Pichia pastoris engineering bacterium for expressing feline-derived erythropoietin recombinant protein

Abstract

The invention relates to pichia pastoris engineering bacteria for expressing feline-derived erythropoietin recombinant protein, and belongs to the technical field of genetic engineering bacteria. The amino acid sequence of the feline-derived erythropoietin recombinant protein is as shown in SEQ ID NO: 1. According to the invention, a yeast codon preference DNA repetitive sequence, GC content and the like of the feline-derived erythropoietin are optimized, the codon adaptation index of the feline-derived erythropoietin is increased to 0.8-1, the GC content is optimized to 40-60%, and an optimized feline-derived erythropoietin coding gene segment is obtained; the feline-derived erythropoietin recombinant protein can be effectively translated and modified in the pichia pastoris, so that the efficient expression of the feline-derived erythropoietin recombinant protein in the pichia pastoris is realized, the enzyme production efficiency of the recombinant pichia pastoris in the fermentation process is improved, the immunogenicity is reduced, and the activity and purity of the target protein are improved.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to a Pichia pastoris engineered strain that expresses a recombinant feline erythropoietin protein. Background Technology

[0002] Feline erythropoietin (EPO, NP_001009269.1) is a glycoprotein hormone with a molecular weight of 34 kDa, composed of 165 amino acids. In cats with chronic kidney disease or other conditions leading to impaired kidney function, insufficient EPO secretion can cause anemia. In such cases, treatment with feline erythropoietin can help stimulate red blood cell production and alleviate anemia symptoms.

[0003] In clinical practice, recombinant human erythropoietin (rHuEPO) is primarily used, including both short-acting and long-acting forms. However, long-term use of EPO can lead to the production of anti-rHuEPO antibodies and may also stimulate anemia in cats, resulting in treatment failure. When human-derived EPO is used in animals, it is recognized as a foreign protein by the animal's body, and antibody production is more likely to occur with prolonged use. Therefore, the use of EPO in veterinary clinical practice must be extremely cautious and should not be abused. Thus, the development and preparation of feline erythropoietin is crucial.

[0004] Wei Xiuying (Wei Xiuying. Preparation and Preliminary Evaluation of the Application Effect of Feline Erythropoietin [D]. Guangxi University, 2024. DOI:10.27034 / d.cnki.ggxiu.2024.002343.) designed and synthesized the feline erythropoietin fusion gene rFe-EPO by linking two feline EPO protein genes to the two ends of the FC fragment of the feline IgG protein gene using flexible peptides. A eukaryotic expression vector was constructed, transfected into a mammalian cell expression system, and subclonal cell lines stably expressing feline erythropoietin rFe-EPO were obtained through limiting dilution and screening with the antibiotic G418, successfully achieving stable expression of feline erythropoietin. However, the mammalian cell expression system suffers from high cell culture costs, strict condition requirements, and low protein expression levels. Currently, a simpler method for high expression of feline erythropoietin is needed. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Pichia pastoris engineered strain that efficiently and stably expresses feline erythropoietin recombinant protein.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a feline erythropoietin recombinant protein, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0008] This invention utilizes genetic engineering techniques to optimize the coding gene of feline erythropoietin, enabling effective translation and modification of the recombinant feline erythropoietin protein in Pichia pastoris. This allows the strain to efficiently express the recombinant feline erythropoietin protein, ensuring its activity and protein stability.

[0009] Secondly, the present invention provides a nucleic acid molecule encoding the recombinant feline erythropoietin protein, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0010] Thirdly, the present invention provides a recombinant vector expressing the feline erythropoietin recombinant protein, wherein the recombinant vector contains the nucleic acid molecule.

[0011] Furthermore, the skeletal vector of the recombinant vector includes pGAPZαA, pPICZαA, or pPIC9K.

[0012] Fourthly, the present invention provides a recombinant Pichia pastoris engineered strain containing the recombinant vector.

[0013] The Pichia pastoris expression system features rapid cell growth, ease of culture, and simple genetic manipulation. It also allows for the correct processing, modification, and rational spatial folding of expressed proteins. Pichia pastoris utilizes the methanol-induced alcohol oxidase (AOX1) promoter and the glyceraldehyde-3-phosphate dehydrogenase promoter PGAP, enabling strict control over the expression of exogenous genes. It also boasts advantages such as simple nutritional requirements, high genetic stability of exogenous genes, high secretion of exogenous proteins, and ease of purification.

[0014] Furthermore, the chassis strain of the recombinant Pichia pastoris engineered strain includes Pichia pastoris X33, SMD1168H, GS115, or KM71.

[0015] Fifthly, the present invention provides a method for preparing recombinant feline erythropoietin, wherein the nucleic acid molecule is transferred into Pichia pastoris and induced to express.

[0016] Furthermore, the recombinant vector was transferred into Pichia pastoris and induced to express.

[0017] Furthermore, the characteristic feature is that the Pichia pastoris includes Pichia pastoris X33, SMD1168H, GS115 or KM71.

[0018] Furthermore, the inducing agents used in the induced culture include methanol and / or sorbitol.

[0019] Furthermore, the inducing agent is a mixture of methanol and sorbitol solution.

[0020] Preferably, the sorbitol concentration is 50% (w / v), and the methanol and sorbitol solutions have the same volume.

[0021] Furthermore, the inducer is added twice a day, morning and evening, with an 8-hour interval between the two additions.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] This invention optimizes the yeast codon-biased DNA repetitive sequence and GC content of feline erythropoietin, increasing its codon fitness index to between 0.8 and 1 and optimizing the GC content to between 40% and 60%. This yields an optimized feline erythropoietin encoding gene fragment, promoting its efficient translation and modification in Pichia pastoris. This results in the efficient expression of recombinant feline erythropoietin protein in Pichia pastoris, improving enzyme production efficiency during fermentation, reducing immunogenicity, and enhancing the activity and purity of the target protein. Attached Figure Description

[0024] Figure 1 This is a PCR amplification diagram of a feline erythropoietin (FEPO) fragment. Lanes 1 and 2 show the FEPO fragment.

[0025] Figure 2 Electrophoresis diagram of the pPICZαA expression vector. Lane 1 represents the pPICZαA expression vector.

[0026] Figure 3 This is an electrophoresis image of the double-digested pPICZαA vector. Lane 1: pPICZαA expression vector (undigested); Lane 2: pPICZαA expression vector (double-digested).

[0027] Figure 4 The results show the identification of Escherichia coli colonies containing the pPICZαA-FEPO recombinant vector. Lanes 1-8 correspond to pPICZαA-FEPO Escherichia coli 1-8, respectively.

[0028] Figure 5 This is the plasmid map of pPICZαA-FEPO.

[0029] Figure 6 This is an electrophoresis image of the pPICZαA-FEPO recombinant vector. Lane 1 represents the pPICZαA-FEPO recombinant vector.

[0030] Figure 7 This is an electrophoresis image of the linearized pPICZαA-FEPO recombinant vector. Lane 1 shows the pPICZαA-FEPO recombinant vector before linearization (control); lane 2 shows the linearized pPICZαA-FEPO recombinant vector.

[0031] Figure 8 This is an electrophoresis image showing the positive identification of strain X33-pPICZαA-FEPO. Lanes 1 to 24 correspond to strains X33-pPICZαA-FEPO-(1 to 24), respectively.

[0032] Figure 9 This is an electrophoresis image of the protein immunoblotting supernatant of strain X33-pPICZαA-FEPO. Lane 1 is strain X33-pPICZαA-FEPO-1; lane 2 is strain X33-pPICZαA-FEPO-10; lane 3 is strain X33-pPICZαA-FEPO-14; lane 4 is strain X33-pPICZαA-FEPO-15; lane 5 is strain X33-pPICZαA-FEPO-16; lane 6 is strain X33-pPICZαA-FEPO-18; lane 7 is strain X33-pPICZαA-FEPO-19; lane 8 is strain X33-pPICZαA-FEPO-20; and lane 9 is strain X33-pPICZαA-FEPO-22.

[0033] Figure 10 Electrophoresis diagram for positive identification of strain SMD1168H-pPICZαA-FEPO. Lanes 1 to 24 correspond to strains SMD1168H-pPICZαA-FEPO-(1 to 24), respectively.

[0034] Figure 11This is an electrophoresis image of the protein immunoblotting supernatant from the bacterial culture of strain SMD1168H-pPICZαA-FEPO. Lane 1 is for strain SMD1168H-pPICZαA-FEPO-4; lane 2 is for strain SMD1168H-pPICZαA-FEPO-13; lane 3 is for strain SMD1168H-pPICZαA-FEPO-16; lane 4 is for strain SMD1168H-pPICZαA-FEPO-17; lane 5 is for strain SMD1168H-pPICZαA-FEPO-18; lane 6 is for strain SMD1168H-pPICZαA-FEPO-19; lane 7 is for strain SMD1168H-pPICZαA-FEPO-20; lane 8 is for strain SMD1168H-pPICZαA-FEPO-21; and lane 9 is for strain SMD1168H-pPICZαA-FEPO-22.

[0035] Figure 12 This is an electrophoresis image of the pGAPZαA expression vector. Lane 1 represents the pGAPZαA expression vector.

[0036] Figure 13 This is an electrophoresis image of the double-digested pGAPZαA vector. Lane 1 shows the double-digested pGAPZαA expression vector; lane 2 shows the undigested pGAPZαA expression vector (control).

[0037] Figure 14 The results of colony identification of Escherichia coli containing the pGAPZαA-FEPO recombinant vector.

[0038] Figure 15 This is a plasmid map of pGAPZαA-FEPO.

[0039] Figure 16 Electrophoresis image of the pGAPZαA-FEPO recombinant vector in large-scale nucleic acid extraction. Lane 1: pGAPZαA-FEPO recombinant vector.

[0040] Figure 17 Linearization of the pGAPZαA-FEPO plasmid was performed. Lane 1 contained the unlinearized pGAPZαA-FEPO recombinant plasmid (control); lane 2 contained the linearized pGAPZαA-FEPO recombinant plasmid (control).

[0041] Figure 18 Electrophoresis image for positive identification of recombinant yeast strain X33-pGAPZαA-FEPO. Lanes 1-9 correspond to strains X33-pGAPZαA-FEPO-(1-9) respectively.

[0042] Figure 19This is an electrophoresis image of the protein immunoblotting supernatant of the recombinant X33-pGAPZαA-FEPO strain. Lanes 1-4 correspond to strains X33-pGAPZαA-FEPO-(1-4), respectively. Lane 1: X33-pGAPZαA-FEPO-1; Lane 2: X33-pGAPZαA-FEPO-2; Lane 3: X33-pGAPZαA-FEPO-3; Lane 4: X33-pGAPZαA-FEPO-4.

[0043] Figure 20 Electrophoresis diagram for positive identification of strain SMD1168H-pGAPZαA-FEPO. Lanes 1-24 correspond to strains SMD1168H-pGAPZαA-FEPO-(1-24), respectively.

[0044] Figure 21 Electrophoresis image of Western blot detection of protein from the supernatant of recombinant SMD1168H-pGAPZαA-FEPO bacterial culture. Lane 1 is SMD1168H-pGAPZαA-FEPO-5; Lane 2 is SMD1168H-pGAPZαA-FEPO-8; Lane 3 is SMD1168H-pGAPZαA-FEPO-10; Lane 4 is SMD1168H-pGAPZαA-FEPO-12; Lane 5 is SMD1168H-pGA PZαA-FEPO-15; Lane 6 is SMD1168H-pGAPZαA-FEPO-16; Lane 7 is SMD1168H-pGAPZαA-FEPO-18; Lane 8 is SMD1168H-pGAPZαA-FEP O-20; and Lane 9 is SMD1168H-pGAPZαA-FEPO-21.

[0045] Figure 22 Electrophoresis images showing the immunoblotting detection of protein expression levels in four recombinant feline EPO expression strains. Lane 1: SMD1168H-pGAPZαA-FEPO-21 strain; Lane 2: X33-pGAPZαA-FEPO-4 strain; Lane 3: SMD1168H-pPICZαA-FEPO-19 strain; Lane 4: X33-pPICZαA-FEPO-14 strain. Detailed Implementation

[0046] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, other materials and reagents used in the embodiments are commercially available.

[0047] Example 1: Construction of X33-pPICZαA-FEPO (XP-FEPO) Pichia pastoris engineered strain

[0048] 1. Optimize the design of target genes

[0049] The amino acid sequence information of feline erythropoietin (FEPO, NCBI accession number NP_001009269.1) was retrieved using NCBI. The gene sequence information corresponding to the amino acid sequence A27-R192 in the mature region (NM_001009269.1) was selected, and the selected cDNA sequence was optimized. Optimization parameters included yeast codon-biased DNA repeat sequences and GC content, increasing the codon fitness index to between 0.8 and 1 and optimizing the GC content to between 40% and 60%, resulting in the optimized feline EPO nucleotide sequence. The amino acid sequence of feline erythropoietin is shown in SEQ ID NO: 1, and the optimized nucleotide sequence of feline erythropoietin is shown in SEQ ID NO: 2.

[0050] APPRLICDSRVLERYILGAREAENVTMGCAEGCSFSENITVPDTKVNFYTWKRMDVGQQAVEVWQGLALLSEAILRGQALLANSSQPSETLQLHVDKAVSSLRSLTSLLRALGAQKEATSLPEATSAAPLRTFTVDTLCKLFRIYSNFLRGKLTLYTGEACRRGDR* (SEQ ID NO: 1).

[0051] GCACCACCAAGATTGATCTGTGACTCCAGAGTTTTGGAGAGGTACATCTTGGGTGCTAGAGAGGCTGAGAACGTTACTATGGGTTGTGCTGAAGGTTGCTCCTTCTCCGAAAACATCACTGTTCCA GACACCAAGGTCAACTTCTACACCTGGAAGAGAATGGACGTTGGTCAGCAAGCTGTTGAGGTTTGGCAAGGTTTGGCTTTGTTGTCCGAGGCTATTTTGAGAGGTCAAGCTTTGCTGGCTAACTCT TCTCAACCATCCGAAACCTTGCAGTTGCACGTTGACAAGGCTGTGTCCTCTTTGAGATCCTTGACCTCCTTGTTGAGAGCTTTGGGTGCTCAGAAAGAGGCTACTTCTTTGCCAGAAGCTACTTCC GCTGCTCCATTGAGAACTTTCACTGTTGACACCCTGTGCAAGTTGTTCAGAATCTACTCCAACTTCCTGAGGGGTAAGTTGACTCTGTACACTGGTGAGGCTTGTGAAGAGGTGACAGATAA(SEQ ID NO: 2).

[0052] 2. Amplify gene fragments

[0053] Based on the restriction enzyme site information on the multiple cloning site of the Pichia pastoris expression vector, a homologous sequence of the restriction endonuclease site XhoI and the corresponding nucleotide sequence of the proteinase Kex2 recognition sequence (Lys-Arg) were added to the 5' end of the optimized feline erythropoietin nucleotide sequence, and a homologous sequence of the restriction endonuclease site XbaI was added to the 3' end. The fragment was then synthesized by Sangon Biotech (Shanghai) Co., Ltd., resulting in the optimized feline erythropoietin gene fragment with added restriction enzyme sites (SEQ ID NO: 3). The optimized feline erythropoietin gene fragment with added restriction enzyme sites was ligated into the universal plasmid pUC57 by Sangon Biotech (Shanghai) Co., Ltd., then transformed into E. coli and preserved in bacterial culture.

[0054] CTCGAGAAGAGAGCACCACCAAGATTGATCTGTGACTCCAGAGTTTTGGAGAGGTACATCTTGGGTGCTAGAGAGGCTGAGAACGTTACTATGGGTTGTGCTGAAGGTTGCTCCTTCTCCGAAAACATCAC TGTTCCAGACACCAAGGTCAACTTCTACACCTGGAAGAGAATGGACGTTGGTCAGCAAGCTGTTGAGGTTGGCAAGGTTTGGCTTTGTTGTCCGAGGCTATTTTGAGAGGTCAAGCTTTGCTGGCTAACT CTTCTCAACCATCCGAAACCTTGCAGTTGCACGTTGACAAGGCTGTGTCCTCTTTGAGATCCTTGACCTCCTTGTTGAGAGCTTTGGGTGCTCAGAAAGAGGCTACTTCTTTGCCAGAAGCTACTTCCGCT GCTCCATGAGAACTTTCACTGTTGACACCCTGTGCAAGTTGTTCAGAATCTACTCCAACTTCCTGAGGGGTAAGTTGACTCTGTACACTGGTGAGGCTTGTGAAGAGGTGACAGATAATCTAGA(SEQID NO: 3).

[0055] An optimized feline erythropoietin gene fragment with added restriction enzyme sites was amplified by PCR. The amplified product was detected by 1% (w / v) agarose gel electrophoresis. The product was then excised and recovered after it met the expected fragment size.

[0056] The upstream primer used for PCR amplification was 5'-GAAGAAGGGGTATCTCTCGAGAAGAGAGCACCACCAAGATTGATCTGTGAC-3' (SEQ ID NO: 4), and the downstream primer was 5'-CT GAGATGAGTTTTTGTTCTAGATTATCTGTCACCTCTTCTACAAGCCTCAC-3' (SEQ ID NO: 5).

[0057] The PCR amplification system (100 μL) consisted of: 3 μL of upstream primer (10 μmol / L), 3 μL of downstream primer (10 μmol / L), 2 μL of bacterial culture, 42 μL of ddH2O, and 50 μL of 2×Phanta Flash Master Mix (brand: Novizan, catalog number: P510-03).

[0058] The PCR amplification program was as follows: 98℃ for 30s, 1 cycle; 98℃ for 10s, 56℃ for 5s, 72℃ for 5s, 35 cycles; 72℃ for 1min, 1 cycle; constant temperature at 12℃.

[0059] The results are as follows Figure 1 As shown, the theoretical molecular weight of FEPO obtained by PCR amplification is 15.8 kDa, and its length is 462 bp. It was excised and recovered for later use.

[0060] To facilitate the identification of positive recombinant bacteria in the later stage, a gene covering a certain length of homologous arm was used. After adding the identification primer length, the PCR length for positive identification was 858 bp (covering the target gene).

[0061] 3. Construction of pPICZαA-FEPO recombinant vector

[0062] (1) Extraction of expression plasmid: E. coli containing the pPICZαA expression vector were cultured and expanded. The pPICZαA expression vector was extracted using the Nanjing Novizan Plasmid Large-Scale Extraction Kit (brand: Novizan, catalog number: DC202-01) (electrophoresis image as shown). Figure 2 (As shown), the pPICZαA expression vector was purified by chloroform extraction, double-digested with XbaI and XhoI enzymes, and purified by chloroform extraction to obtain the double-digested pPICZαA vector. The double-digested pPICZαA vector was detected by 1.2% (w / v) agarose gel electrophoresis, and the results are shown below. Figure 3 As shown.

[0063] (2) Using the ClonExpress MLtra One Step Cloning Kit (brand: Novizan, catalog number: C112), the amplified and recovered feline EPO (FEPO) fragment was ligated with the double-digested and recovered pPICZαA vector to obtain the pPICZαA-FEPO recombinant vector. The pPICZαA-FEPO recombinant vector was then transformed into E. coli TOP10 to obtain E. coli containing the pPICZαA-FEPO recombinant vector. The E. coli containing the pPICZαA-FEPO recombinant vector was cultured in LB medium at 37°C for 1 hour, centrifuged, and plated on LB plates supplemented with 100 μg / mL bleomycin (Zeocin). The plates were then cultured at 37°C in the dark until single colonies grew.

[0064] The molar ratio of the inserted FEPO fragment to the double-digested pPICZαA vector in the ligation system was 2:1, the final concentration of the inserted FEPO fragment was 0.006 pmol / L, and the final concentration of the inserted double-digested pPICZαA vector was 0.003 pmol / L.

[0065] The seamless cloning ligation system (10 μL) consisted of: 2 μL of 5×CE MultiS Buffer, 1 μL of Exnase MultiS, 1 μL of double-digested pPICZαA vector (0.03 pmol / L), 1 μL of inserted FEPO fragment (0.06 pmol / L), and 5 μL of ddH2O.

[0066] The seamless cloning reaction program is as follows: 37℃ for 30 min, 1 cycle; 4℃, 1 cycle, isothermal.

[0067] (3) Identification of positive colonies of Escherichia coli containing the pPICZαA-FEPO recombinant vector

[0068] Single colonies cultured on LB plates in step (2) were picked and inoculated into LB medium supplemented with 100 μg / mL Zeocin. The culture was then incubated at 37°C in a shaker until the cells became turbid. PCR was then performed for positive identification. The PCR amplification products were detected by 1% (w / v) agarose gel electrophoresis to determine whether the transformation was successful and whether the selected colonies were the target colonies. To facilitate the identification of positive recombinant yeast in the later stages, a pair of primers was designed at both ends of the target gene on the vector. Combined with a portion of the sequence length on the vector, the PCR length for positive identification was 903 bp (covering the target gene).

[0069] The upstream primer used for PCR positive identification was 5'-GCATCCTCCGCATTAGCTGCTCCAGT CAACACTAC-3' (SEQ ID NO: 6), and the downstream primer was 5'-CTGCATCTCTCAGGCA AATGGCATTCTGACATCCTC-3' (SEQ ID NO: 7).

[0070] The PCR amplification system consisted of: 0.2 μL of upstream primer (10 μmol / L), 0.2 μL of downstream primer (10 μmol / L), 0.5 μL of bacterial culture, 4.1 μL of ddH2O, and 5 μL of 2×SanTaq PCR Master Mix (Sangon Biotech (Shanghai) Co., Ltd.).

[0071] The PCR positive identification procedure was as follows: pre-denaturation: 94℃ for 4 min, 1 cycle; denaturation: 94℃ for 30 s, 35 cycles; annealing: 58℃ for 30 s, 35 cycles; extension: 72℃ for 55 s, 35 cycles; final extension: 72℃ for 2 min, 1 cycle; 12℃, 1 cycle, isothermal.

[0072] The results of positive colony identification of Escherichia coli containing the pPICZαA-FEPO recombinant vector are as follows: Figure 4 As shown, the product conforms to the expected fragment size. The plasmid map of pPICZαA-FEPO is detailed below. Figure 5 As shown.

[0073] 4. Construct a linearized pPICZαA-FEPO recombinant vector and electroporate it.

[0074] After expanding the culture of E. coli containing the pPICZαA-FEPO recombinant vector, plasmid (pPICZαA-FEPO recombinant vector) was extracted (kit brand: Novizan, catalog number: DC202-01), and the band size was detected by 1% agarose gel electrophoresis. The detection results are as follows. Figure 6 As shown in the figure. The pPICZαA-FEPO recombinant vector was purified by chloroform extraction, digested with SacI (brand: NEB, catalog number: R3156S), and extracted with chloroform to obtain the linearized pPICZαA-FEPO recombinant vector. The results were detected by 1% agarose gel electrophoresis. Figure 7 As shown.

[0075] The SacI enzyme digestion system consisted of: 4 μL linearized SacI enzyme, 50 μL 10×CutSmart, 400 μL (200 μg) pPICZαA-FEPO recombinant vector, and 46 μL ddH2O. Digestion was carried out at 37℃ for 3 h.

[0076] The linearized pPICZαA-FEPO recombinant vector was electroporated into Pichia pastoris X33 to obtain Pichia pastoris X33 transformed with the pPICZαA-FEPO recombinant vector. The bacterial culture was resuspended with 1 mol / L sorbitol, incubated in a 30°C water bath for 1 h, and then transferred to a shaking incubator and cultured at 30°C and 200 rpm for 2 h. After centrifugation at 4500g for 5 min, part of the supernatant was discarded, and the precipitated bacterial culture was resuspended. The bacterial culture was then spread on YPD plates supplemented with 300 μg / mL Zeocin and cultured at 30°C until single colonies grew.

[0077] 5. Positive identification of strain X33-pPICZαA-FEPO

[0078] Pick a single colony obtained in step 4 and inoculate it into a 2 mL EP tube. Incubate at 37°C for 8 h. Lyse the bacteria by quick freezing in liquid nitrogen and sonication. Perform positive identification using PCR and agarose gel electrophoresis as described in step 3(3). The identification results are as follows: Figure 8 As shown, the obtained positive strain was named X33-pPICZαA-FEPO.

[0079] 6. Induced expression

[0080] The X33-pPICZαA-FEPO strain was inoculated into shake flasks of BMMY medium at pH 6.0 and cultured at 30°C and 200 rpm on a shaker. When OD600 = 1, the target protein expression was induced using an inducer. The amount of inducer added was calculated based on the measured OD600. The inducer was added twice daily (12 hours apart), morning and evening. The calculation method was: inducer amount (μL) = OD600 / 1. 600 × Dilution factor before detection × Culture medium volume × 0.05 × 10; The inducer is a mixture of methanol and sorbitol solution, in which the sorbitol concentration is 50% (w / v), and the methanol and sorbitol solutions are of equal volume.

[0081] 7. Detection and analysis of target protein using Western blot

[0082] Prepare a 12% (w / v) SDS-protein gel according to the protein molecular weight. Take 20 μL of the supernatant after centrifugation and add it to 5×portein buffer. Boil in water for 5 min. After SDS electrophoresis, transfer the membrane and block it in blocking buffer (TBST buffer containing 5% w / v skim milk powder) for 2 h. Incubate with primary antibody (rabbit anti-EPO polyclonal antibody, manufacturer: Sangon Biotech (Shanghai) Co., Ltd., catalog number: D161653) and secondary antibody (HRP-labeled mouse anti-rabbit IgG, manufacturer: Sangon Biotech (Shanghai) Co., Ltd., catalog number: D110065). Wash the membrane with TBST buffer, expose and develop. Prepare developing solution according to the instructions of the superPico ECLC Chemiluminescence Kit (manufacturer: Novizan, catalog number: E422-01): drop the developing solution onto the membrane, react in the dark for 5 min, and then develop and photograph using a chemiluminescence imaging system. Figure 9 As shown, the target band is present between the 25 kDa and 35 kDa bands. Since erythropoietin is a highly glycosylated protein, glycosylation during yeast expression results in a molecular weight slightly larger than the theoretical value. The X33-pPICZαA-FEPO-14 strain exhibited the best expression performance.

[0083] Example 2: Construction of SMD1168H-pPICZαA-FEPO(SP-FEPO) Pichia pastoris engineered strain

[0084] Following steps 1-4 of Example 1, a linearized pPICZαA-FEPO recombinant vector was constructed and electroporated to obtain Pichia pastoris SMD1168H transformed into the pPICZαA-FEPO recombinant vector. The vector was then cultured until single colonies appeared. The difference was that the Pichia pastoris strain X33 used in the substrate was replaced with Pichia pastoris SMD1168H. Then, following step 5 of Example 1, a positive strain of SMD1168H-pPICZαA-FEPO was obtained. The difference was that the single colonies used were obtained from culturing Pichia pastoris SMD1168H transformed into the pPICZαA-FEPO recombinant vector. The positive identification results are as follows: Figure 10 As shown, the identification results of the recombinant yeast are in line with expectations.

[0085] The target protein of the SMD1168H-pPICZαA-FEPO positive strain was analyzed by immunoblotting according to step 7 of Example 1. Figure 11 As shown, there is a target band between the 25KDa and 35KDa bands. Since erythropoietin is a highly glycosylated protein, the glycosylation modification during yeast expression makes its molecular weight slightly larger than the theoretical molecular weight. The SMD1168H-pPICZαA-FEPO-19 strain showed the best expression effect.

[0086] Example 3: Construction of X33-pGAPZαA-FEPO (XG-FEPO) Pichia pastoris engineered strain

[0087] Following steps 1-3 of Example 1, the pGAPZαA-FEPO recombinant vector was constructed, except that the backbone vector pPICZαA was replaced with pGAPZαA. The electrophoresis image of the extracted pGAPZαA expression vector is shown below. Figure 12 As shown, the electrophoresis image of the double-digested pGAPZαA vector is as follows. Figure 13 As shown. The results of positive colony identification of *E. coli* containing the pGAPZαA-FEPO recombinant vector are as follows. Figure 14 As shown, the product conforms to the expected fragment size. The plasmid map of pGAPZαA-FEPO is detailed below. Figure 15 As shown.

[0088] Following the method in step 4 of Example 1, a linearized pGAPZαA-FEPO recombinant vector was constructed and electroporated to obtain Pichia pastoris X33 transformed with the pGAPZαA-FEPO recombinant vector. The cells were cultured until single colonies appeared. The difference was that the pPICZαA-FEPO recombinant vector was replaced with the pGAPZαA-FEPO recombinant vector. After expanding the culture of E. coli containing the pGAPZαA-FEPO recombinant vector, plasmid (pGAPZαA-FEPO recombinant vector) extraction was performed. Electrophoresis results are shown below. Figure 16As shown in the figure. The pGAPZαA-FEPO recombinant vector was purified by chloroform extraction, digested with BlnI (brand: Takara, catalog number: 1022A), and extracted with chloroform to obtain the linearized pGAPZαA-FEPO recombinant vector. The results were detected by 1% agarose gel electrophoresis. Figure 17 As shown. The BlnI enzyme digestion system consisted of: 6 μL linearized BlnI enzyme, 50 μL 10×CutSmart, 400 μL (200 μg) pGAPZαA-FEPO recombinant vector, and 44 μL ddH2O. Digestion was carried out at 37℃ for 3 h.

[0089] Following the method in step 5 of Example 1, an X33-pGAPZαA-FEPO positive strain was obtained. The difference was that the single colony used was a single colony obtained from Pichia pastoris X33 transformed with the pGAPZαA-FEPO recombinant vector. The positive identification results are as follows: Figure 18 As shown, the identification results of the recombinant yeast are in line with expectations.

[0090] The target protein of the X33-pGAPZαA-FEPO positive strain was analyzed by immunoblotting according to step 7 in Example 1. Figure 19 As shown, there is a target band between the 25KDa and 35KDa bands. Since erythropoietin is a highly glycosylated protein, the glycosylation modification during yeast expression makes its molecular weight slightly larger than the theoretical molecular weight, about 35KDa. The X33-pGAPZαA-FEPO-4 strain showed the best expression effect.

[0091] Example 4: Construction of SMD1168H-pGAPZαA-FEPO (SG-FEPO) Pichia pastoris engineered strain

[0092] Following the method in Example 3, the pGAPZαA-FEPO recombinant vector and a linearized pGAPZαA-FEPO recombinant vector were constructed and electroporated to obtain Pichia pastoris SMD1168H transformed into the pGAPZαA-FEPO recombinant vector. The strain was cultured until a single colony grew, yielding an SMD1168H-pGAPZαA-FEPO positive strain. The difference was that the Pichia pastoris X33 strain used in the substrate was replaced with Pichia pastoris SMD1168H. The positive identification results are as follows: Figure 20 As shown, the identification results of the recombinant yeast are in line with expectations.

[0093] The target protein of the SMD1168H-pGAPZαA-FEPO positive strain was detected and analyzed by immunoblotting according to the method in Example 3. Figure 21As shown, there is a target band between the 25KDa and 35KDa bands. Since erythropoietin is a highly glycosylated protein, the glycosylation modification during yeast expression makes its molecular weight slightly larger than the theoretical molecular weight, about 35KDa. The SMD1168H-pGAPZαA-FEPO-21 strain showed the best expression effect.

[0094] Implementation Case 5: Comparison of expression levels of four recombinant feline EPO expression strains

[0095] The supernatant fermentation broth samples of the four highest expression strains were analyzed by Western blotting under the same conditions as in Example 1. Figure 22 The results showed that the expression levels of strain SMD1168H-pPICZαA-FEPO-19 in lane 3 and strain X33-pPICZαA-FEPO-14 in lane 4 were the highest and comparable.

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A recombinant feline erythropoietin protein, characterized in that, The amino acid sequence of the feline erythropoietin recombinant protein is shown in SEQ ID NO:

1.

2. A nucleic acid molecule encoding the feline erythropoietin recombinant protein of claim 1, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

2.

3. A recombinant vector expressing the feline erythropoietin recombinant protein of claim 1, characterized in that, The recombinant vector contains the nucleic acid molecule described in claim 2.

4. The recombinant vector as described in claim 3, characterized in that, The scaffold vector of the recombinant vector includes pGAPZαA, pPICZαA, or pPIC9K.

5. A recombinant Pichia pastoris engineered strain, characterized in that, The recombinant Pichia pastoris engineered strain contains the recombinant vector described in claim 3 or 4.

6. The recombinant Pichia pastoris engineered strain as described in claim 5, characterized in that, The chassis strain of the recombinant Pichia pastoris engineered strain includes Pichia pastoris X33, SMD1168H, GS115, or KM71.

7. A method for preparing the feline erythropoietin recombinant protein of claim 1, characterized in that, The nucleic acid molecule described in claim 2 was transferred into Pichia pastoris and induced to express.

8. The method as described in claim 7, characterized in that, The recombinant vector described in claim 3 or 4 is transferred into Pichia pastoris and induced to express.

9. The method as described in claim 8, characterized in that, The Pichia pastoris includes Pichia pastoris X33 or SMD1168H, GS115 or KM71.

10. The method as described in claim 9, characterized in that, The inducing agents used in the induction culture include methanol and / or sorbitol.

Images