MRNA vaccine for preventing or treating hepatitis B virus infection and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an mRNA vaccine for preventing or treating hepatitis B virus infection and application of the mRNA vaccine. The mRNA vaccine comprises mRNA for coding hepatitis B virus surface antigen or / and hepatitis B virus core associated antigen or / and hepatitis B virus front surface antigen 1 fusion IgG Fc segment protein, and the mRNA is wrapped by lipid nanoparticles to form a delivery system to be prepared into the mRNA vaccine. The vaccine preparation can specifically enhance humoral immune response and cellular immune response aiming at hepatitis B virus surface antigen or / and hepatitis B virus core related antigen or / and hepatitis B virus front surface antigen, and can be used for preventing and treating hepatitis B. All the components in the vaccine preparation can be widely obtained, the vaccine cost is effectively reduced, the vaccine yield is increased, and therefore the vaccine preparation has good practical application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to an mRNA vaccine for preventing or treating hepatitis B virus infection and application thereof. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing an understanding of the general background of the application and does not necessarily constitute an admission or a recognition that the information forms part of the prior art already known to a person of ordinary skill in the art.

[0003] Hepatitis B virus (HBV) belongs to the family of hepadnaviridae, and HBV is a hepadnavirus, whose genome includes four ORFs, referred to as S, C, P, and X regions, which encode viral capsid protein, nucleocapsid, polymerase, and X protein, respectively. The open reading frame of the capsid protein contains multiple simultaneous translation initiation codons, which determine three carboxy-terminal overlapping polypeptides, which in turn constitute three protein forms of large (L), medium (M), and small (S). The L protein includes preS1, preS2, and S regions, and the immunogenicity of the preS2 region protein is the strongest. The preS1 region is located at the outermost end of the virus particle and only exists on the complete hepatitis B virus particle with infectivity, interacts with the receptor NTCP binding domain on the hepatocyte, participates in the direct binding of the virus to the hepatocyte, and plays an important role in the assembly and release of the HBV virus.

[0004] Globally, the number of hepatitis B virus infected persons has reached nearly 300 million. If there is no effective intervention, chronic hepatitis B infection can develop into severe liver disease. The immune tolerance characteristics of the liver are the basic mechanisms for maintaining homeostasis and preventing excessive immune inflammatory damage, but at the same time, they are also the key factors for the sustained infection and difficult immune clearance of various pathogens including hepatitis B virus. Although the hepatitis B vaccine has a significant effect in preventing infection, the current clinically commonly used interferon and nucleotide drugs have certain limitations. Therefore, it is urgent to develop new, safe and effective anti-HBV therapeutic drugs and strategies.

[0005] Therapeutic hepatitis B vaccine as a new and effective strategy aims to present hepatitis B virus related antigens to the patient's immune system through various pathways, thereby stimulating the patient's own immune system to clear HBV, and ultimately achieving viral control, functional cure and even complete cure of chronic HBV infection. The therapeutic hepatitis B vaccines currently in the research and development stage mainly include recombinant protein vaccines, DNA vaccines and dendritic cell (DC) vaccines, etc. However, the inventors found that the lack of ideal adjuvants and efficient antigen delivery systems is the main challenge faced by the current development of HBV therapeutic vaccines. SUMMARY

[0006] In view of the deficiencies in the prior art, the present application aims to provide an mRNA vaccine for preventing or treating hepatitis B virus infection and its application. Specifically, the present application successfully prepares an mRNA vaccine, which can be used for preventing hepatitis B virus infection or treating acute or chronic hepatitis B caused by hepatitis B virus infection. Based on the above research results, the present application is completed.

[0007] In order to achieve the above technical purpose, the technical scheme provided by the present application is as follows: In a first aspect of the present application, an mRNA molecule is provided, which comprises a nucleic acid sequence encoding hepatitis B virus surface antigen (HBsAg), hepatitis B virus core-related antigen (HBcAg) and / or hepatitis B virus pre-surface antigen 1 fusion IgG Fc segment protein (PreS1-Fc). Further, the mRNA molecule comprises any one of (a1)-(a3): (a1) an mRNA molecule having a nucleotide sequence shown in any one or more of SEQ ID NO. 1-5; (a2) an mRNA molecule derived from (a1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence defined in (a1), having the function of encoding HBsAg, HBcAg and / or PreS1-Fc and having the same percentage content of GC base pairs as the original nucleic acid sequence; (a3) an mRNA molecule hybridizing with the mRNA molecule defined in (a1) or (a2) under stringent conditions and having the function of encoding HBsAg, HBcAg and / or PreS1-Fc.

[0008] Further, in order to achieve the best immune effect of the mRNA vaccine, the mRNA molecule comprises one or more modifications, which include untranslated region modification and nucleotide modification.

[0009] In another specific embodiment of the present application, the untranslated region modification comprises at least one of 5' cap structure modification, 5' and 3' untranslated region sequence introduction, and 3' polyadenylic acid introduction. In another specific embodiment of the present application, the nucleotide modification comprises at least one of pseudouridine, 5-methoxyuridine, 5-methylcytidine, 2-thiouridine, N6-methyladenosine (m6A), N1-methyladenosine (m1A), 2'-O-methylation, N6-methyladenosine (m6A), 5-methylcytosine (m5C), 5-hydroxymethylcytosine (5hmC), N4-methylcytidine (m4C), 7-methylguanosine (m7G), N2-methylguanosine (m2G), N1-methylpseudouridine, m2,7G, m2,2,7G and Nm.

[0010] In another embodiment of the present application, the pseudouridine is selected from at least one of 4-thiopseudouridine, 2-thiopseudouridine, 1-carboxymethylpseudouridine, 1-propynyl pseudouridine, 1-taurinomethyl pseudouridine, N1-methylpseudouridine, 4-thio-1-methylpseudouridine, 2-thio-1-methylpseudouridine, 1-methyl-1-deazapseudouridine, 2-thio-1-methyl-1-deazapseudouridine, dihydrouridine, 2-thio-dihydrouridine, 4-methoxy pseudouridine, and 4-methoxy-2-thiopseudouridine, wherein N1-methylpseudouridine is preferred.

[0011] In another embodiment of the present application, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the nucleotides in the mRNA sequence are modified. In another embodiment of the present application, the nucleotide modifications in the mRNA sequence are the same or different.

[0012] In a second aspect of the present application, a pharmaceutical composition is provided, comprising the above mRNA molecule.

[0013] In another embodiment of the present application, the pharmaceutical composition further comprises a delivery vehicle, which includes but is not limited to a liposome nanoparticle (LNP), a liposome, a polymer, a micelle, a plasmid, a virus, or a combination thereof; wherein the liposome nanoparticle is preferred.

[0014] In another embodiment of the present application, the liposome nanoparticle comprises a cationic lipid, a helper phospholipid, a sterol lipid, and a PEG-modified lipid.

[0015] In another embodiment of the present application, the cationic lipid is an ionizable cationic lipid, which can be selected from any one or more of 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (DLin-MC3-DMA), N,N-dimethyl-2,2-di-(9Z,12Z)-9,12-octadecadien-1-yl-1,3-dioxolane-4- ethanamine (DLin-KC2-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy) heptadecanedioate (L319), heptan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino) octanoate (SM102); wherein SM102 is preferred.

[0016] In another embodiment of the present application, the helper phospholipid is preferably selected from one or more of DSPC, DOPC, DPPG, DOPS, and DOPE, more preferably DSPC and / or DOPS, most preferably DSPC.

[0017] In another embodiment of the present application, the solid sterol lipid is selected from one or more of the group consisting of cholesterol, cholesterol ester, a solid sterol hormone, a solid sterol vitamin, and a phytosterol, more preferably from one or more of the group consisting of cholesterol, cholesterol ester, and phytosterol, and most preferably is cholesterol.

[0018] In another embodiment of the present application, the PEG-modified lipid is preferably selected from one or more of the group consisting of DAG-PEG, DAA-PEG, DMG-PEG, Cer-PEG, and DSPE-PEG, and more preferably is PEG-DMG. Preferably, the PEG has a relative molecular mass of 2000-5000, for example 2000, 3000, 4000, or 5000, and most preferably the PEG-modified lipid is mPEG2000-DMG.

[0019] In another embodiment of the present application, the liposomal nanoparticle is prepared from a combination of SM102, DSPC, cholesterol, and mPEG2000-DMG.

[0020] In another embodiment of the present application, the molar ratio of SM102, DSPC, cholesterol, and mPEG2000-DMG in the liposomal nanoparticle is 30-70:1-20:20-50:0.1-5, and preferably is 50:10:38.5:1.5.

[0021] In a third aspect of the present application, an mRNA vaccine is provided, which comprises the mRNA molecule described above and a liposomal nanoparticle encapsulating the mRNA.

[0022] The liposomal nanoparticle is prepared from a combination of SM102, DSPC, cholesterol, and mPEG2000-DMG.

[0023] In another embodiment of the present application, the molar ratio of SM102, DSPC, cholesterol, and mPEG2000-DMG in the liposomal nanoparticle is 30-70:1-20:20-50:0.1-5, and preferably is 50:10:38.5:1.5. The liposomal nanoparticle has good antigen presentation performance.

[0024] In another embodiment of the present application, the dosage form of the mRNA vaccine can be a lyophilized agent, an injection agent, or the like, without being specifically limited herein.

[0025] In another embodiment of the present application, the administration mode of the mRNA vaccine can be through intravenous, intramuscular, subcutaneous, or topical routes.

[0026] In another specific embodiment of the present application, the vaccine preparation is an injection, and the administration mode is intramuscular injection. In another specific embodiment of the present application, the dosage for intramuscular injection is 1 μg-10 μg per injection; a total of two injections per course, with an interval of 14 days between each injection.

[0027] In a fourth aspect of the present application, a DNA molecule capable of transcribing the above-mentioned mRNA molecule is provided.

[0028] In a fifth aspect of the present application, an expression vector, an expression cassette or a host cell containing the above-mentioned mRNA molecule or DNA molecule is provided.

[0029] In a sixth aspect of the present application, a preparation method of the above-mentioned mRNA molecule is provided, which comprises transcribing the above-mentioned DNA molecule.

[0030] In a seventh aspect of the present application, the above-mentioned mRNA molecule, DNA molecule, expression vector, expression cassette or host cell, pharmaceutical composition or mRNA vaccine is used for preparing a drug having any one or more of the following effects: 1) preventing or treating liver diseases mediated by hepatitis B virus; 2) preventing, treating or detecting hepatitis B virus.

[0031] In the application 1), the liver diseases mediated by hepatitis B virus include but are not limited to hepatitis, cirrhosis, liver failure and liver cancer mediated by hepatitis B virus. The hepatitis is preferred, and further, the hepatitis includes acute hepatitis and chronic hepatitis.

[0032] Specifically, the present application proves by experiments that the mRNA vaccine, especially the two-component vaccine (HBsAg / PreS1+IgG Fc), can significantly reduce the level of HBsAg in the peripheral blood serum of HBV mice to the detection limit, and the two-component vaccine can more effectively reduce the level of PreS1 in the peripheral blood serum of HBV mice, prevent the re-invasion of HBV to cells and HBV infection, reverse the immune tolerance state caused by chronic HBV infection, effectively induce HBV antigen-specific humoral immunity, and experiment seroconversion; safely and effectively reduce the HBV DNA in the peripheral blood serum of HBV mice to the detection limit. Thus, the hepatitis B virus can be effectively prevented and / or treated.

[0033] In an eighth aspect of the present application, a method for preventing and / or treating liver diseases mediated by hepatitis B virus is provided, which comprises administering the above-mentioned mRNA molecule, DNA molecule, expression vector, expression cassette or host cell, pharmaceutical composition or mRNA vaccine to a subject.

[0034] The above-mentioned one or more technical solutions have the following beneficial technical effects: (1) The hepatitis B virus mRNA vaccine preparation prepared by the technical scheme has the advantages that, compared with other traditional vaccine production methods, mRNA can be prepared by in vitro transcription, does not depend on cell amplification, can easily realize monitoring and quality control of all production processes, and further saves time and economic cost of cell culture, antigen extraction and purification processes; (2) The endogenous expressed protein antigen of the hepatitis B virus mRNA vaccine preparation has the advantages that, compared with heterologous prepared antigen, the protein translated from mRNA entering the inoculated body has high fidelity of spatial structure and post-translational modification such as glycosylation, can cause effective immune response against the corresponding pathogen, and improves the protection effect of the vaccine; (3) The hepatitis B virus mRNA vaccine contains a nucleic acid sequence encoding an IgG Fc segment, which can increase the molecular stability and prolong the in vivo half-life. Moreover, the Fc segment can mediate biological functions such as ADCC and CDC, which helps the vaccine to enhance the patient's own immune system to break immune tolerance and induce strong cellular immune response and humoral immune response; (4) Compared with DNA vaccines, the mRNA vaccine translated protein antigen does not need to enter the nucleus, which enhances the antigen yield while avoiding the risk of genomic integration. In addition, as a kind of transient component commonly found in vivo, mRNA is relatively easy to be cleared by the physiological metabolic pathway of the body, which does not additionally increase the metabolic burden of the inoculated body; (5) The mRNA of the hepatitis B virus mRNA vaccine preparation can activate various intracellular pathogen related receptors (pathogen related receptors, PRR), has self-adjuvant effect, does not need to add additional adjuvant, can induce acquired immune response against pathogens by promoting different innate immune responses, and does not have the risk of potential hepatitis B infection caused by attenuated live vaccine inoculation; (6) The untranslated region modification and nucleotide modification of the hepatitis B virus mRNA vaccine preparation for achieving the best immune effect of the mRNA vaccine, including 5' cap modification by co-transcription method, introduction of 5' and 3' untranslated region sequences, introduction of 3' polyadenylic acid sequence, nucleotide modification such as uridine replacement with pseudouridine, can further improve the stability of mRNA, improve the protein translation efficiency, and enhance the immune effect of the vaccine. Therefore, it has good practical application value. BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical schemes in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows.

[0036] Figure 1A schematic diagram of the plasmid structure of the present application.

[0037] Figure 2 A electropherogram of mRNA of the present application; A is SEQ ID NO. 1-3; B is SEQ ID NO. 4-5.

[0038] Figure 3 A display diagram of protein expression amount of mRNA of Example 3 of the present application in HEK293T cells.

[0039] Figure 4 Serum HBsAb (A), anti-HBc (B) and anti-PreS1 (C) antibody levels induced by the HBV mRNA vaccine of the present application in healthy mice.

[0040] Figure 5 Analysis of antigen-specific T cell responses induced by the HBV mRNA vaccine of the present application in healthy mice; wherein, A is HBsAg; B is HBcAg; C is PreS1.

[0041] Figure 6 Body weight change curve results after immunizing healthy mice with the HBV mRNA vaccine of the present application.

[0042] Figure 7 Inhibition of HBV serum HBsAg (A), PreS1 (B) and HBV DNA (C) by the HBV mRNA vaccine of the present application.

[0043] Figure 8 Serum HBsAb (A) and anti-PreS1 IgG (B) levels induced by the HBV mRNA vaccine of the present application in HBV mice. DETAILED DESCRIPTION

[0044] It should be noted that the following detailed description is illustrative only and is intended to provide further description of the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs.

[0045] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, steps, operations, elements, components, and / or groups thereof, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components, and / or groups thereof. The present application employs, unless otherwise indicated herein, conventional techniques and methods of gene engineering and molecular biology. Those skilled in the art can employ other conventional techniques, methods and reagents in the practice of the present application, in addition to those disclosed in the embodiments provided herein, without resort to undue experimentation.

[0046] The summary of the application will be described in detail below in conjunction with the drawings and specific embodiments. In the following examples, the materials, reagents, etc. used, unless otherwise specified, are obtained from commercial channels. The experimental methods described, unless otherwise specified, are conventional methods in the art.

[0047] Example 1: mRNA vaccine sequence design of hepatitis B virus mRNA candidate sequence design: HBV is a capsid DNA virus belonging to the Hepadnaviridae family, and its genome includes four ORFs, referred to as S, C, P, and X regions, which encode viral capsid proteins, nucleocapsid, polymerase, and X protein, respectively. The open reading frame of the capsid protein contains multiple simultaneous translation initiation codons, which determine three carboxy-terminal overlapping polypeptides, which in turn constitute three protein forms of large (L), medium (M), and small (S). The L protein includes preS1, preS2, and S regions. The loading of HBV-related antigens is a major factor leading to T cell exhaustion in the liver. Studies have shown that the level of HBsAg in HBV-infected patients is as high as 400 ng / mL (0.4% of total serum protein), which plays an important role in suppressing HBV-specific immune responses. HBsAg can directly act on dendritic cells to inhibit the production of cytokines. Traditional vaccines generally use HBsAg to achieve the purpose of anti-HBV.

[0048] PreS1 region is located at the outermost end of the viral particles, only exists in the infectious complete hepatitis B virus particles, interacts with the receptor NTCP binding domain on hepatocytes, participates in the direct binding of virus and hepatocytes, and plays an important role in the assembly and release of HBV virus. In addition, the addition of Fc fusion protein can increase the molecular stability, prolong the in vivo half-life, and can exert the effect function mediated by Fc segment. In addition to the structural role in capsid formation, HBV virus C antigen (HBc) can coordinate the assembly of viral particles by recruiting host and viral chaperone proteins required for viral replication. HBc also interacts with NAs to ensure the protection of viral genome, and participates in the replication of viral genome together with viral polymerase. All these functions make HBc one of the important targets for drug development. In this invention, on the basis of redesigned HBs, other HBV antigens (HBcAg and PreS1) will be used as the antigen design basis of the vaccine.

[0049] HBV is genotyped according to the entire genome sequence, and there are 10 recognized genotypes (A-J). It can also be classified according to the corresponding B cell antigen epitope of the envelope protein, and divided into adr, adw, ayr or ayw, and further divided into 10 serological subtypes. Most of the prophylactic hepatitis B vaccines currently used in clinical practice are derived from A2-adw type strains, while Chinese infected persons are mainly of type C, so we designed the antigen as the gene encoding the full-length amino acid sequence of HBsAg and PreS1 of C-adr type strain (GenBank: D16665.1).

[0050] Due to the low expression amount of viral proteins in mammalian body, codon optimization is used to improve the expression amount. Any amino acid in the organism corresponds to multiple different codons, but in the translation process, the frequency of use of one codon is dominant. Preferential codons are used as much as possible to improve the translation rate and accelerate protein synthesis. The more stable the secondary structure of the mRNA molecule, the longer the half-life, the in vivo stability of the mRNA molecule is improved, and the relative long-term expression of the antigen is ensured. In the present invention, the sequence is optimized to obtain 5 sequences.

[0051] Example 2: mRNA preparation 2.1 Whole gene synthesis of template plasmid: the ORF (open reading frame) sequence encoding the antigen or interleukin is connected with T7 promoter sequence, 5'UTR sequence, 3'UTR sequence and polyA sequence in series, and then whole gene synthesis is carried out with Puc57 as the carrier, that is, the template plasmid can be obtained. Figure 1 As shown in the figure).

[0052] 2.2 PCR to obtain transcription template DNA sequence: using polyT long primer, high-fidelity DNA polymerase, dNTP and other raw materials (all purchased from Nanjing Novozyme Bio-tech Co., Ltd.) as template, linearized template plasmid, and following the recommended program of PCR instrument, the transcription template linear DNA can be obtained.

[0053] 2.3 In vitro transcription reaction to prepare mRNA (using 40 μL reaction system as an example): the prepared IVT template, T7 RNA polymerase, rNTP mononucleotide, capping enzyme and other raw materials (purchased from Jiangsu Shenji Biological Technology Co., Ltd.) are mixed according to the recommended ratio, co-transcription capping method is adopted, and the transcription reaction is carried out at 37°C for 2 hours. After the transcription reaction is completed, the template linear DNA is digested using DNAase (purchased from Novozyme) to reduce the risk brought by residual DNA template.

[0054] 2.4 Purification: using RNA purification kit (purchased from NEB) to purify the mRNA after in vitro transcription reaction. The purified mRNA is dissolved in TE buffer, which can be used for subsequent preparation coating. The electrophoresis results (Figs. Figure 2 A and 2B) show that the mRNA has good purity, and the sequence information is shown in SEQ ID NO. 1-5.

[0055] Example 3: mRNA sequence transfection of HEK-293T cells to verify protein expression level HEK 293T cells were plated in a six-well plate, 5x10 5 cells per well, and incubated in a 37°C incubator for 24 hours. 2 μg of each mRNA sequence was transfected using jetMESSENGER transfection reagent. The specific operation is as follows: 2 μg of mRNA was added to 200 μl of mRNA buffer, mixed well, then 4 μl of jetMESSENGER reagent was added and mixed well, incubated at room temperature for 15 minutes, then added dropwise to the cells, and the untransfected cells were used as negative control and placed in a 37°C incubator. After 48 hours of transfection, part of the culture supernatant was collected. The cells were collected, an appropriate amount of lysis buffer was added, mixed gently, and incubated in an ice bath for 30 minutes, vortexed every 5 minutes during the incubation, then centrifuged at 12000 rpm for 15 minutes at 4°C, and the supernatant was collected. The expression level of HBsAg in the cell lysate was detected by enzyme-linked immunoassay.

[0056] The experimental results are shown in Figure 3 Fig. 3. The mRNA sequence after sequence optimization can be expressed in HEK293T cells.

[0057] Example 4: Preparation of hepatitis B mRNA vaccine preparation and its characterization Preparation of lipid solution: SM102: DSPC: Cholesterol: mPEG2000-DMG were dissolved in ethanol solution according to the molar ratio of 50:10:38.5:1.5; the molar concentration of SM102 in ethanol solution was controlled at 2.112 mmol / L.

[0058] Preparation of mRNA solution: mRNA was dissolved in 10 mM citric acid buffer solution with pH = 4.0 to prepare a 50 μg / mL solution; Preparation of lipid nanoparticles: the instrument used was Inano L+ Nanomedicine Preparation System (purchased from Miannal Instruments Technology Co., Ltd.). The vaccine mRNA and lipid solution were taken by syringe according to the volume ratio of 3:1, inserted into the microfluidic chip, and the parameters were set as follows: Flowrate ratio: 3:1, Total flow rate: 12 mL / min, and the lipid nanoparticle solution was obtained by mixing. Solution replacement: the lipid nanoparticle solution was added to the ultrafiltration tube for centrifugal ultrafiltration, and phosphate buffer was used for multiple replacement to obtain the finished product.

[0059] Formulation characterization: NanoBrook Omni (manufacturer: Brookhaven) was used to characterize the particle size distribution and ZETA potential of the prepared mRNA vaccine formulation.

[0060] Comparative Example 1: marketed HBV subunit vaccine In vivo immunogenicity evaluation of the vaccines prepared in Examples 1-4 above and Comparative Example 1: Statistical analysis: the data obtained from the above examples and comparative examples were statistically analyzed using GraphPad Prism 8.0 software by Mann-Whitney test method, wherein p≥0.01 was no significant difference, marked as ns; in the significant difference, p<0.1 was marked as *, p<0.01 was marked as **, p<0.001 was marked as ***, and p<0.0001 was marked as ****.

[0061] Animal immunization C57BL / 6 mice (male, initial immunization age 6 weeks, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were used for vaccine immunogenicity detection, and four doses were used in Example 4 as follows: mRNA preparation containing 10 μg SEQ ID NO. 1 (Vaccine 1) or mRNA preparation containing SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, each 1 μg / 5 μg / 10 μg (Vaccine 2); Comparative Example (1 / 10 human dose of marketed subunit vaccine), double-needle immunization (immunization on days 0, 14), a total of 6 groups, 7 mice per group. After the vaccine was diluted with PBS to the specified concentration, it was injected intramuscularly into the thigh, and both sides were injected.

[0062] At 1, 2, 3, and 4 weeks after the initial immunization, 100-150 μL of blood was taken, and the blood was allowed to stand at 4°C for more than 2 hours, then centrifuged at 3000 rpm for 15 minutes to separate the serum, and the sample was stored at -80°C for subsequent immunological analysis.

[0063] At 4 weeks after immunization, the mice were euthanized, and the spleen was ground on a 70 μm cell filter screen, red blood cell lysis solution (purchased from Solabio) was added, and the mixture was allowed to stand at room temperature for 5 minutes, then 10 ml of PBS was added, and after centrifugation at 1600 rpm for 5 min, the cell culture medium was used to resuspend the single-cell suspension.

[0064] Antibody titer detection Hepatitis B virus surface antibody quantitative detection kit (purchased from Beijing Wantai Biological Pharmacy Co., Ltd.) was used to quantitatively detect the hepatitis B virus surface antibody in the mouse serum according to the instructions.

[0065] Hepatitis B core antibody was detected by Elisa method: HBc (purchased from Beijing Wantai Biological Pharmacy Co., Ltd.) was diluted to 2 pg / mL with coating solution, and 50 mΐ per well was added to the ELISA coated plate (Corning 9018), 4 °C coated overnight. Wash with PBS 260 mΐ per well. 5% blocking solution (5% FBS) 37 °C blocked for two hours. Dilute serum samples with PBS to the appropriate dilution, add 50 mΐ per well to the blocked ELISA plate, incubate at 37 °C for 1 hour. Wash with PBST 5 times, 260 mΐ each time, add 50 mΐ enzyme-conjugated secondary antibody (enzyme-conjugated anti-mouse IgG-HRP 1:10000 diluted by PBS) per well, incubate at 37 °C for half an hour. Wash with PBST five times, 260 mΐ each time, add 100 mΐ substrate TMB per well, incubate at room temperature in the dark, wait for the substrate to develop color. Add 50 mΐ stop solution (2 N H2SO4) per well to stop color development, read the plate with a microplate reader, and the reading is OD 450-OD630.

[0066] Hepatitis B PreS1 antibody was detected by Elisa method: preS1 was diluted to 2 pg / mL with coating solution, and 50 mΐ per well was added to the ELISA coated plate (Corning 9018), 4 °C coated overnight. Wash with PBS 260 mΐ per well. 5% blocking solution (5% FBS) 37 °C blocked for two hours. Dilute serum samples with PBS to the appropriate dilution, add 50 mΐ per well to the blocked ELISA plate, incubate at 37 °C for 1 hour. Wash with PBST 5 times, 260 mΐ each time, add 50 mΐ enzyme-conjugated secondary antibody (enzyme-conjugated anti-mouse IgG-HRP 1:10000 diluted by PBS) per well, incubate at 37 °C for half an hour. Wash with PBST five times, 260 mΐ each time, add 100 mΐ substrate TMB per well, incubate at room temperature in the dark, wait for the substrate to develop color. Add 50 mΐ stop solution (2 N H2SO4) per well to stop color development, read the plate with a microplate reader, and the reading is OD 450-OD630.

[0067] The experimental results are as follows Figure 4As shown, the HBV mRNA vaccine groups of Example B all induced high levels of antigen-specific antibodies, and the antibody levels further increased with the second inoculation and over time. In contrast, the clinically used comparative vaccine barely induced HBV antigen-specific antibodies in mice. This result indicates that the HBV mRNA vaccine can effectively induce HBV antigen-specific humoral immunity.

[0068] The enzyme-linked immunospot assay was performed using an IFN-γ ELISpot detection kit (purchased from MABTECH) according to the instructions. The specific steps are as follows: the coating antibody was diluted with PBS to a concentration of 15 μg / ml, and the volume was prepared according to the calculation of 100 μl per well. Take out the PVDF plate, pre-wet with 35% ethanol, 15 μl per well, and at most 1 min. Wash the plate with sterile water 5 times, 200 μl per well. Add the coating antibody 100 μl per well, 4-8°C, incubate overnight. Remove the coating solution, rinse with sterile PBS 4 times, 200 μL per well; block with 1640 complete culture medium containing 10% FBS, 200 μL per well, and place in the cell culture box for more than 30 min. Dilute the protein concentration to 2 μg / mL with 1640 complete culture medium. Take out the ELISpot plate, discard the culture medium, add 100 μL per well of gE protein (final concentration 1 μg / mL), and add 100 μL of culture medium to the negative control. Add 100 μL per well of the isolated spleen cell suspension (cell number 2 ×10 5 ), and place in the cell culture box for 18-24 hours. Take out the ELISpot plate, discard the liquid, and wash with PBS 5 times, 200 μL per well, and pat dry. Dilute the primary antibody (detection antibody coupled with biotin) with an antibody diluent at a ratio of 1:1000 (final concentration: 1 μg / mL), add 100 μL per well, and incubate at room temperature for 2 hours. Discard the primary antibody, wash with PBS 5 times, 200 μL per well, and pat dry. Dilute the secondary antibody (Streptavidin-ALP) with an antibody diluent at a ratio of 1:1000, add 100 μL per well, and incubate at room temperature for 1 hour. Discard the secondary antibody, wash with PBS 5 times, 200 μL per well, and pat dry. Add 100 μL of filtered color developing solution BCIP / NBT-plus per well, avoid light, and observe the color developing state in real time. Place the plate under running water to wash clean, dry, and store at room temperature in the dark. Use the ELISpot reader to read the plate.

[0069] The experimental results are as follows: Figure 5As shown, the antigen-specific T cells induced by the Example HBV mRNA vaccine SEQ ID NO. 1 group secreted very strong IFN-γ. The antigen-specific T cells induced by the Example HBV mRNA vaccine SEQ ID NO. 1 + SEQ ID NO. 2 + SEQ ID NO. 3 group secreted IFN-γ in a dose-dependent manner. The antigen-specific T cells induced by the Comparative Example HBV subunit vaccine hardly secreted IFN-γ.

[0070] During the observation and examination period, the mouse state was observed and examined daily by the animal room management personnel according to the test regulations. The test personnel periodically observed the mouse state, including but not limited to: behavioral activity, food and water intake, body weight change (body weight was measured once a week), appearance, signs or other abnormal conditions. The number of animal deaths and side effects in each group was recorded based on the number of animals in each group. Abnormal conditions of mice included but were not limited to: significant weight loss, body weight reduction greater than 20%; unable to freely eat and drink water; and the animal showed the following clinical manifestations and continued to worsen: piloerection; arching of the back; ear, nose, eye or foot color whitening; rapid breathing; convulsions; continuous diarrhea; dehydration; slow movement; vocalization.

[0071] The body weight measurement results are as follows Figure 6 As shown, the body weight of the mice in each group did not decrease significantly during the entire immunization period, indicating that the Example and Comparative Example HBV vaccine preparations had no significant toxic side effects.

[0072] Example 5: Construction of an HBV-carrier mouse model Construction of a rAAV / HBV 1.3 mouse model: normal adult 5-6w C57BL / 6J male mice were taken, and each mouse was injected with 3×10 10 GC (purchased from Beijing Pisheng Biotechnology Co., Ltd.). After 8w, the mouse serum was collected. Mice with serum HBsAg concentration greater than 700 ng / mL were defined as HBV-carrier mice.

[0073] Comparative Example 2: Entecavir (ETV) The vaccines prepared in Examples 1-4 and Comparative Example 2 were evaluated for in vivo pharmacodynamics in Example 5: Statistical analysis The data obtained in the above examples and comparative examples were statistically analyzed using GraphPad Prism 10.1 software using one-way ANOVA test method, wherein p≥0.05 was not significantly different, marked as ns; in the significant difference, p<0.1 was marked as *, p<0.01 was marked as **, p<0.001 was marked as ***, and p<0.0001 was marked as ****.

[0074] Animal administration C57BL / 6 mice (male, initial immunization age 10 weeks, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were used for vaccine immunogenicity detection, and three doses of Example 4 were used as follows: mRNA preparation YLZH01 containing 11.4 μg SEQ ID NO. 4, mRNA preparation YLZH16 containing 8.6 μg SEQ ID NO. 5, and mRNA preparation CPUYL01 containing 11.4 μg SEQ ID NO. 4 and 8.6 μg SEQ ID NO. 5; the comparative example entecavir was diluted to an appropriate concentration, and 50 μg / kg was administered by gavage once a day. A total of 5 groups of experimental mice, 9 mice per group. After the vaccine was diluted with PBS to the specified concentration, it was injected intramuscularly in the thigh, and a total of 200 μL was injected bilaterally.

[0075] After the first immunization, 100-150 μL of blood was taken every week at 1, 3, 5, 7, 9, and 11 weeks, and was placed at 4°C for more than 2 hours. After centrifugation at 3000 rpm for 15 minutes, the serum was separated, and the samples were stored at -80°C for subsequent immunological analysis.

[0076] The mouse serum antigen detection used a hepatitis B virus surface antigen detection kit (all purchased from Antu Biological Engineering Co., Ltd.), and was performed according to the instructions.

[0077] The hepatitis B serum PreS1 antigen was detected by ELISA: anti-preS1 antibody was diluted with coating solution to 5 μg / mL, and 50 μl per well of the system was added to the ELISA coated plate (Corning 9018), which was coated at 4°C overnight, and the plate was washed with PBS twice. 5% blocking solution (5% FBS) was used for blocking at 37°C for 2 hours. The serum samples were diluted with PBS to an appropriate dilution, 50 μl per well was added to the blocked ELISA plate, and incubated at 37°C for 1 hour. PBST was washed 5 times, 260 μl each time, 50 μL of enzyme-conjugated secondary antibody (enzyme-conjugated anti-PreS1-HRP 1:5000) diluted with PBS was added to each well, and incubated at 37°C for half an hour. Wash with PBST five times, 260 μL each time, add 100 μL of substrate TMB per well, incubate at room temperature in the dark, and wait for the substrate to develop color. Add 100 μL of stop solution (2 N H2SO4) to each well to stop the color development, and read the plate on the enzyme label, with the reading being OD 450-OD630.

[0078] The experimental results are as follows Figure 7As shown, compared with the untreated group and Comparative Example 2 (ETV), the HBV mRNA vaccine YLZH01 and CPUYL01 group can significantly reduce the level of HBsAg in the peripheral blood serum of HBV mice to the detection limit, and the two-component vaccine CPUYL01 can more effectively reduce the level of PreS1 in the peripheral blood serum of HBV mice, which is of great significance for preventing the re-invasion of HBV to cells and HBV infection.

[0079] The antibody titer was detected by a hepatitis B virus surface antibody quantitative determination kit (purchased from Beijing Wantai Biological Pharmacy Co., Ltd.) according to the instructions to quantify the hepatitis B virus surface antibody in the mouse serum.

[0080] The hepatitis B PreS1 antibody was detected by an Elisa method: preS1 was diluted to 2 μg / mL with coating solution, and the system of 50 μl per well was added to an ELISA coated plate (Corning 9018) at 4 °C for overnight coating. 260 μL per well was washed with PBS once. 5% blocking solution (5% FBS) was blocked at 37 °C for two hours. The serum sample was diluted to an appropriate dilution fold, 50 μl per well was added to the blocked ELISA plate at 37 °C for incubation for 1 hour. PBST was washed 5 times, 260 μl each time, 50 μL enzyme-conjugated anti-mouse IgG-HRP (1:10000 diluted by PBS) was added to each well, and incubated at 37 °C for half an hour. PBST was washed five times, 260 μL each time, 100 μL substrate TMB was added to each well, and incubated at room temperature in the dark. The color was developed by waiting for the substrate to develop color. 50 μL stop solution (2 N H2SO4) was added to each well to stop the color development, and the plate was read by an enzyme-labeled instrument, and the reading was OD 450-OD630.

[0081] The experimental results are shown in Table 1. Figure 8 As shown, the hepatitis B virus mRNA vaccine group of Example B induced high levels of antigen-specific antibodies 35 days after four immunizations, and the two-component vaccine CPUYL01 effectively induced HBV model mice to produce HBsAb and anti-PreS1 antibodies. The clinical drug entecavir cannot induce mice to produce HBV antigen-specific antibodies and PreS1 antigen-specific antibodies. The antigen detection results show that the HBV mRNA preparation vaccine can reverse the immune tolerance state caused by chronic HBV infection, effectively induce HBV antigen-specific humoral immunity, and the experimental seroconversion.

[0082] Serum HBV DNA detection Hepatitis B virus nucleic acid assay kit (purchased from Shengxiang Biotechnology Co., Ltd.), according to the instructions for the quantification of hepatitis B virus DNA in mouse serum.

[0083] First, take out each component in the kit, balance to room temperature. And according to the proportion of reaction liquid 19 μL / portion + enzyme mixture 2 μL / portion + internal standard 0.1 μL / portion, mix evenly. Then add 2.5 μL sample release agent and 2.5 μL serum sample, negative control, positive control, quantitative reference in each hole of eight joint tube, blow evenly, room temperature for 10 min, add 20 μL of mixed solution, cover the tube cap and separate immediately. Put into qPCR instrument for reaction.

[0084] The experimental results are shown in Figure 8 As shown, compared with the untreated group, the HBV DNA level in the peripheral blood serum of the HBV mice can be significantly reduced by the nucleoside analog drug of Comparative Example 2 (ETV). The HBV mRNA vaccine YLZH01 and CPUYL01 groups can also reduce the HBV DNA in the peripheral blood serum of the HBV mice to the detection lower limit.

[0085] During the experiment, the animal house management personnel observed and examined the state of the mice every day according to the test regulations, and observed the state of the mice. The test personnel observed the state of the mice regularly, including but not limited to: behavior activity, food and water intake, appearance signs or other abnormal conditions. Based on the number of animals in each group, the number of animal deaths and side effects in the group were recorded. The abnormal conditions of the mice included but were not limited to: significant weight loss, weight loss greater than 20%; unable to freely eat and drink; and the following clinical manifestations appeared in the animals and continued to worsen: piloerection; arching of the back; ear, nose, eye or foot color whitening; rapid breathing; convulsions; continuous diarrhea; dehydration; slow movement; vocalization. During the experiment, the mice in each group had no obvious adverse reactions, indicating that the HBV mRNA vaccine preparation in the application can safely and effectively eliminate hepatitis B virus.

[0086] The sequence information involved in the application SEQ ID NO. 1 (YLZ01: HBsAg) SEQ ID NO. 2 (YLZ03: PreSl) AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGGGAGGTTGGTCCAGCAAGCCCAGGCAGGGCATGGGCACCAACCTGTCCGTGCCCAACCCCCTGGGCTTCTTTCCAGACCACCAGCTGGACCCGGCCTTCGGCGCCAATAGCAACAATCCTGATTGGGATTTCAATCCCAATAAGGATCATTGGCCCGAGGCCATCAAGGTGGGGGCCGGGGACTTTGGCCCCGGCTTCACCCCACCTCACGGGGGGCTGCTGGGGTGGAGCCCCCAGGCACAGGGCATCCTGACCACTGTGCCTGCCGCCCCTCCGCCTGTGAGCACCAACAGGCAGAGCGGGCGGCAGCCCACCCCAATCAGCCCCCCCCTGAGGGACAGCCACCCTCAGGCCTGATGACTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC SEQ ID NO. 3 (YLZ02: HBcAg 1-149aa ) AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGGACATCGACCCCTACAAGGAGTTCGGCGCTAGCGTGGAGCTGCTGAGCTTCCTGCCTAGCGACTTCTTCCCTAGCATCAGAGACCTGCTGGACACCGCTAGCGCCCTGTACAGAGAGGCCCTGGAGAGCCCCGAGCACTGCAGCCCCCACCACACCGCCCTGAGACAAGCCATCCTGTGCTGGGGCGAGCTGATGAACCTGGCCACCTGGGTGGGCAGCAACCTGGAGGACCCCGCTAGCAGAGAGCTGGTGGTGAGCTACGTGAACGTGAACATGGGCCTGAAGATCAGACAGCTGCTGTGGTTCCACATCAGCTGCCTGACCTTCGGCAGAGAGACCGTGCTGGAGTACCTGGTGAGCTTCGGCGTGTGGATCAGAACCCCCCCCGCCTACAGACCCCCCAACGCCCCCATCCTGAGCACCCTGCCCGAGACCACCGTGGTGTGATGACTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC SEQ ID NO. 4 (YLZH01: HBsAg) AGGTTGTTGATTATTAAGGATATTTATAACACTCGATACTTCATCTCTTCGTAATTAATATTCTTTCAGCTTAACTTAAACGTGTGTTGGAGTCGATAAAAATAGTCTTTTACGTAGTCCATTTTAGATTTTTAAGCCACCATGGAGAGCACCACCAGCGGCTTCCTGGGCCCCCTGCTGGTGCTGCAGGCCGGCTTCTTCCTGCTGACCCGCATCCTGACCATCCCCCAGAGCCTGGACAGCTGGTGGACCAGCCTGAACTTCCTGGGCGGCGCCCCCACCTGCCCCGGCCAGAACAGCCAGAGCCCCACCAGCAACCACAGCCCCACCAGCTGCCCCCCCATCTGCCCCGGCTACCGCTGGATGTGCCTGCGCCGCTTCATCATCTTCCTCTTCATCCTGCTGCTGTGCCTGATCTTCCTGCTGGTGCTGCTGGACTACCAGGGCATGCTGCCCGTGTGCCCCCTGCTGCCCGGCACCAGCACCACCAGCACCGGCCCCTGCAAGACCTGCACCATCCCCGCCCAGGGCACCTCCATGTTCCCCAGCTGCTGCTGCACCAAGCCCAGCGACGGCAACTGCACCTGCATCCCCATCCCCAGCAGCTGGGCCTTCGCCCGCTTCCTGTGGGAGTGGGCCAGCGTGCGCTTCTCTTGGCTGTCCCTGCTGGTGCCCTTCGTGCAGTGGTTTGCTGGGCTGAGCCCAACAGTGTGGCTGTCCGTGATCTGGATGATGTGGTACTGGGGCCCCAGCCTGTACAACATCCTGTCCCCCTTCCTGCCCCTGCTGCCCATCTTCTTCTGCCTGTGGGTGTACATCTGATGAGTGTGTTGTTTCTCCTCTGCACTCAGCCCCCTGCTGCCCTGACTCCCGGCCCCCTGCCCCTGGAGTCCTGCCCCATTAAAACTTTGGGATCCTGGT SEQ ID NO. 5 (YLZH16: PreS1 + IgG Fc) The above description is only the preferred embodiment of the present application, and is not intended to limit the present application. The present application can have various changes and modifications for those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An mRNA molecule, characterized in that, The mRNA molecule includes a nucleic acid sequence encoding hepatitis B surface antigen (HBsAg), hepatitis B core-associated antigen (HBcAg), and / or hepatitis B pre-surface antigen 1 fusion IgG Fc fragment protein (PreS1-Fc).

2. The mRNA molecule as described in claim 1, characterized in that, The mRNA molecule includes any one of (a1)-(a3): (a1) An mRNA molecule having one or more of the nucleotide sequences shown in SEQ ID NO. 1-5; (a2) A mRNA molecule derived from (a1) having one or more nucleotides substituted, deleted or added in the nucleotide sequence defined in (a1) to encode HBsAg, HBcAg and / or PreS1-Fc and having the same percentage of GC base pairs as the original nucleic acid sequence. (a3) An mRNA molecule that hybridizes under strict conditions to the mRNA molecule defined by (a1) or (a2) and has the function of encoding HBsAg, HBcAg and / or PreS1-Fc.

3. The mRNA molecule as described in claim 1, characterized in that, The mRNA molecule includes one or more modifications, including untranslated region modifications and nucleotide modifications; Furthermore, the untranslated region modification includes at least one of the following: 5' cap structure modification, introduction of 5' and 3' end untranslated region sequences, and introduction of 3' end polyadenylate.

4. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the mRNA molecule according to any one of claims 1-3; Furthermore, the pharmaceutical composition further includes a delivery carrier, which includes liposome nanoparticles, liposomes, polymers, micelles, plasmids, viruses, or combinations thereof; wherein, the liposome nanoparticles are preferred; Furthermore, the liposome nanoparticles include cationic lipids, cofactor phospholipids, sterol lipids, and PEG-modified lipids.

5. The pharmaceutical composition according to claim 4, characterized in that, The liposome nanoparticles were prepared from a combination of SM102, DSPC, cholesterol and mPEG2000-DMG. Furthermore, the molar ratio of SM102, DSPC, cholesterol, and mPEG2000-DMG in the liposome nanoparticles is 30-70:1-20:20-50:0.1-5, preferably 50:10: 38.5：1.5。 6. An mRNA vaccine, characterized in that, The mRNA vaccine comprises the mRNA molecule as described in any one of claims 1-3 and liposome nanoparticles encapsulating the mRNA; Furthermore, the lipid nanoparticles are prepared from a combination of SM102, DSPC, cholesterol, and mPEG2000-DMG; Furthermore, the molar ratio of SM102, DSPC, cholesterol, and mPEG2000-DMG in the liposome nanoparticles is 30-70:1-20:20-50:0.1-5, preferably 50:10: 38.5：1.5。 7. A DNA molecule, characterized in that, The DNA molecule can be transcribed to obtain the mRNA molecule according to any one of claims 1-3.

8. An expression vector, expression cassette, or host cell containing the mRNA molecule of any one of claims 1-3 or the DNA molecule of claim 7.

9. The use of the mRNA molecule of any one of claims 1-3, the DNA molecule of claim 7, the expression vector, expression cassette or host cell of claim 8, the pharmaceutical composition of any one of claims 4-5, and the mRNA vaccine of claim 6 in the preparation of a drug having any one or more of the following effects; 1) Prevention or treatment of liver diseases mediated by hepatitis B virus; 2) Prevention, treatment or testing for hepatitis B virus.

10. The application as described in claim 9, characterized in that, In application 1), the liver diseases mediated by hepatitis B virus include hepatitis, cirrhosis, liver failure, and liver cancer mediated by hepatitis B virus; further, the hepatitis includes acute hepatitis and chronic hepatitis.

Images