lung injury.

[0009] As a preferred embodiment of the formulation described in this invention, the substance includes sgRNA, siRNA, dsRNA, shRNA, miRNA, antisense nucleic acid, antibody, enzyme, or small molecule compound.

[0010] As a further preferred embodiment of the formulation described in this invention, the nucleotide sequence of the shRNA is: F:CCGGCGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGTCGTTTT TG; R:AATTCAAAAACGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGT CG.

[0011] As a further preferred embodiment of the formulation described in this invention, the nucleotide sequence of the sgRNA is GGCCTGGGAACCTGCAGTGCTGG.

[0012] As a preferred embodiment of the formulation described in this invention, it further includes a pharmaceutically acceptable carrier.

[0013] In a second aspect, the present invention uses the formulation described in the first aspect in the preparation of a medicament for the prevention and / or treatment of acute lung injury.

[0014] Thirdly, the present invention uses RNF5 as a target in the preparation of drugs for the prevention and / or treatment of acute lung injury.

[0015] As a preferred embodiment of the application described in this invention, the drug is capable of knocking down or eliminating the gene expression of RNF5 or reducing the protein activity of RNF5.

[0016] As a further preferred embodiment of the application described in this invention, the method for knocking down or eliminating the gene expression of RNF5 includes gene editing using CRISPR-Cas9 technology, silencing RNF5 using a recombinant plasmid containing knockout primers, siRNA, plasmid-mediated shRNA, or virus-mediated shRNA; the method for reducing the protein activity of RNF5 includes reducing protein activity using antibodies, enzymes, or small molecule compounds of RNF5.

[0017] Fourthly, the present invention utilizes inhibitors of RNF5 expression in the preparation of medicaments for the prevention and / or treatment of acute lung injury.

[0018] As a preferred embodiment of the application described in this invention, the inhibitor includes primers, sgRNA, siRNA, dsRNA, shRNA, miRNA, antisense nucleic acid, antibody, enzyme, or small molecule compound.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discovers a novel function of RNF5: inhibiting RNF5 expression or protein activity can improve acute lung injury. Based on the role of RNF5 in acute lung injury, it can be used to develop targeted drugs for the prevention, relief, and / or treatment of acute lung injury. Attached Figure Description

[0020] Figure 1 The images show the pathological and meristem analysis results of mice and A549 cells in the PBS and LPS 24 h groups. A represents HE staining of mouse lung tissue; B represents a bar chart of mouse lung injury scores (n=5); C represents a bar chart of mouse lung RNF5 mRNA expression levels (n=5); D represents a comparison of mouse lung RNF5 protein expression levels (n=5); E represents mouse lung RNF5 immunohistochemical staining results; F represents a bar chart of mouse lung RNF5 immunohistochemical intensity (n=5); G represents a bar chart of A549 cells after LPS stimulation for 3, 6, 12, 24, and 48 hours (n=5); H represents a comparison of A549 cells after LPS stimulation for 3, 6, 12, 24, and 48 hours (n=5); * indicates p < 0.05 vs PBS group, ** indicates p < 0.01 vs PBS group.

[0021] Figure 2 Figure 1 shows the apoptosis and inflammation results of LPS and PBS (PBS) stimulation in A549 cell lines infected with PLKO.1 and shRNF5 lentiviruses. A represents the RNF5 protein expression level detection in the PLKO.1 and shRNF5 A549 cell lines; B represents the TUNEL immunofluorescence of apoptosis in the PLKO.1 and shRNF5 A549 cells; C represents the TUNEL immunofluorescence statistical bar chart of apoptosis in the PLKO.1 and shRNF5 A549 cells (n=5); D represents the mRNA statistical bar chart of RNF5, inflammatory factors (TNFα, IL-1β, IL-6), and chemokines (CXCL2, CXCL3, MCP1) in the PLKO.1 and shRNF5 A549 cells (n=5). * indicates p < 0.05 vs PBS group, ** indicates p < 0.01 vs PBS group.

[0022] Figure 3Figure 1 shows the apoptosis and inflammation results of LPS and PBS (PBS) in GFP and RNF5 OE A549 cell lines. A represents the RNF5 protein expression level detection in both GFP and RNF5 OE A549 cell lines; B represents the TUNEL immunofluorescence of apoptosis in both GFP and RNF5 OE A549 cells; C represents the TUNEL immunofluorescence statistical bar chart of apoptosis in both GFP and RNF5 OE A549 cells (n=5); D represents the mRNA expression levels of inflammatory factors (TNFα, IL-1β, IL-6) and chemokines (CXCL2, CXCL3, MCP1) in both GFP and RNF5 OE A549 cells (n=5). * indicates p < 0.05, ** indicates p < 0.01.

[0023] Figure 4 The images show the pathological and meristem examination results of WT and RNF5 KO mice after treatment with Sham and LPS. Specifically, A shows the RNF5 protein expression level in WT and RNF5 KO mice; B shows the HE staining results of WT and RNF5 KO mice after treatment with Sham and LPS; C shows the lung injury score statistics (n=5) of WT and RNF5 KO mice after treatment with Sham and LPS; D shows the wet-to-dry weight ratio of the lungs in WT and RNF5 KO mice after treatment with Sham and LPS (n=5); E shows the total protein quantification statistics in the bronchoalveolar lavage fluid of WT and RNF5 KO mice after treatment with Sham and LPS (n=5); F shows the total cell count statistics in the bronchoalveolar lavage fluid of WT and RNF5 KO mice after treatment with Sham and LPS (n=5); G shows the total cell count statistics in the bronchoalveolar lavage fluid of WT and RNF5 KO mice after treatment with Sham and LPS (n=5); G shows the total cell count of WT and RNF5 KO mice after treatment with Sham and LPS. TUNEL immunofluorescence image of lung tissue from KO mice after LPS treatment; H is a statistical bar chart of TUNEL immunofluorescence in lung tissue from WT and RNF5 KO mice after LPS treatment (n=5); I and J are statistical bar charts of mRNA expression levels of inflammatory factors (Tnfα, Il-1β, Il-6) and chemokines (Cxcl3, Cxcl2, Mcp1) in lung tissue from WT and RNF5 KO mice after LPS treatment (n=5); * indicates p<0.05, ** indicates p<0.01.

[0024] Figure 5The images show the pathological and meristem examination results of AAV6-GFP and AAV6-GFP-RNF5 mice after treatment with Sham and LPS. Specifically, A represents the RNF5 protein expression level in AAV6-GFP and AAV6-GFP-RNF5 mice; B represents HE staining of AAV6-GFP and AAV6-GFP-RNF5 mice after Sham and LPS treatment; C represents a bar chart (n=5) of lung injury scores in AAV6-GFP and AAV6-GFP-RNF5 mice after Sham and LPS treatment; D represents a bar chart (n=5) of the wet-to-dry weight ratio of lungs in AAV6-GFP and AAV6-GFP-RNF5 mice after Sham and LPS treatment; and E represents the total protein content in bronchoalveolar lavage fluid of AAV6-GFP and AAV6-GFP-RNF5 mice after Sham and LPS treatment. Statistical bar chart (n=5); F is a statistical bar chart of total cell count in bronchoalveolar lavage fluid of AAV6-GFP and AAV6-GFP-RNF5 mice after treatment with Sham and LPS (n=5); G is a TUNEL immunofluorescence image of lung tissue of AAV6-GFP and AAV6-GFP-RNF5 mice after LPS treatment; H is a statistical bar chart of TUNEL immunofluorescence in lung tissue of AAV6-GFP and AAV6-GFP-RNF5 mice after LPS treatment (n=5); I and J are statistical bar charts of mRNA expression levels of inflammatory factors (Tnfα, Il-1β, Il-6) and chemokines (Cxcl3, Cxcl2, Mcp1) in lung tissue of AAV6-GFP and AAV6-GFP-RNF5 mice after LPS treatment (n=5); * indicates p<0.05, ** indicates p<0.01. Detailed Implementation

[0025] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0026] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0027] The experimental methods involved in the examples are as follows: (1) Laboratory animals and their care Experimental animals: Male C57BL / 6 mice aged 8-10 weeks and weighing 23.5g-27.5g were selected as experimental subjects.

[0028] Housing environment: SPF-grade laboratory animal center; SPF-grade mouse feed was purchased from Beijing Huafukang Biotechnology Co., Ltd.

[0029] Feeding conditions: The room temperature should be between 22℃ and 24℃, the humidity between 40% and 70%, the light should be alternating between light and dark for 12 hours, and the animals should have free access to water and food.

[0030] (2) Construction of A549 cell line To construct an shRNA expression vector targeting RNF5, two complementary oligonucleotide chains were synthesized. The resulting double-stranded DNA sequence after annealing was cloned into the PLKO.1 vector digested with AgeI / EcoRI. The oligonucleotide sequence is as follows: F:CCGGCGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGTCGTTTT TG; R:AATTCAAAAACGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGT CG; To clone the coding sequence (CDS) of RNF5, the following PCR primers were designed and synthesized: F:TCGGGTTTAAACGGATCCATGGCAGCAGCGGAGGAG; R:GGGCCCTCTAGACTCGAGAATACTGAGCAGCCAAAAAAAG; The RNF5 CDS fragment was obtained by PCR amplification and cloned into a pHAGE lentiviral vector using homologous recombination. Then, PLKO.1, GFP, sh RNF5 and RNF5 OE lentiviruses were constructed using a three-plasmid packaging system. The A549 cell line was infected with the lentiviruses and screened with puromycin to obtain four A549 cell lines: PLKO.1, GFP, sh RNF5 and RNF5 OE.

[0031] (3) Construction of RNF5 KO mice A guide RNA (sgRNA) targeting a DNA region was predicted in exon 3 of the RNF5 gene using an online CRISPR design tool (http: / / chopchop.cbu.uib.no / ), specifically: GGCCTGGGAACCTGCAGTGCTGG. An RNF5-sgRNA expression vector was constructed using pUC57-sgRNA (Addgene, 51132) as the backbone vector. The purified products of Cas9 mRNA and sgRNA were mixed and injected into single-cell zygotes of C57BL / 6 mice using a FemtoJet 5247 microinjection system. The injected zygotes were then transferred to surrogate female mice, resulting in F0 generation mice after approximately 19-21 days of gestation. Genomic DNA was extracted from ear tissue of mice two weeks after birth for gene identification.

[0032] (4) Construction of AAV6-mediated lung RNF5 overexpression mice The Rnf5 and GFP genes were amplified from cDNA and then ligated into a vector (pAAV-CMV-MCS-T2A-EGFP). The constructed plasmid was then packaged into an AAV6 vector carrying a CMV promoter to drive the expression of GFP (AAV6-CMV-GFP) and Rnf5 (AAV6-CMV-GFP-Rnf5). After anesthesia, mice were slowly nebulized with the virus solution (2.0 × 10⁻⁶). 11 (vg / mL, 100 μL / mouse). Three weeks after AAV6 injection, animals were randomly assigned to either the sham-operated group or the LPS group. Surgery and subsequent analyses were performed under blinded conditions.

[0033] (5) Construction of ALI model LPS stimulation was used to simulate acute lung injury (ALI) induced by Gram-negative bacterial infection, and this model was used to investigate the regulatory role of RNF5 at the in vivo level in acute lung injury. The method was as follows: After anesthetizing mice, 200 μL of LPS from *E. coli* (E. coli O55:B5, 10 mg / kg) was injected intratracheally into the lungs using an aerosol microsyringe. After administration, the mice were kept in a neutral position for 5 minutes to ensure LPS reached the lungs and prevent reflux. Subsequently, the mice were placed in a 28°C incubator until they recovered. After 3, 6, 12, and 24 hours of LPS stimulation, the mice were anesthetized by intraperitoneal injection of sodium pentobarbital. Peritoneal venous serum, bronchoalveolar lavage fluid, and lung tissue were collected sequentially. The bronchoalveolar lavage fluid consisted of saline injected into the left main bronchus, followed by fluid recovery. The fluid was then centrifuged at 5000g for 10 minutes at low temperature to separate the supernatant and precipitate. Protein concentration was determined using the supernatant. Protein concentration in bronchoalveolar lavage fluid supernatant was determined using the BCA Protein Assay Kit (23225; Thermo Fisher Scientific). After treatment with erythrocyte lysis buffer, the total cell count in the bronchoalveolar lavage fluid was obtained using a hemocytometer (Auto 1000; Nexcelom). The right lung of each mouse was weighed, and the wet-to-dry weight ratio was calculated (the entire lung was dried in a 65°C oven for 24 hours, and then weighed to obtain the dry weight). The wet-to-dry weight ratio was calculated as (wet weight - dry weight) / dry weight. All procedures and subsequent analyses were performed blinded.

[0034] (6) Hematoxylin-eosin (HE) staining of lung tissue Lung tissue was immediately fixed in 10% neutral formalin after collection, dehydrated, embedded in paraffin, and cut into 5μm continuous paraffin sections. It was then stained with hematoxylin and eosin (hematoxylin, G1004, Wuhan Saiwell Biotechnology Co., Ltd.; eosin, BA-4024, Zhuhai Beso Biotechnology Co., Ltd.) for routine hematoxylin and eosin staining and observation of lung tissue necrosis.

[0035] (7) Immunohistochemical staining Paraffin sections were repaired with EDTA and incubated overnight at 4°C with RNF5 antibody (Abclonal, A8351). After washing with PBS, secondary antibody was incubated at 37°C for 30 minutes. Then, DAB (1:200, BLRE147-200T, Biolight) was used for staining, and hematoxylin (BLRE004, Biolight) was used for nuclear staining. Images were obtained by scanning using a slide scanner (Win180, WINMEDIC).

[0036] (8) TUNEL staining Staining was performed using the TUNEL staining kit (Roche, 11684817910), following the instructions.

[0037] (9) Western Blot Cells or tissues were added to an appropriate amount of RIPA lysis buffer (65 mM Tris-HCl pH 7.5, 150 Mm NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) containing protease (04693132001; Roche) and phosphatase inhibitor (4906837001; Roche), sonicated, centrifuged, and the supernatant was collected to obtain total protein. Protein concentration was determined using the BCA (23225, Thermo) method. Equal masses of protein samples were added to loading buffer and separated by 10% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred to a 0.45 μm PVDF (IPVH00010, Millipore) membrane. After transfer, the PVDF membrane was blocked with 5% skim milk at room temperature for approximately 1 hour. The PVDF membrane was washed three times with TBST for 5 minutes each time, and then incubated overnight at 4°C with primary antibody. Wash with TBST, add the corresponding species-specific secondary antibody (Jackson Immuno Research), and incubate at room temperature for 1 h. Develop with ECL luminescent substrate (1705062, Bio-Rad), and collect signals using a Bio-Rad gel imaging system (ChemiDoc XRS+).

[0038] The antibody information is as follows: Anti-RNF5 was purchased from Abclonal, catalog number A8351; Anti-GAPDH was purchased from CellSignaling Technology, catalog number #2118.

[0039] (10) RT-PCR Tissues or cells were lysed using TRIzol, and RNA was extracted using chloroform. The obtained RNA was then reverse transcribed using a reverse transcription kit to obtain cDNA. Primers for the target genes were designed, and Q-PCR was performed using cDNA as a template. β-actin was used as an internal control to analyze the relative expression levels of each gene mRNA.

[0040] Primer sequence information is shown in Table 1: Table 1 Primer sequences Example 1: Expression of RNF5 protein during ALI Mice were divided into PBS and LPS 24h groups, and A549 cells were divided into PBS and LPS 3h, 6h, 12h, and 24h groups. LPS group cells were stimulated with LPS, and PBS group cells were stimulated with PBS. Then, the mouse PBS group and A549 cell PBS group were used as controls for RT-PCR, WB, HE staining, and RNF5 immunofluorescence staining experiments.

[0041] The results are as follows Figure 1 As shown in Figure A, compared to the PBS control group, mouse lung tissue showed significant inflammatory infiltration and alveolar structural damage after 24 hours of LPS stimulation. Figure B showed a significantly elevated lung tissue pathological score, indicating successful establishment of the mouse lung injury model. Figures C and D showed that, compared to the PBS group, the mRNA and protein expression levels of RNF5 in the lung tissue of mice in the LPS group were significantly increased. Figures E and F showed that, compared to the PBS group, the RNF5 protein expression intensity per unit area was significantly increased after LPS stimulation. Similarly, A549 cells were treated with PBS and LPS respectively in vitro to simulate alveolar epithelial damage caused by memory lung injury. The statistical bar chart of RNF5 mRNA expression level and the comparison chart of RNF5 protein expression level (GH) showed that the results were consistent with those in vivo in mice. After LPS stimulation, the mRNA and protein expression levels of RNF5 in A549 cells were upregulated in a time-dependent manner. The combined in vivo and in vitro results indicate that RNF5 is significantly upregulated during ALI and is a sensitive molecule responding to ALI.

[0042] Example 2: Effects of RNF5 knockdown on inflammation and apoptosis markers in A549 cells A549 cells infected with PLKO.1 and shRNF5 lentiviruses were divided into PBS group and LPS group. LPS group cells were stimulated with LPS for 24 h, and PBS group cells were stimulated with PBS for 24 h. PLKO.1 PBS group was used as control for WB, TUNEL staining and RT-PCR experiments.

[0043] The results are as follows Figure 2 As shown in Figure A, compared with PLKO.1, the RNF5 protein expression level of shRNF5 was significantly reduced, indicating that the RNF5 knockdown cell line was successfully constructed. Figures B and C show that compared with PLKO.1PBS, the number of TUNEL-positive cells and inflammatory chemokines in the PLKO.1LPS group were significantly increased, indicating that the cell damage was successfully constructed. Figure D shows that compared with PLKO.1LPS group, the mRNA expression levels of inflammatory factors (TNFα, IL-1β, IL-6) and chemokines (CXCL2, CXCL3, MCP1) in shRNF5LPS were significantly reduced, indicating that RNF5 knockdown can alleviate apoptosis and inflammation of A549 cells under LPS stimulation in vitro.

[0044] Example 3: Effects of RNF5 overexpression on inflammation and apoptosis markers in A549 cells A549 cells infected with GFP and RNF5 OE lentiviruses were divided into PBS group and LPS group. LPS group cells were stimulated with LPS for 24 h, and PBS group cells were stimulated with PBS for 24 h. The GFP PBS group was used as a control for WB, TUNEL staining and RT-PCR experiments.

[0045] The results are as follows Figure 3 As shown in Figure A, the RNF5 protein expression level in RNF5 OE is significantly increased compared to GFP, indicating that the RNF5 overexpression cell line was successfully constructed. Figures B, C, and D show that the number of TUNEL-positive cells and inflammatory chemokines are significantly increased in the GFP LPS group compared to GFP PBS, indicating that cell damage was successfully constructed. Compared to the GFP LPS group, the number of TUNEL-positive cells and the mRNA expression levels of inflammatory factors (TNFα, IL-1β, IL-6) and chemokines (CXCL2, CXCL3, MCP1) in the RNF5 OE LPS group are significantly increased, indicating that RNF5 overexpression can aggravate apoptosis and inflammation of A549 cells under LPS stimulation in vitro.

[0046] Example 4: RNF5 knockout can reduce apoptosis and inflammation in mice under LPS stimulation. WT and RNF5 KO mice were divided into Sham group and LPS group. LPS group mice were stimulated with LPS to construct an ALI model. Sham control mice underwent sham surgery. Afterwards, WB, HE staining, bronchoalveolar lavage fluid cell count, lung dry-wet weight ratio, bronchoalveolar lavage fluid protein quantification, TUNEL staining and RT-PCR experiments were performed.

[0047] The results are as follows Figure 4 As shown in Figure A, compared to WT, RNF5 knockout mice exhibit RNF5 protein loss, indicating successful construction of RNF5 knockout mice. Figure B, an HE staining image, shows that compared to WTSham, the WT LPS group showed alveolar wall thickening, extensive neutrophil infiltration, and alveolar edema fluid exudation, indicating significantly improved lung tissue condition in RNF5 KO mice. Figure CF shows that compared to WTSham, the WT LPS group had a significantly higher lung injury pathological score, with significantly higher total cell count, total protein content, and lung wet-to-dry weight ratio in bronchoalveolar lavage fluid, indicating successful construction of acute lung injury in vivo. Compared to the WT LPS group, the RNF5 KO mice had a significantly lower lung injury pathological score, with significantly lower total cell count, total protein content, and lung wet-to-dry weight ratio in bronchoalveolar lavage fluid, indicating that RNF5 knockdown can alleviate acute lung injury in vivo. Figure GJ shows that compared to WT LPS, RNF5... The number of TUNEL-positive cells and the mRNA expression levels of inflammatory factors (TNFα, IL-1β, IL-6) and chemokines (CXCL2, CXCL3, MCP1) were significantly reduced in the KO group, indicating that knocking out RNF5 can alleviate cell apoptosis and inflammation in mice under LPS stimulation, and ultimately improve LPS-induced acute lung injury.

[0048] Example 5: RNF5 overexpression can aggravate apoptosis and inflammation in mice under LPS stimulation. AAV6-GFP and AAV6-GFP-RNF5 mice were divided into Sham group and LPS group. LPS group mice were stimulated with LPS to construct an ALI model. The control group Sham mice underwent sham surgery. Afterwards, WB, HE staining, bronchoalveolar lavage fluid cell count, lung dry-wet weight ratio, bronchoalveolar lavage fluid protein quantification, TUNEL staining and RT-PCR experiments were performed.

[0049] The results are as follows Figure 5 As shown in Figure A: Compared with AAV6-GFP, the RNF5 protein expression in AAV6-GFP-RNF5 is increased, indicating that the RNF5 overexpression mouse model was successfully constructed. Figure B is an HE staining image, showing that compared with AAV6-GFP, the AAV6-GFP LPS group has thickened alveolar walls, extensive neutrophil infiltration, and alveolar edema fluid exudation, indicating that the lung tissue condition of AAV6-GFP-RNF5 mice is more severe. Figure CF shows that compared with AAV6-GFPSham, the lung injury pathological score of the AAV6-GFP LPS group is significantly higher, and the total number of cells, total protein, and lung wet weight to dry weight ratio in the bronchoalveolar lavage fluid are all significantly higher, indicating that the acute lung injury model was successfully constructed in vivo. Compared with the AAV6-GFP LPS group, the AAV6-GFP-RNF5 group... LPS mice showed significantly elevated lung injury pathological scores, with significant increases in total cell count, total protein content, and lung wet-to-dry weight ratio in bronchoalveolar lavage fluid (BALF), indicating that overexpression of RNF5 can exacerbate acute lung injury in vivo. Figure GJ shows that compared with AAV6-GFP-LPS, the AAV6-GFP-RNF5 group had significantly higher numbers of TUNEL-positive cells and significantly higher mRNA expression levels of inflammatory factors (TNFα, IL-1β, IL-6) and chemokines (CXCL2, CXCL3, MCP1), indicating that overexpression of RNF5 can aggravate cell apoptosis and inflammation in mice stimulated by LPS, ultimately further exacerbating LPS-induced acute lung injury.

[0050] As demonstrated in the above examples, in the LPS-induced acute lung injury model, RNF5 gene knockout reduced LPS-induced lung inflammation and type II alveolar epithelial cell apoptosis, while RNF5 overexpression significantly aggravated LPS-induced lung inflammation and apoptosis. In A549 cells, RNF5 knockdown significantly alleviated LPS-induced lung inflammation and apoptosis, while RNF5 overexpression showed the opposite effect. This suggests that RNF5 knockdown has a protective effect on the lungs, inhibiting lung inflammation and apoptosis, providing a theoretical and clinical basis for the role of RNF5 in researching new targets and strategies for the prevention and treatment of acute lung injury.

[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An formulation for the prevention and / or treatment of acute lung injury, characterized in that, This includes substances that knock down or eliminate the expression level of the RNF5 gene or protein.

2. The formulation according to claim 1, characterized in that, The substances include sgRNA, siRNA, dsRNA, shRNA, miRNA, antisense nucleic acid, antibody, enzyme, or small molecule.

3. The formulation according to claim 2, characterized in that, The nucleotide sequence of the shRNA is as follows: CCGGCGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGTCGTTTTT G and / or AATTCAAAAACGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGTC G.

4. The formulation according to claim 2, characterized in that, The nucleotide sequence of the sgRNA is GGCCTGGGAACCTGCAGTGCTGG.

5. The formulation according to claim 1, characterized in that, It also includes pharmaceutically acceptable carriers.

6. Use of the formulation according to any one of claims 1 to 5 in the preparation of a medicament for the prevention and / or treatment of acute lung injury.

7. Application of RNF5 as a target in the preparation of drugs for the prevention and / or treatment of acute lung injury.

8. The application according to claim 7, characterized in that, The drug can knock down or eliminate the gene expression of RNF5 or reduce the protein activity of RNF5.

9. The application according to claim 8, characterized in that, The method for knocking down or eliminating the gene expression of RNF5 includes gene editing using CRISPR-Cas9 technology, silencing RNF5 using recombinant plasmids containing knockout primers, siRNA, plasmid-mediated shRNA, or virus-mediated shRNA; the method for reducing the protein activity of RNF5 includes reducing protein activity using antibodies, enzymes, or small molecule compounds of RNF5.

10. The use of inhibitors of RNF5 expression in the preparation of drugs for the prevention and / or treatment of acute lung injury.

Images