Application of PRR30 gene SNP and haplotype combination in identifying bull semen quality

By detecting SNP sites and haplotype combinations in the PRR30 gene, the problem of early assessment of bull semen quality was solved, improving breeding efficiency and the assessment efficiency of bull reproductive performance.

CN120888675BActive Publication Date: 2025-12-30INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511414910.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-30
Publication Date
2025-12-30
Estimated Expiration
2045-09-30

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively assess the semen quality of bulls before they reach maturity, resulting in economic losses and low breeding efficiency.

Method used

By detecting specific SNP sites and haplotype combinations in the PRR30 gene, including SNP7: g.794 C>A and SNP8: g.2247 G>T, the semen collection volume and sperm abnormality rate of bulls are assessed, and superior breeds are screened out.

Benefits of technology

This enables early assessment of bull reproductive performance, shortens the screening cycle, improves breeding efficiency, and promotes the development of superior breeding bulls.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888675B_ABST
    Figure CN120888675B_ABST
Patent Text Reader

Abstract

The application discloses PRR30 gene SNP and a haplotype combination thereof in identifying bull semen quality, and belongs to the technical field of molecular genetics. Eight SNP sites are identified, wherein SNP7: g.794 C>A or SNP8: g.2247 G>T can be used for identifying the high and low of bull semen collection amount, SNP2: g.-2151 C>T can be used for identifying the high and low of bull sperm abnormality rate, and the haplotype combination of SNP1-SNP8 is that the bull with H1H11 has higher semen collection amount and lower sperm abnormality rate, and can be further used for identifying bull semen quality, thereby helping staff to evaluate bull breeding performance in an early stage, to carry out superior gene bull screening, to promote the cultivation of superior bull, to shorten the screening period and to improve the breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to the application of PRR30 gene SNPs and their haplotype combinations in the identification of bull semen quality. Background Technology

[0002] Bull semen quality is a crucial indicator of a bull's reproductive capacity, directly impacting the success rate of artificial insemination and the health of offspring, and profoundly affecting the genetic improvement and production efficiency of the entire herd. Currently, the assessment of bull semen quality primarily relies on indicators such as appearance, ejaculate volume, semen density, sperm motility, and sperm abnormality rate. These indicators typically require analysis after bulls reach sexual maturity. However, delaying the detection and culling of bulls with poor semen quality until this stage often results in significant economic losses. Therefore, utilizing genetic molecular markers for early identification of bull semen quality can not only improve breeding efficiency and reduce costs but also significantly enhance the overall reproductive performance of the herd, possessing significant practical application value.

[0003] The PRR30 gene is generally considered a proline-rich protein, and its expression has been found in multiple tissues, particularly the testes and reproductive system. The PRR30 gene protein sequence contains multiple proline residues, which suggests it may play a role in protein-protein interactions, signal transduction, or cell morphology alterations. It plays a specific role at different stages of spermatogenesis. Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have been widely used in animal breeding, becoming an important tool for studying the relationship between genes and traits, and diseases. SNP markers can effectively identify the genetic characteristics of superior breeds in animal and plant breeding, thereby promoting precision breeding. Screening for genes and their SNP molecular markers related to bull spermatogenesis and semen quality is of significant application value and practical importance for early assessment of bull reproductive performance and promoting the breeding of superior bulls. However, the discovery and research of SNPs in the PRR30 gene related to bull semen quality have not yet been reported. Summary of the Invention

[0004] The purpose of this invention is to provide the application of PRR30 gene SNPs and their haplotype combinations in identifying the quality of bull semen, thereby shortening the screening cycle and improving breeding efficiency.

[0005] The technical solution of this invention is described in detail below:

[0006] In a first aspect, the present invention provides the application of PRR30 gene SNPs in identifying the semen yield of bulls, wherein the SNPs are SNP7: g.794 C>A or SNP8: g.2247 G>T, and the NCBI reference sequence of the PRR30 gene is NC_037338.1;

[0007] Bulls with the SNP7 genotype CA had a significantly higher semen yield than bulls with the genotype CC.

[0008] Bulls with the SNP8 genotype GG had significantly higher semen yields than bulls with the genotype GT.

[0009] Optionally or preferably, SNP7 and SNP8 are positions 3194 and 4647 of the nucleotide sequence shown in SEQ ID NO:1, respectively.

[0010] Secondly, this invention provides the application of a reagent for detecting SNPs in the PRR30 gene in identifying the semen yield of bulls, wherein the SNPs are SNP7: g.794 C>A or SNP8: g.2247 G>T, and the NCBI reference sequence of the PRR30 gene is NC_037338.1.

[0011] Bulls with the SNP7 genotype CA had a significantly higher semen yield than bulls with the genotype CC.

[0012] Bulls with the SNP8 genotype GG had significantly higher semen yields than bulls with the genotype GT.

[0013] Optionally or preferably, in the above applications, the reagent includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO: 2~3.

[0014] Thirdly, this invention provides the application of a SNP in the promoter region of the PRR30 gene in identifying the rate of sperm abnormality in bulls, wherein the SNP is SNP2: g.-2151 C>T, and SNP2 is located at position 251 of the nucleotide sequence shown in SEQ ID NO:1;

[0015] Bulls with the SNP2 genotype CT had a significantly lower sperm abnormality rate than bulls with the SNP2 genotype CC.

[0016] Fourthly, this invention provides the application of a reagent for detecting SNPs in the promoter region of the PRR30 gene in identifying the rate of sperm abnormalities in bulls, wherein the SNP is SNP2: g.-2151 C>T, and SNP2 is located at position 251 of the nucleotide sequence shown in SEQ ID NO:1;

[0017] Bulls with the SNP2 genotype CT had a significantly lower sperm abnormality rate than bulls with the SNP2 genotype CC.

[0018] Optionally or preferably, in the above applications, the reagent includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:4~5.

[0019] Fifthly, this invention provides the application of PRR30 gene SNP haplotype combinations in identifying bull semen quality, wherein the semen quality includes semen volume and / or sperm abnormality rate, and 5 of the SNPs are located on the promoter and 3 are located on the gene.

[0020] The five SNPs located on the promoter are as follows:

[0021] SNP1: g.-2247 G>T, located at position 155 of the sequence shown in SEQ ID NO:1.

[0022] SNP2: g.-2151 C>T, located at position 251 of the sequence shown in SEQ ID NO:1

[0023] SNP3: g.-2136 T>C, located at position 266 of the sequence shown in SEQ ID NO:1

[0024] SNP4: g.-2133 G>A, located at position 269 of the sequence shown in SEQ ID NO:1.

[0025] SNP5: g.-1231 C>T, located at position 1171 of the sequence shown in SEQ ID NO:1

[0026] The three SNPs located on the gene are as follows:

[0027] SNP6: g.778 G>A, located at position 3178 of the sequence shown in SEQ ID NO:1

[0028] SNP7: g.794 C>A, located at position 3194 of the sequence shown in SEQ ID NO:1

[0029] SNP8: g.2247 G>T, located at position 4647 of the sequence shown in SEQ ID NO:1;

[0030] Compared to other haplotype combinations, the H1H11 haplotype combination yielded higher sperm collection volume and lower sperm abnormality rate. The SNP1-SNP8 genes of haplotype H1 are GCTGCGCG, and the SNP1-SNP8 genes of haplotype H11 are GTTGCAAG.

[0031] In a sixth aspect, the present invention provides the application of a reagent for detecting SNP haplotype combinations of the PRR30 gene in identifying the quality of bull semen, wherein the semen quality includes semen volume and / or sperm abnormality rate, and wherein 5 of the SNPs are located on the promoter and 3 are located on the gene;

[0032] The five SNPs located on the promoter are as follows:

[0033] SNP1: g.-2247 G>T, located at position 155 of the sequence shown in SEQ ID NO:1.

[0034] SNP2: g.-2151 C>T, located at position 251 of the sequence shown in SEQ ID NO:1

[0035] SNP3: g.-2136 T>C, located at position 266 of the sequence shown in SEQ ID NO:1

[0036] SNP4: g.-2133 G>A, located at position 269 of the sequence shown in SEQ ID NO:1.

[0037] SNP5: g.-1231 C>T, located at position 1171 of the sequence shown in SEQ ID NO:1

[0038] The three SNPs located on the gene are as follows:

[0039] SNP6: g.778 G>A, located at position 3178 of the sequence shown in SEQ ID NO:1

[0040] SNP7: g.794 C>A, located at position 3194 of the sequence shown in SEQ ID NO:1

[0041] SNP8: g.2247 G>T, located at position 4647 of the sequence shown in SEQ ID NO:1;

[0042] Compared to other haplotype combinations, the H1H11 haplotype combination yielded higher sperm collection volume and lower sperm abnormality rate. The SNP1-SNP8 genes of haplotype H1 are GCTGCGCG, and the SNP1-SNP8 genes of haplotype H11 are GTTGCAAG.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] This invention, based on the PRR30 promoter and gene analysis of 244 bulls, identified a total of 8 SNPs. Correlation analysis with bull semen quality revealed that two SNP loci were significantly correlated with semen volume (P < 0.05): the CA type individuals at the g.794 C>A locus and the GG type individuals at the g.2247 G>T locus had significantly higher semen volumes than the CC type individuals at the g.794 C>A locus and the GT type individuals at the g.2247 G>T locus, respectively. One SNP locus was significantly correlated with sperm abnormality rate (P < 0.05): the CT type individuals at the g.-2151 C>T locus had a significantly lower sperm abnormality rate than the CC type individuals at the g.-2151 C>T locus. Eleven haplotype combinations were identified among the 8 SNP loci. The H1H11 genotype combination was the dominant haplotype combination, exhibiting significantly higher semen volume and a significantly lower sperm abnormality rate than other haplotype combinations.

[0045] The SNPs and their dominant haplotype combinations provided by this invention can effectively help staff assess the reproductive performance of bulls in the early stages, screen for bulls with dominant genes, promote the breeding of superior bull breeds, shorten the screening cycle, and improve breeding efficiency. Attached Figure Description

[0046] Figure 1 The following are statistical results of the expression level of the PRR30 gene in different tissues and testes of different ages in the examples.

[0047] Figure 2 The example illustrates the different bases at eight SNP sites on the PRR30 promoter and gene sequence.

[0048] Figure 3 This is a statistical chart showing the correlation between three SNP sites and semen quality in the example. Detailed Implementation

[0049] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0050] Example 1

[0051] 1.1 PRR30 gene expression profile in testicular tissue

[0052] Testicular tissue was collected from three newborn Holstein bulls within one week of birth, and heart, liver, spleen, lung, kidney, and testicular tissues were collected from three adult Holstein bulls. RNA was extracted from the testicular tissue using the Trizol method and reverse transcribed into cDNA using a reverse transcription reagent. The cDNA obtained from this reverse transcription step was used as a template. RT-qPCR technology was employed, with β-actin as an internal control gene. The amplification system was prepared according to the instructions of the quantitative PCR reagent, and the reaction was performed in a real-time quantitative PCR instrument.

[0053] The results showed that the PRR30 gene was enriched and expressed in bovine testicular tissue, and its expression level in adult bovine testicular tissue was significantly higher than that in newborn calves. (See [link to relevant documentation]). Figure 1 This spatiotemporal specificity of expression suggests that PRR30 may play an important role in testicular development and spermatogenesis.

[0054] 1.2 Association analysis of genetic markers on PRR30 and semen quality

[0055] 1.2.1 High-salt method for extracting genomic DNA from bull frozen semen

[0056] Genomic DNA was extracted from frozen semen of 244 bulls using a high-salt method. Complete semen quality records were available for all 244 bulls. Semen quality data, including semen volume, sperm motility, semen density, post-freezing motility, and abnormality rate, were averaged from 2018 to 2024.

[0057] 1.2.2 Amplification of the bull PRR30 gene and promoter sequence

[0058] Based on the publicly available PRR30 gene and promoter sequences from NCBI, PCR primers were designed to amplify the gene and promoter sequences of PRR30 from 246 bulls.

[0059] Upstream primer for gene: 5'-AAGGAGAGACTGAATGCCCC-3' (SEQ ID NO:2).

[0060] Downstream primer for gene: 5'-CACCCCTTGTTGGGTTCTGG-3' (SEQ ID NO:3);

[0061] Product size: 2788bp.

[0062] Upstream primer for promoter: 5'-TTCACTTTCATCCAGAGGCT-3' (SEQ ID NO:4).

[0063] Promoter downstream primer: 5'-TAGCAGTAGCAGTGGGG-3' (SEQ ID NO:5);

[0064] Product size: 2546bp.

[0065] The amplified gene and promoter sequence were subjected to Sanger sequencing. The promoter and gene sequence of the PRR30 gene are as follows:

[0066] TTCACTTTCATCCAGAGGCTTTTAGTTCCTCTTCACTTTCTGCCATAAGGGTGGTGTCATCTGCATATCTGAGGTTATTGATATTTCTCCCGACAATCTTGATTCCAGCTTGTGCTTCTTCCAGCCCAGCGTTTCTCATGATGTACTCTGCATA G AAGTTAAATAAGCAGGGTGACAAATATACAGCCTTGACGTACTCCTTTCCTATTTGGAACCAGTCTGTTGTTCCATGTCCAGTTCTAACTGTTGC C TCCTGACCTGCATA T AG GTTTCTCAAGAGGCAGGTCGGGTGGTCTGGTATTCCCATCTCTTTCAGAATTTTCCACAGTTTCTTGTGATCTACACAGTCAAAGGCTTTGACATAGTCAATAAGCAGAAATAGATGTTTTTCTGGAACTCTCTTGCTTTTTCCATGATCCAGTGGATGTTGGCAATTTGATCTCTGGTTCCTCTGCCTTTTCTAAAACCAGCTTGAACATCTGGAAGTTCACGGTTCATGTATTGCTGAAGCCTAGTTTGGAGAATTTTCAGCATTACTTTACTAGCGTGTGAGATGAGTGCAATTGTGCGGTAGTTTGAGCATTCTTTGGCATTGCCTTTCTTTGGGATTGGAATGAAAACTGACCTTTTCCAGTCCTGTGGTGAAACGTAAATCAAAGTCCTAATATTATACTACTTTACACCCACTTCTGCTGCTGCTGCTGCTAAGTCGCTTCAGTCGTGTCCAACTCTGTGAGACCCCAGAGACGGCAGCCCACCAGGCTCCCCCATCCCTGGGATTCTCCAGGCAAGAACACTGGAGTGGGTTGCCATTTCCTTCTCCAATGCATGAAAGTGAAAAGTGAAAGGAAAGTCGCTCAGTCGTGTCCGGCTCTTAGCGACCCCATGGACTGCAGCCTACTCAGGCTCCTCTGCCCATGGGATTTTCCAGGAAAGAGTATTGGAGTGGGTTGCCGTTGTCTTCTCCGACTTCGTACCCACTAGGATTGCTAAAACAAAAAAGACAGACAACAGCATGTGTTGGTGAGGATAGGAAAACTTGGAAGCATTGTACCTTGCTGGTGGGATTCGAAAATGGTACAACTAATTTGGAAGACAGTTTGGCAGCTTCTCAAAATGTTAATAATAGACTTATCATGTGATTCCGCAACTCTATCACTGGTATCTACT CT TTGTGACATAGGCACTAGGTGCCAGGGAGAACTGCTCCAGGAAATGGGGCTCCCAGCTCCCAAGGGGGGCGGCAACGCCGCCCCTTAGACACAGTCTCTGTCTCCCAGAGGCTTTCACCAGCTGGCCCCACTGCTACTGCTGCTACTGAGTGTGAAAAGCCACCTGGGTTGGGGCCAGGCTGAGTCAGAGGACATCAGCATTAGGGAAGACAGGGATTAGGGCCACCAGAGTGCCACAAAACCAGGATGCTTGCAGAATCTGTGATTTGGATTTAAGAGAAAGAAAACCCGTAATAGAAGACCTCCTCCTGGCTGAACAAGGACTGAGGGCAAGACTCAGACCAAAATCTGAGTCAGAGTGAGTTTAGGTTGACAGACGCTGGGGGCAGAGAGGGGCATATCCACCATTTGTTGACTCTATTTCCCTCTCTCCAAGGTCCCCTCATTGCTGAAGTGCCTTGAGAAACAGCCCAGAGGAACCTTTATTGGTAAGAGTTCCCAGGACCAGAACACCCTCAATTCCTAGTTCCATCTCAGTCTCCATCTCCCAATTCCCCTCCTCTAACTCCATCCTCTCCACCCTACCCTCCCTTGCCTCTCCTCTCCTCCTCCATTCTCACCTTCTCTGGAGCTTTTTGCCAGCTCTTCTGACCCCAGGGGTGGTATGGATTTAGGATCGTGGTGAACCAGCCCATACACAGTACATAAACCAGAGCCAGAAATGGACCCAGTCTCCCCGTGTCATGGGCTCTGTTTCTTTCTCTACAGATCCTATG A GCTGTGTCTTCCTCC CG GTCCACTTGAAGCCCAGGCCTTCCTCTGCCCCAAAGAGACCTGCCTCTCTAGGGCCCATTCCCCAAAAGTCACCACTCTAGTTCCAGAGCCACGGAGGCCCCCTGGAGCACCTCTTCTGAATCCCACCAGCCCTGCTCGGCTCCAGACCTCAGGGAGCCCCCGAGACACTCTGAAGGGCTGGCTGGCTGGAGGTCAGGTGTGTTCTCCAGTCCTGAACCCTGGGAGCCCCTTGTGGAGTCTGCTTTCTCCTGGCTGAAGAGGACCAAGGGCATCTGAGGCCCCACTCAGCCTTCTGTGTAACCAATTAAAAAAAAAAAAAAAAGCCTGACCCTGCAAAACT (SEQ ID NO:1), position 2401 is the transcription start site +1 site, upstream is the promoter sequence, downstream is the gene sequence.

[0067] 1.2.3 Identification of SNP sites on the PRR30 gene and its promoter

[0068] The PRR30 gene and promoter sequences obtained by amplification were sequence aligned using software to identify SNP sites on the PRR30 promoter and gene.

[0069] Five SNP sites were identified at the promoter: SNP1: g.-2247 G>T, SNP2: g.-2151 C>T, SNP3: g.-2136 T>C, SNP4: g.-2133 G>A, and SNP5: g.-1231 C>T. Three SNP sites were identified at the gene level: SNP6: g.778 G>A, SNP7: g.794 C>A, and SNP8: g.2247 G>T. (See [link to gene description]). Figure 2 In the sequence shown by SEQ ID NO:1, positions 155, 251, 266, 269, 1171, 3178, 3194, and 4647 represent the locations of SNP1 to SNP8, indicated by underline and bold font.

[0070] 1.2.4 Correlation analysis between different genotypes and haplotypes and bull semen quality

[0071] The correlation between different PRR30 genotypes and bull semen quality was analyzed using software. The results are shown in the table below:

[0072] Table 1. Results of association analysis between different PRR30 genotypes and bull semen quality.

[0073]

[0074] The results showed that two SNP loci (SNP7 and SNP8) were significantly correlated with the amount of semen collected (P < 0.05). The amount of semen collected by individuals with the CA type (SNP7: g.794 C>A locus) was significantly higher than that of individuals with the CC type, and the amount of semen collected by individuals with the GG type (SNP8: g.2247 G>T locus) was significantly higher than that of individuals with the GT type.

[0075] One SNP locus (SNP2) was significantly correlated with sperm abnormality rate (P < 0.05). Individuals with the CT morphology (SNP2: g.-2150 C>T locus) had a significantly lower abnormality rate than those with the CC morphology. (See [link to relevant documentation]). Figure 3 .

[0076] Haplotype analysis of the above 8 SNP sites revealed a total of 11 haplotype combinations:

[0077] H1=GCTGCGCG,

[0078] H2=GCTGTGCT,

[0079] H3=GTTGCGCG,

[0080] H4=TTCACGCG,

[0081] H5=TTCATGCT,

[0082] H6=TTTGCGCG,

[0083] H7=GCTGCAAG,

[0084] H8=GCTGCGCT,

[0085] H9=GTTACGCG,

[0086] H10=GCTGCACG,

[0087] H11=GTTGCAAG.

[0088] The correlation between different haplotype combinations of PRR30 and bull semen quality traits was analyzed using SPASS software. The results are shown in Table 2.

[0089] Table 2. Correlation between different haplotype combinations and bull semen quality

[0090]

[0091] The results showed that the semen collection volume of haplotype combination H1H11 was significantly higher than that of other haplotype combinations, and the abnormality rate of haplotype combination H1H11 was significantly lower than that of other haplotype combinations, making it the dominant haplotype combination.

[0092] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. The use of reagents for detecting PRR30 gene SNPs in the preparation of products for identifying the semen quantity of a bull, characterized in that, The SNP is SNP7 or SNP8, SNP7 is located at position 3194 of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is C or A; SNP8 is located at position 4647 of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is G or T; The semen collection volume of the bull with SNP7 genotype CA is significantly higher than that of the bull with SNP7 genotype CC; The semen collection volume of the bull with SNP8 genotype GG is significantly higher than that of the bull with SNP8 genotype GT.

2. Use according to claim 1, characterized in that, The reagent comprises a primer pair, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 2-3.

3. The use of reagents for detecting the SNP in the promoter region of the PRR30 gene in the preparation of products for identifying the level of abnormality of bull sperm, characterized in that, The SNP is SNP2, SNP2 is located at position 251 of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is C or T; The sperm abnormality rate of the bull with SNP2 genotype CT is significantly lower than that of the bull with SNP2 genotype CC.

4. Use according to claim 3, characterized in that, The reagent comprises a primer pair, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 4-5.

5. The use of reagents for detecting the SNP haplotype combination of PRR30 gene in the preparation of products for identifying the quality of bull semen, characterized in that, The semen quality comprises the semen collection volume and / or the sperm abnormality rate, 5 of the SNPs are located on the promoter, and 3 of the SNPs are located on the gene; The 5 SNPs located on the promoter are as follows: SNP1 is located at position 155 of the sequence shown in SEQ ID NO: 1, and the polymorphism is G or T; SNP2 is located at position 251 of the sequence shown in SEQ ID NO: 1, and the polymorphism is C or T; SNP3 is located at position 266 of the sequence shown in SEQ ID NO: 1, and the polymorphism is T or C; SNP4 is located at position 269 of the sequence shown in SEQ ID NO: 1, and the polymorphism is G or A; SNP5 is located at position 1171 of the sequence shown in SEQ ID NO: 1, and the polymorphism is C or T; The 3 SNPs located on the gene are as follows: SNP6 is located at position 3178 of the sequence shown in SEQ ID NO: 1, and the polymorphism is G or A; SNP7 is located at position 3194 of the sequence shown in SEQ ID NO: 1, and the polymorphism is C or A; SNP8 is located at position 4647 of the sequence shown in SEQ ID NO: 1, and the polymorphism is G or T; Compared with other haplotype combinations, the semen collection volume is higher and the sperm abnormality rate is lower when the haplotype combination is H1H11; the SNPs 1-SNP8 of haplotype H1 are GCTGCGCG in sequence, and the SNPs 1-SNP8 of haplotype H11 are GTTGCAAG in sequence.

Citation Information

Patent Citations

  • SNP site related to sperm motility of Chinese Holstein bull and application of SNP site

    CN118308497A

  • HNRNPA2B1 gene-based SNP molecular marker related to bovine sperm malformation rate and application of HNRNPA2B1 gene-based SNP molecular marker

    CN120060502A