Culture medium and culture method for amplifying adult kidney stem cells of mice

Abstract

The invention discloses a culture medium and a culture method for amplifying adult kidney stem cells of mice, and relates to the technical field of stem cell culture. Comprising the following components: a fibroblast growth factor, interleukin-6, an insulin-like growth factor-1, a hepatocyte growth factor, a platelet-derived growth factor, a vascular endothelial growth factor, ascorbic acid, insulin, a growth hormone, hydrocortisone, Y-27632, CHIR99021, bovine serum albumin, linoleic acid, linolenic acid, 1-20 [mu] g / mL of alanine, 1-20 [mu] g / mL of asparagine, 1-20 [mu] g / mL of glutamic acid and the balance of water. The invention relates to the field of medicine, in particular to a medicine for preventing and treating diseases. The culture medium provided by the invention can be used for continuously and stably culturing more than 25 generations of adult kidney stem cells of mice, and a more stable kidney stem cell long-term in-vitro amplification system is established compared with an international existing culture system.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of stem cell culture, and more particularly to a culture medium and culture method for expanding mouse adult renal stem cells. BACKGROUND

[0002] As a key organ for excreting metabolic products, maintaining water-salt-electrolyte balance and endocrine regulation, the kidney is susceptible to damage and even functional failure due to toxicants, ischemia or chronic diseases. Studies have shown that there are multiple cell populations with regenerative potential in mammalian kidneys, and in particular, after renal tubular injury, some residual cells can be activated to a regenerative state, and research has suggested the existence of a "renal stem / progenitor cell" population with certain self-renewal and differentiation potential. Such cells are an important basis for future renal regenerative medicine and individualized treatment research.

[0003] However, current research and in vitro culture systems for mouse adult renal progenitor cells (RPC) are not mature. Traditional primary renal epithelial cells or renal tubular cells are prone to aging, loss of stemness, and limited expansion capacity under conventional conditions. Some literature reports the use of 3D culture (such as Matrigel) to induce the formation of "renal tubular organoids" or "glomerular organoids", but this method has the following problems: high cost, large batch differences, and difficulty in standardization; long culture period, low cell expansion efficiency; limited ability of adult-derived cells to maintain stemness and differentiation potential.

[0004] In addition, studies have shown that Sox9 + , Pax2 + and other marker cells in the adult kidney have certain stemness and regenerative capacity. Therefore, establishing a Matrigel-independent two-dimensional culture system that can efficiently maintain and expand mouse adult renal stem cells is of great significance for advancing stem cell transplantation therapy, kidney organoid construction, individualized drug development, and renal toxicity evaluation.

[0005] In summary, developing a two-dimensional culture system with clear composition, stability, and high efficiency, which can expand adult renal stem cells without external matrix, is a key requirement in the current field of renal regenerative medicine. SUMMARY

[0006] Therefore, the present application provides a culture medium and culture method for expanding mouse adult renal stem cells.

[0007] To achieve the above purpose, the present application adopts the following technical solutions:

[0008] A culture medium for expanding mouse adult renal stem cells, the culture medium comprising the following components:

[0009] fibroblast growth factor 1-100 ng / mL, interleukin-6 1-100 ng / mL, insulin-like growth factor-1 1-100 ng / mL, hepatocyte growth factor 1-100 ng / mL, platelet-derived growth factor 1-100 ng / mL, vascular endothelial growth factor 1-100 ng / mL, ascorbic acid 50-200 μg / mL, insulin 1-100 μg / mL, growth hormone 1-100 ng / mL, hydrocortisone 0.1-20 μg / mL, Y-27632 1-10 μM, CHIR99021 1-10 μM, bovine serum albumin 100-500 mg / mL, linoleic acid 0.1-1 mg / mL, linolenic acid 0.1-1 mg / mL, alanine 1-20 μg / mL, asparagine 1-20 μg / mL, glutamic acid 1-20 μg / mL, glycine 1-20 μg / mL, proline 1-20 μg / mL, serine 1-20 μg / mL, arginine 1-50 μg / mL.

[0010] Further, the culture medium comprises the following components:

[0011] fibroblast growth factor 50 ng / mL, interleukin-6 10 ng / mL, insulin-like growth factor-1 100 ng / mL, hepatocyte growth factor 50 ng / mL, platelet-derived growth factor 50 ng / mL, vascular endothelial growth factor 50 ng / mL, ascorbic acid 200 μg / mL, insulin 10 μg / mL, growth hormone 100 ng / mL, hydrocortisone 1 μg / mL, Y-27632 5 μM, CHIR99021 6 μM, bovine serum albumin 250 mg / mL, linoleic acid 0.5 mg / mL, linolenic acid 0.5 mg / mL, alanine 8.9 μg / mL, asparagine 13.3 μg / mL, glutamic acid 14.7 μg / mL, glycine 7.5 μg / mL, proline 11.5 μg / mL, serine 10.5 μg / mL, arginine 21 μg / mL.

[0012] Further, DMEM / F12 is used as the solvent.

[0013] A method for preparing a culture medium for expanding mouse adult kidney stem cells, comprising the following steps:

[0014] (1) respectively dissolve fibroblast growth factor, interleukin-6, insulin-like growth factor-1, hepatocyte growth factor, platelet-derived growth factor, vascular endothelial growth factor, ascorbic acid, growth hormone, bovine serum albumin, alanine, asparagine, glutamic acid, glycine, proline, serine and arginine in DMEM / F12 to prepare a mother liquor;

[0015] Hydrocortisone, Y-27632, CHIR99021, linoleic acid and linolenic acid were dissolved in DMSO to prepare mother liquor, respectively;

[0016] Insulin was dissolved in 0.01M HCl to prepare mother liquor;

[0017] (2) Each mother liquor of step (1) was added to DMEM / F12 according to the final concentration of the medium.

[0018] A culture method of mouse adult kidney stem cells, comprising the following steps: culturing primary kidney cells in a gelatin-coated culture dish with the culture medium of any one of claims 1-3.

[0019] Further, the medium is changed every day during the culture process.

[0020] A mouse adult kidney stem cell, which is obtained by culturing with the culture medium of any one of claims 1-3 or the culture method of claims 5 or 6.

[0021] Use of a culture medium for expanding mouse adult kidney stem cells in the preparation of cells.

[0022] Use of a culture medium for expanding mouse adult kidney stem cells in the preparation of an expanded kidney stem cell preparation.

[0023] Use of mouse adult kidney stem cells for non-diagnostic therapeutic purposes, wherein the use is any one of:

[0024] A: in vitro study of the proliferation, differentiation and death regulation mechanism of adult kidney stem cells;

[0025] B: kidney stem cell transplantation therapy;

[0026] C: kidney organoid construction;

[0027] D: individualized drug development, screening and kidney toxicity evaluation.

[0028] According to the above technical solution, compared with the prior art, the beneficial effects of the present application are:

[0029] The culture system of the present application can continuously and stably culture mouse adult kidney stem cells for more than 25 generations under two-dimensional conditions, and maintain good cell morphology and high proliferation rate during long-term subculture. The in vitro cultured adult kidney stem cells can be differentiated into glomerular podocytes, renal tubular epithelial cells and other mature kidney functional cells.

[0030] The medium provided by the application can continuously and stably culture mouse adult kidney stem cells for more than 25 generations, compared with the existing culture system in the world, a more stable long-term in-vitro expansion system of kidney stem cells is established; the kidney stem cells can maintain high proliferation rate and multiple differentiation potential after continuous subculture, that is, have the differentiation potential to kidney tubules and glomerular cells.

[0031] The culture system provided by the application has clear components and strong controllability, is suitable for standardized production and large-scale in-vitro expansion, and has important scientific research and clinical application value for promoting stem cell treatment of kidney disease, kidney organoid construction, in-vitro screening and evaluation of nephrotoxic drugs, and the like. BRIEF DESCRIPTION OF DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description only the embodiments of the application, and for those skilled in the art, without creative labor, other drawings can also be obtained according to the provided drawings.

[0033] Figure 1 The cell morphology of the mouse adult kidney stem cells provided in the embodiment 1 of the application is shown in the following figure, wherein Figure 1 A is primary (P0), Figure 2 B is the 25th generation (P25);

[0034] Figure 2 The cell morphology of the mouse adult kidney stem cells provided in the embodiment of the application is shown in the following figure, wherein Figure 2 A is the cell morphology of the 25th generation (P25) mouse adult kidney stem cells provided in the embodiment 2, Figure 2 B is the cell morphology of the 25th generation (P25) mouse adult kidney stem cells provided in the embodiment 3;

[0035] Figure 3 The in-vitro expansion proliferation rate graph of the mouse adult kidney stem cells provided in the embodiment 1 of the application is shown in the following figure;

[0036] Figure 4 The qPCR identification of the expression of adult kidney precursor cell marker genes after the adult kidney stem cells in the embodiment 1 are continuously expanded for 25 generations is shown in the following figure;

[0037] Figure 5 The immunofluorescence staining results of the differentiation identification of the kidney stem cells cultured for 25 generations in the embodiment 1 of the application are shown in the following figure, wherein Figure 5 A is a renal tubular cell, Figure 5 B is a glomerular cell. DETAILED DESCRIPTION

[0038] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all the other embodiments obtained by a person of ordinary skill in the art without creative effort belong to the protection scope of the present application.

[0039] Sources of experimental materials:

[0040] DMEM / F12: manufacturer: Gibco; item number: C11330500BT;

[0041] Example 1

[0042] Preparation of culture medium

[0043] DMEM / F12 was used as a solvent to prepare a culture medium containing the following final concentration components, including fibroblast growth factor 50 ng / mL, interleukin-6 10 ng / mL, insulin-like growth factor-1 100 ng / mL, hepatocyte growth factor 50 ng / mL, platelet-derived growth factor 50 ng / mL, vascular endothelial growth factor 50 ng / mL, ascorbic acid 200 μg / mL, insulin 10 μg / mL, growth hormone 100 ng / mL, hydrocortisone 1 μg / mL, Y-27632 5 μM, CHIR99021 6 μM, bovine serum albumin 250 mg / mL, linoleic acid 0.5 mg / mL, linolenic acid 0.5 mg / mL, alanine 8.9 μg / mL, asparagine 13.3 μg / mL, glutamic acid 14.7 μg / mL, glycine 7.5 μg / mL, proline 11.5 μg / mL, serine 10.5 μg / mL, arginine 21 μg / mL.

[0044] Preparation method:

[0045] (1) Fibroblast growth factor was dissolved in DMEM / F12 to prepare a 50 ug / mL stock solution.

[0046] Interleukin-6 was dissolved in DMEM / F12 to prepare a 10 ug / mL stock solution.

[0047] Insulin-like growth factor-1 was dissolved in DMEM / F12 to prepare a 100 ug / mL stock solution.

[0048] Hepatocyte growth factor was dissolved in DMEM / F12 to prepare a 50 ug / mL stock solution.

[0049] Platelet-derived growth factor was dissolved in DMEM / F12 to prepare a 50 ug / mL stock solution.

[0050] Vascular endothelial growth factor was dissolved in DMEM / F12 to make a stock solution of 50 ug / mL.

[0051] Ascorbic acid was dissolved in DMEM / F12 to make a stock solution of 200 mg / mL.

[0052] Insulin was dissolved in 0.01 M HC1 overnight to dissolve, and a stock solution of 10 mg / ml was prepared.

[0053] Growth hormone was dissolved in DMEM / F12 to make a stock solution of 100 ug / mL.

[0054] Hydrocortisone was dissolved in DMSO to make a stock solution of 1 mg / mL.

[0055] Y-27632 was dissolved in DMSO to make a stock solution of 5 mM.

[0056] CHIR99021 was dissolved in DMSO to make a stock solution of 6 mM.

[0057] Bovine serum albumin was dissolved in DMEM / F12 to make a stock solution of 2.5 g / mL.

[0058] Linoleic acid was dissolved in DMSO to make a stock solution of 5 mg / mL.

[0059] Linolenic acid was dissolved in DMSO to make a stock solution of 5 mg / mL.

[0060] Alanine was dissolved in DMEM / F12 to make a stock solution of 8.9 mg / mL.

[0061] Asparagine was dissolved in DMEM / F12 to make a stock solution of 13.3 mg / mL.

[0062] Glutamic acid was dissolved in DMEM / F12 to make a stock solution of 14.7 mg / mL.

[0063] Glycine was dissolved in DMEM / F12 to make a stock solution of 7.5 mg / mL.

[0064] Proline was dissolved in DMEM / F12 to make a stock solution of 11.5 mg / mL.

[0065] Serine was dissolved in DMEM / F12 to make a stock solution of 10.5 mg / mL.

[0066] Arginine was dissolved in DMEM / F12 to make a stock solution of 21 mg / mL.

[0067] (2) The above ingredients were added to DMEM / F12 according to the final concentration of the use medium, and each stock solution of step (1) was added to DMEM / F12.

[0068] Example 2

[0069] A culture medium for amplifying mouse adult kidney stem cells, characterized in that it comprises the following components: fibroblast growth factor 1 ng / mL, interleukin-6 1 ng / mL, insulin-like growth factor-1 1 ng / mL, hepatocyte growth factor 1 ng / mL, platelet-derived growth factor 1 ng / mL, vascular endothelial growth factor 1 ng / mL, ascorbic acid 50 μg / mL, insulin 1 μg / mL, growth hormone 1 ng / mL, hydrocortisone 0.1 μg / mL, Y-27632 1 μM, CHIR99021 1 μM, bovine serum albumin 100 mg / mL, linoleic acid 0.1 mg / mL, linolenic acid 0.1 mg / mL, alanine 1 μg / mL, asparagine 1 μg / mL, glutamic acid 1 μg / mL, glycine 1 μg / mL, proline 1 μg / mL, serine 1 μg / mL, arginine 1 μg / mL.

[0070] Configuration method:

[0071] (1) Fibroblast growth factor is dissolved in DMEM / F12 to prepare a 50 ug / mL stock solution.

[0072] Interleukin-6 is dissolved in DMEM / F12 to prepare a 10 ug / mL stock solution.

[0073] Insulin-like growth factor-1 is dissolved in DMEM / F12 to prepare a 100 ug / mL stock solution.

[0074] Hepatocyte growth factor is dissolved in DMEM / F12 to prepare a 50 ug / mL stock solution.

[0075] Platelet-derived growth factor is dissolved in DMEM / F12 to prepare a 50 ug / mL stock solution.

[0076] Vascular endothelial growth factor is dissolved in DMEM / F12 to prepare a 50 ug / mL stock solution.

[0077] Ascorbic acid is dissolved in DMEM / F12 to prepare a 200 mg / mL stock solution.

[0078] Insulin is dissolved in 0.01M HCl overnight to prepare a 10 mg / mL stock solution.

[0079] Growth hormone is dissolved in DMEM / F12 to prepare a 100 ug / mL stock solution.

[0080] Hydrocortisone is dissolved in DMSO to prepare a 1 mg / mL stock solution.

[0081] Y-27632 is dissolved in DMSO to prepare a 5 mM stock solution.

[0082] CHIR99021 is dissolved in DMSO to prepare a 6 mM stock solution.

[0083] Bovine serum albumin was dissolved in DMEM / F12 to make a stock solution of 2.5 g / mL.

[0084] Linoleic acid was dissolved in DMSO to make a stock solution of 5 mg / mL.

[0085] Linolenic acid was dissolved in DMSO to make a stock solution of 5 mg / mL.

[0086] Alanine was dissolved in DMEM / F12 to make a stock solution of 8.9 mg / mL.

[0087] Asparagine was dissolved in DMEM / F12 to make a stock solution of 13.3 mg / mL.

[0088] Glutamic acid was dissolved in DMEM / F12 to make a stock solution of 14.7 mg / mL.

[0089] Glycine was dissolved in DMEM / F12 to make a stock solution of 7.5 mg / mL.

[0090] Proline was dissolved in DMEM / F12 to make a stock solution of 11.5 mg / mL.

[0091] Serine was dissolved in DMEM / F12 to make a stock solution of 10.5 mg / mL.

[0092] Arginine was dissolved in DMEM / F12 to make a stock solution of 21 mg / mL.

[0093] (2) The above ingredients were added to DMEM / F12 according to the final concentration of the culture medium.

[0094] Example 3

[0095] A culture medium for expanding mouse adult kidney stem cells, characterized by comprising the following ingredients: fibroblast growth factor 100 ng / mL, interleukin-6 100 ng / mL, insulin-like growth factor-1 100 ng / mL, hepatocyte growth factor 100 ng / mL, platelet-derived growth factor 100 ng / mL, vascular endothelial growth factor 100 ng / mL, ascorbic acid 200 μg / mL, insulin 100 μg / mL, growth hormone 100 ng / mL, hydrocortisone 20 μg / mL, Y-27632 10 μM, CHIR99021 10 μM, bovine serum albumin 500 mg / mL, linoleic acid 1 mg / mL, linolenic acid 1 mg / mL, alanine 20 μg / mL, asparagine 20 μg / mL, glutamic acid 20 μg / mL, glycine 20 μg / mL, proline 20 μg / mL, serine 20 μg / mL, arginine 50 μg / mL.

[0096] Configuration method:

[0097] (1) Fibroblast growth factor was dissolved in DMEM / F12 to make a stock solution of 50 ug / mL.

[0098] Interleukin-6 was dissolved in DMEM / F12 to make a stock solution of 10 ug / mL.

[0099] Insulin-like growth factor-1 was dissolved in DMEM / F12 to make a stock solution of 100 ug / mL.

[0100] Hepatocyte growth factor was dissolved in DMEM / F12 to make a stock solution of 50 ug / mL.

[0101] Platelet-derived growth factor was dissolved in DMEM / F12 to make a stock solution of 50 ug / mL.

[0102] Vascular endothelial growth factor was dissolved in DMEM / F12 to make a stock solution of 50 ug / mL.

[0103] Ascorbic acid was dissolved in DMEM / F12 to make a stock solution of 200 mg / mL.

[0104] Insulin was dissolved in 0.01 M HC1 overnight and made into a stock solution of 10 mg / ml.

[0105] Growth hormone was dissolved in DMEM / F12 to make a stock solution of 100 ug / mL.

[0106] Hydrocortisone was dissolved in DMSO to make a stock solution of 1 mg / mL.

[0107] Y-27632 was dissolved in DMSO to make a stock solution of 5 mM.

[0108] CHIR99021 was dissolved in DMSO to make a stock solution of 6 mM.

[0109] Bovine serum albumin was dissolved in DMEM / F12 to make a stock solution of 2.5 g / mL.

[0110] Linoleic acid was dissolved in DMSO to make a stock solution of 5 mg / mL.

[0111] Linolenic acid was dissolved in DMSO to make a stock solution of 5 mg / mL.

[0112] Alanine was dissolved in DMEM / F12 to make a stock solution of 8.9 mg / mL.

[0113] Asparagine was dissolved in DMEM / F12 to make a stock solution of 13.3 mg / mL.

[0114] Glutamic acid was dissolved in DMEM / F12 to make a stock solution of 14.7 mg / mL.

[0115] Glycine was dissolved in DMEM / F12 to prepare a stock solution of 7.5 mg / mL.

[0116] Proline was dissolved in DMEM / F12 to prepare a stock solution of 11.5 mg / mL.

[0117] Serine was dissolved in DMEM / F12 to prepare a stock solution of 10.5 mg / mL.

[0118] Arginine was dissolved in DMEM / F12 to prepare a stock solution of 21 mg / mL.

[0119] (2) The above ingredients were added to DMEM / F12 according to the final concentration of the use medium.

[0120] Example 4

[0121] In vitro culture of mouse adult kidney stem cells

[0122] A gelatin coating solution with a concentration of 10 mg / mL was prepared with pure water and coated on 6 cm cell culture dishes. Mouse adult kidney stem cells were isolated and extracted from adult C57BL mouse kidney tissue by 100 U / mL collagenase digestion. The extracted kidney cells were inoculated in the gelatin-coated culture dishes and cultured with the medium prepared in Example 1, and the medium was changed every day, and the cell morphology was observed every day. After 7 days of culture, clones appeared in the culture dishes, and the cells inside were dense.

[0123] When the cell clone morphology diameter was greater than 1 mm, the stem cell clone was digested by trypsin and subcultured to a 6-well plate at a ratio of 1:4. When the cells in the 6-well plate reached about 90% confluence, they were subcultured to a 6-well plate at a ratio of 1:6.

[0124] The medium of the present application can culture kidney stem cells for more than 25 continuous passages, and the cells still maintain a high proliferation rate and good stem cell morphological characteristics. Figure 3 The cell proliferation curve within 25 passages of cell subculture, and the cell expansion factor was as high as 10 25 The data show that the medium of the present application can stably expand mouse kidney stem cells for at least 25 passages.

[0125] Example 5

[0126] Real-time fluorescent quantitative PCR verifies that the in vitro expanded kidney stem cells express kidney stem cell genes

[0127] The cells cultured for 25 generations and mouse kidney tissue were fully lysed by Trizol, 1 / 2 chloroform was added, centrifuged at 12000 rpm for 15 minutes at 4°C, the upper aqueous phase was taken and an equal volume of isopropanol was added, fully mixed, room temperature for 10 minutes, 4°C, 12000 rpm, centrifuged for 15 minutes, then the precipitate was washed with 75% ethanol, air-dried to a translucent state at room temperature, and dissolved in water.

[0128] RNA reverse transcription was performed using a reverse transcription kit according to the instructions (Vazyme, #R323). The expression levels of the corresponding genes were detected by real-time fluorescent quantitative PCR. The reaction system of real-time fluorescent quantitative PCR is shown in Table 1, the reaction conditions are shown in Table 2, the primer sequences are shown in Table 3, and the results are shown in Figure 4 .

[0129] Table 1: Reaction system

[0130] Reagents Volume (μL) 2X SYBR Green Taq 10.0 Forward primer 0.6 Reverse primer 0.6 cDNA 0.6 ddH2O 8.2 Total volume 20

[0131] Table 2: Reaction conditions

[0132]

[0133] Table 3: Primer sequence

[0134] Primer name Primer sequence Pax2-F AAGCCCGGAGTGATTGGTG, as set forth in SEQ ID No: 1 ; Pax2-R CAGGCGAACATAGTCGGGTT, as set forth in SEQ ID No: 2; Sox9-F CACACGTCAAGCGACCCATGAA, as set forth in SEQ ID No: 3; Sox9-R TCTTCTCGCTCTCGTTCAGCAG, as set forth in SEQ ID No: 4; Sox2-F GCGGAGTGGAAACTTTTGTCC, as set forth in SEQ ID No: 5; Sox2-R CGGGAAGCGTGTACTTATCCTT, as set forth in SEQ ID No: 6;

[0135] Example 6

[0136] Identification of the differentiation potential of kidney stem cells in stem cell culture system

[0137] To verify that the adult kidney stem cells cultured in the medium described in the application can still maintain multiple differentiation potential after continuous subculture, kidney stem cells subcultured for 25 times were selected for verification. When the cells were subcultured for 3 days, the induced differentiation was continued for 7 days, and then the induced differentiated cells were fixed with 4% paraformaldehyde solution at room temperature for 30 minutes. Antibody proteins that can label functional mature renal tubular cells (ATP1A1) and glomerular cells (PODXL) were added to track the mature kidney cell types formed by the differentiation of kidney stem cells. The antibody and cells were incubated overnight at 4°C, the cells were washed with PBS for 3 times, then the corresponding immunofluorescence secondary antibody of the corresponding antibody was added, incubated at room temperature for 1 hour, the cells were washed with PBS for 3 times, then DAPI staining solution was added and incubated for 5 minutes, the cells were washed with PBS for 3 times, and observed under a fluorescence microscope. Figure 5 A, ATP1A1 antibody labeled mature renal tubular cells; Figure 5 B, PODXL antibody labeled mature glomerular cells.

[0138] The results show that the adult kidney stem cells subcultured for 25 generations still maintain multiple cell differentiation potential.

[0139] The foregoing description of the disclosed embodiments enables one skilled in the art to make or use the application. Numerous modifications of those embodiments can be apparent to those skilled in the art, and the generic principles defined herein can be applied to other embodiments without the use of the innovation falling outside the spirit and scope of the application. Therefore, the application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A culture medium for expanding adult mouse renal stem cells, characterized in that, The culture medium comprises the following components: Fibroblast growth factor 1-100 ng / mL, interleukin-6 1-100 ng / mL, insulin-like growth factor-1 1-100 ng / mL, hepatocyte growth factor 1-100 ng / mL, platelet-derived growth factor 1-100 ng / mL, vascular endothelial growth factor 1-100 ng / mL, ascorbic acid 50-200 μg / mL, insulin 1-100 μg / mL, growth hormone 1-100 ng / mL, hydrocortisone 0.1-20 μg / mL, Y-276321-10μM, CHIR990211-10μM, bovine serum albumin 100-500mg / mL, linoleic acid 0.1-1mg / mL, linolenic acid 0.1-1mg / mL, alanine 1-20μg / mL, asparagine 1-20μg / mL, glutamic acid 1-20μg / mL, glycine 1-20μg / mL, proline 1-20μg / mL, serine 1-20μg / mL, arginine 1-50μg / mL.

2. The culture medium according to claim 1, characterized in that, The culture medium comprises the following components: Fibroblast growth factor 50 ng / mL, interleukin-6 10 ng / mL, insulin-like growth factor-1 100 ng / mL, hepatocyte growth factor 50 ng / mL, platelet-derived growth factor 50 ng / mL, vascular endothelial growth factor 50 ng / mL, ascorbic acid 200 μg / mL, insulin 10 μg / mL, growth hormone 100 ng / mL, hydrocortisone 1 μg / mL, Y-276 325 μM, CHIR990 216 μM, bovine serum albumin 250 mg / mL, linoleic acid 0.5 mg / mL, linolenic acid 0.5 mg / mL, alanine 8.9 μg / mL, asparagine 13.3 μg / mL, glutamate 14.7 μg / mL, glycine 7.5 μg / mL, proline 11.5 μg / mL, serine 10.5 μg / mL, arginine 21 μg / mL.

3. The culture medium according to claim 1 or 2, characterized in that, DMEM / F12 was used as the solvent.

4. A method for preparing the culture medium according to any one of claims 1-3, characterized in that, Includes the following steps: (1) Fibroblast growth factor, interleukin-6, insulin-like growth factor-1, hepatocyte growth factor, platelet-derived growth factor, vascular endothelial growth factor, ascorbic acid, growth hormone, bovine serum albumin, alanine, asparagine, glutamic acid, glycine, proline, serine and arginine were dissolved in DMEM / F12 to prepare a stock solution. Hydrocortisone, Y-27632, CHIR99021, linoleic acid and linolenic acid were dissolved in DMSO to prepare a mother liquor. Insulin was dissolved in 0.01M HCl to prepare a stock solution; (2) Add each stock solution from step (1) to DMEM / F12 according to the final concentration of the culture medium.

5. A method for culturing adult mouse renal stem cells, characterized in that, The procedure includes the following steps: culturing primary kidney cells in gelatin-coated culture dishes using the culture medium described in any one of claims 1-3.

6. The cultivation method according to claim 5, characterized in that, The medium should be changed every other day during the culture process.

7. A mouse adult kidney stem cell, characterized in that, Cells obtained by culturing using the culture medium described in any one of claims 1-3 or the culture method described in claim 5 or 6.

8. The use of the culture medium according to any one of claims 1-3 in the preparation of cells.

9. The use of the culture medium according to any one of claims 1-3 in the preparation of expanded renal stem cell products.

10. The application of the mouse adult renal stem cells as described in claim 7 for non-diagnostic and therapeutic purposes, characterized in that, The application is any one of the following: A: In vitro study of the regulatory mechanisms of adult renal stem cell proliferation, differentiation, and death; B: Kidney stem cell transplantation therapy; C: Kidney organoid construction; D: Personalized drug development, screening, and nephrotoxicity evaluation.

Images