MIRA primer pair, probe and kit for detecting bacillus anthracis and application of MIRA primer pair and probe

Abstract

The invention relates to an MIRA primer pair, a probe and a kit for detecting bacillus anthracis and application thereof, and belongs to the field of animal epidemic disease detection, the primer pair comprises upstream and downstream primers for identifying protective antigen pagA gene on bacillus anthracis pXO1 plasmid, upstream and downstream primers for capsule capB gene on pXO2 plasmid, and upstream and downstream primers for specific gene BA5345 on chromosome; the probes comprise a probe for identifying a protective antigen pagA gene on a bacillus anthracis pXO1 plasmid, a probe for a capsule capB gene on a pXO2 plasmid and a probe for a specific gene BA5345 gene on a chromosome. The rapid detection of bacillus anthracis can be realized, the operation is simple, the reaction is rapid and sensitive, the specificity is good, the product obtained by the reaction can be subjected to visual result judgment by naked eyes through a portable blue light instrument, and rapid, visual and portable nucleic acid detection is realized.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of animal epidemic detection, and particularly relates to a MIRA primer pair and probe for detecting Bacillus anthracis, a kit and application thereof. BACKGROUND

[0002] Anthrax is a serious zoonosis caused by Bacillus anthracis, which threatens the health of livestock, wild animals and humans, and even leads to the death of sick animals. Bacillus anthracis is a gram-positive bacillus that can form spores in the soil environment and survive for decades. It has strong resistance to PH, ultraviolet light and temperature. Generally, the spores of Bacillus anthracis enter the host through the skin, gastrointestinal tract or inhalation route, then rapidly germinate into proliferative forms to cause infection and disease. Due to the strong survival ability of spores in the environment, Bacillus anthracis has unique transmission dynamics. Therefore, although there may be no anthrax cases for several years or even decades in some areas, there is still a possibility of sudden outbreak of the disease. Due to this feature, it is difficult to completely eliminate the source of anthrax. Therefore, it is urgent to establish a detection technology with simple operation, rapid reaction, high sensitivity and good specificity to determine the epidemic as early as possible and better monitor the source of anthrax.

[0003] Multienzyme isothermal rapid nucleic acid amplification (MIRA) is a new type of in vitro nucleic acid amplification technology, which mainly relies on recombinase, single-stranded binding protein, auxiliary protein, DNA polymerase and DNA helicase. MIRA method can obtain amplification product within 30 min at 37-42℃, and further combined with exo probe and exonuclease III, the reaction data can be read in real time, which has the characteristics of high sensitivity, good specificity, on-site rapid detection and the like. In addition, the probe contains FAM fluorescent group, which shows green fluorescent signal under blue light excitation, realizing the visual judgment of reaction results.

[0004] At present, there are various detection methods for Bacillus anthracis, mainly including traditional culture method, molecular biology technology (such as PCR and real-time PCR) and emerging biosensor detection, but these methods still face some technical problems in practical application. Among them, the traditional culture method is a classic method for detecting Bacillus anthracis, but it takes a long time (usually 12-120h), and the specificity is insufficient in distinguishing Bacillus anthracis from its close species; the molecular biology method has been widely used in the detection of Bacillus anthracis, and has high sensitivity and specificity, but the specificity is still insufficient in complex sample background, and the laboratory equipment and operating personnel are required, which is difficult to realize on-site rapid detection; in recent years, the biosensor technology has shown good application prospect in the detection of Bacillus anthracis, and can realize high specificity detection in complex samples, however, the requirement for detection equipment is strict, which limits its large-scale popularization and application to a certain extent. SUMMARY

[0005] In order to solve the problems existing in the prior art, the present application provides a MIRA primer pair and probe for detecting Bacillus anthracis, a kit and application thereof, so as to realize simple, rapid, sensitive and specific detection of Bacillus anthracis based on the MIRA method.

[0006] The technical scheme adopted by the present application to solve the technical problems is as follows:

[0007] In a first aspect, the present application provides a MIRA primer pair and probe for detecting Bacillus anthracis, wherein the MIRA primer pair comprises: upstream and downstream primers for identifying the protective antigen pagA gene on the pXO1 plasmid of Bacillus anthracis, upstream and downstream primers for the capsule capB gene on the pXO2 plasmid, and upstream and downstream primers for the specific gene BA5345 gene on the chromosome.

[0008] The upstream and downstream primer sequences of the pagA gene are:

[0009] pagA-F: CGTACAGTGATTTCGAAAAGGTTACAGGACGGATT;

[0010] pagA-R: CTATCAGTATTCTGTGTGGATTGATCCTCATTTTT;

[0011] The upstream and downstream primer sequences of the capB gene are:

[0012] capB-F: TATCGGTGAGCAACGCAGGGTAGTTAAAGA;

[0013] capB-R: ATCACTCCAACATTTGCTTGAATCATTTTA;

[0014] The upstream and downstream primer sequences of the BA5345 gene are as follows:

[0015] BA5345-F: AAAGGTTTGGGGTTACTGGTCTCTTTAGCCGC;

[0016] BA5345-R: TTTCTTTTCAATGATGCTTTTGATTTCATCAAAATTT;

[0017] The MIRA probe includes a probe pagA probe for identifying the protective antigen pagA gene on the pXO1 plasmid of Bacillus anthracis, a probe capB probe for the capsule capB gene on the pXO2 plasmid, and a probe BA5345 probe for the specific gene BA5345 gene on the chromosome;

[0018] The sequence of the probe pagA probe of the pagA gene is as follows: 5'-TGTGGCAGCTTATCCGATTGTACATGTAGA(FAM-dT)(THF)(BHQ1-dT)GGAGAATATTATTCT[C3-spacer]-3';

[0019] The sequence of the probe capB probe of the capB gene is as follows: 5'-ATTTGTGAATGTATGGCAGTTCAACCCGAT(FAM-dT)(THF)(BHQ1-dT)CAAATTATCTTCCAA[C3-spacer]-3';

[0020] The sequence of the probe BA5345 probe of the BA5345 gene is as follows: 5'-GTATGTAATGCACCAAGTATATTTTGGAAT(FAM-dT)G(THF)(BHQ1-dT)TGGGTGATGAATCAA[C3-spacer]-3'.

[0021] In a second aspect, the present application provides a MIRA kit for detecting Bacillus anthracis, which contains the MIRA primer pair and the probe for detecting Bacillus anthracis.

[0022] As a preferred embodiment, the MIRA kit further contains a fluorescent basic reaction unit such as an A Buffer, a DNase-free water, and a B Buffer.

[0023] As a preferred embodiment, the fluorescent basic reaction unit includes a recombinase, a single-strand binding protein, an accessory protein, a DNA polymerase, and a DNA helicase.

[0024] In a third aspect, the present application provides a method for detecting MIRA of Bacillus anthracis, which is realized by using the MIRA kit for detecting Bacillus anthracis, and specifically includes the following steps:

[0025] (1) extracting DNA of the sample to be detected;

[0026] (2) using the extracted DNA as a template, performing MIRA amplification, and controlling the reaction conditions of pagA gene, capB gene and BA5345 gene at 37-42℃ for constant temperature amplification for 30 min;

[0027] (3) result determination.

[0028] As a preferred embodiment, in step (1), the DNA of the sample to be detected is extracted by using a bacterial genome kit, or the DNA of the sample to be detected is obtained by using a nucleic acid release agent.

[0029] As a preferred embodiment, in step (3), the result determination is performed by using a fluorescence quantitative detector or a portable blue light detector.

[0030] As a preferred embodiment, in step (3), the quality control standard in the result determination is that: the negative control has no amplification curve or visual result is colorless, and the positive control has an amplification curve or visual result is green, then the experimental result is valid, otherwise the experimental result is invalid.

[0031] As a preferred embodiment, in step (3), in the result determination, if the sample to be detected has no amplification curve or visual result is colorless, it is determined as negative; if the sample to be detected has an amplification curve or visual result is green, it is determined as positive.

[0032] The present application has the following beneficial effects:

[0033] The MIRA primer pair and probe for detecting Bacillus anthracis provided by the present application are suitable for MIRA detection of three target genes of Bacillus anthracis, and three target genes are screened out, which are suitable for upstream primers, downstream primers and probe Probe for MIRA rapid detection. The MIRA primer pair and probe can realize rapid detection of Bacillus anthracis, and have the advantages of simple operation, rapid reaction, high sensitivity, good specificity, etc.

[0034] The MIRA kit for detecting Bacillus anthracis provided by the application is based on MIRA primer pairs and probes for amplifying Bacillus anthracis, and can be completed in 30 min under constant temperature conditions of 37-42 DEG C, has low requirements for instruments and equipment, is short in time consumption, simple in operation, and can realize visual judgment of the obtained amplification product by a portable blue light instrument, is suitable for primary site diagnosis and instant detection (point of care testing, POCT), and can truly realize portable rapid nucleic acid detection, and can provide technical support for diagnosis, prevention and control and regional purification of Bacillus anthracis.

[0035] The MIRA primer pairs and probes for detecting Bacillus anthracis and the corresponding kit provided by the application can realize rapid detection of Bacillus anthracis, have the characteristics of simple operation, rapid reaction, high sensitivity and good specificity, and the obtained reaction product can be judged by visualizing the result by a portable blue light instrument, so that rapid, visual and portable nucleic acid detection can be realized. In the sensitivity detection, the sensitivity of MIRA instrument detection and visualization of pagA gene and capB gene can reach 0.2 CFU / reaction. The sensitivity of MIRA instrument detection and visualization of BA5345 gene can reach 0.02 CFU / reaction. In the specificity detection, according to the clinical symptoms and infection pathways of Bacillus anthracis, 39 kinds of clinically common and easily confused pathogenic bacteria are selected for specificity verification, and the results show that the MIRA rapid detection technology has good specificity. In the simulated Bacillus anthracis clinical blood sample, the detection line of pagA and capB genes is 14.8 CFU / reaction, and the detection line of BA5345 gene is 1.48 CFU / reaction. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 The sensitivity detection result graph of the primer and probe of the application.

[0037] Figure 1 In the figure, A: MIRA amplification results of pagA genes of Bacillus anthracis with different concentrations, B: MIRA amplification results of capB genes of Bacillus anthracis with different concentrations, C: MIRA amplification results of BA5345 genes of Bacillus anthracis with different concentrations, D: MIRA visualization results of pagA genes of Bacillus anthracis with different concentrations, E: MIRA visualization results of capB genes of Bacillus anthracis with different concentrations, and F: MIRA visualization results of BA5345 genes of Bacillus anthracis with different concentrations. In the figure, 1: 2x10 3 CFU / reaction, 2: 2x10 2CFU / reaction, 3: B. anthracis 20 CFU / reaction, 4: B. anthracis 2 CFU / reaction, 5: B. anthracis 0.2 CFU / reaction, 6: B. anthracis 0.02 CFU / reaction, 7: negative control.

[0038] Figure 2 Figure showing the results of specific detection of the primers and probes of the present application.

[0039] Figure 2A: MIRA amplification results of pagA gene of 39 different strains; B: MIRA amplification results of capB gene of 39 different strains; C: MIRA amplification results of BA5345 gene of 39 different strains. Among them, 1: Klebsiella pneumoniae ATCC700603, 2: Bacillus pacificus ATCC10987, 3: Bacillus thuringiensis ATCC10792, 4: Bacillus subtilis niger ATCC9372, 5: Bacillus subtilis ATCC6633, 6: Bacillus licheniformis ATCC11946, 7: Bacillus cereus ATCC11778, 8: Enterobacter cloacae ATCC700323, 9: Vibrio vulnificus ATCC27562, 10: Escherichia coli ATCC35150, 11: Vibrio parahaemolyticus ATCC17802, 12: Escherichia coli O157 EDL933, 13: Bacillus cereus ACCC11077, 14: Salmonella cholerae suis ATCC13312, 15: Enterobacter cloacae ATCC13047, 16: Pseudomonas aeruginosa ATCC27853, 17: Salmonella typhimurium CMCC(B)50115, 18: Shigella dysenteriae CMCC51252, 19: Enterococcus faecalis ATCC29212, 20: Staphylococcus aureus ATCC25923, 21: Yersinia pestis vaccine strain, 22: Aeromonas hydrophila ATCC7966, 23: Proteus mirabilis isolate Q1, 24: Proteus vulgaris isolate Q9b, 25: Enterococcus faecium ATCC35667, 26: Shigella sonnei ATCC25931, 27: Escherichia coli ATCC8739, 28: Brucella abortus vaccine strain 16M, 29: Clostridium perfringens ATCC13124, 30: Acinetobacter baumannii 1-209, 31: Bacillus cereus ATCC14579, 32: Yersinia enterocolitica CMCC52204, 33: Acinetobacter lwoffi Iz4b, 34: Streptococcus suis type 7, 35: Streptococcus suis type 9 sp5, 36: Streptococcus suis type 2 ZY458, 37: Streptococcus suis type 2 1330, 38: Klebsiella oxytoca isolate, 39: Pasteurella multocida ATCC11859, 40: negative control, 41: positive control (Bacillus anthracis No. 2 vaccine strain CVCC40202). The above 39 different strains are commercially available products disclosed in the prior art, which can be purchased and used.

[0040] Figure 3 Determination of MIRA reaction temperature.

[0041] Figure 3 A: 2 x 10 2Figure 1 shows MIRA amplification curves of different genes. A: MIRA amplification curve of pagA gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-pagA as template; B: MIRA amplification curve of capB gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-capB as template; C: MIRA amplification curve of BA5345 gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-BA5345 as template. 2 Figure 1 shows MIRA amplification curves of different genes. A: MIRA amplification curve of pagA gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-pagA as template; B: MIRA amplification curve of capB gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-capB as template; C: MIRA amplification curve of BA5345 gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-BA5345 as template. 2 Figure 1 shows MIRA amplification curves of different genes. A: MIRA amplification curve of pagA gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-pagA as template; B: MIRA amplification curve of capB gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-capB as template; C: MIRA amplification curve of BA5345 gene with 2×10 copies / reaction of recombinant plasmid pMD-18T-BA5345 as template. DETAILED DESCRIPTION

[0042] The technical solutions in the embodiments of the present application will be clearly and completely described below in conjunction with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of the present application.

[0043] In the following embodiments of the present application, the experimental methods involved are conventional methods unless otherwise specified.

[0044] In the following embodiments of the present application, the MIRA lyophilized enzyme comprises a lyophilized powder of recombinant enzyme, single-stranded binding protein, auxiliary protein, DNA polymerase, DNA helicase and auxiliary protein, which is purchased from Weifang Anpu Future Biotechnology Co., Ltd.

[0045] Example 1: Design of MIRA primers and probes for Bacillus anthracis

[0046] According to the 17 representative genotypes of Bacillus anthracis, the gene sequences of 32 representative strains of Bacillus anthracis were downloaded from NCBI, and the pagA, capB and BA5345 gene sequences of the 32 strains of Bacillus anthracis were analyzed by MAGE to determine the conserved regions of the pagA, capB and BA5345 genes. The conserved region of the BA5345 gene was determined as the specific sequence of Bacillus anthracis by blast comparison. The primers and probes of MIRA were designed in the conserved regions of pagA, capB and BA5345 genes by using Snap Gene software.

[0047] The design of the MIRA primer follows the following basic principles: the length of the primer should be greater than or equal to 30 bp and less than 48 bp, preferably between 30-35 bp; the length of the amplicon is not more than 500 bp, preferably between 100-200 bp; the GC content is greater than 30% and less than 70%, preferably between 40% to 60%; when designing the primer, the primer should be designed to avoid the presence of too many repeated short sequences in the primer; prevent the primer from forming a hairpin structure, avoid the formation of a primer dimer, etc. In order to ensure the sensitivity of MIRA amplification, a large number of primers need to be screened to obtain a primer combination with higher sensitivity. The best primer and probe sequence for detection sensitivity are shown in Table 1.

[0048] Table 1 Primer and probe sequence

[0049]

[0050] aPosition refers to the location in the Bacillus anthracis reference strain Ames Ancestor (GenBank: GCF_000008445.1).

[0051] The design method of the MIRA probe is: first design the initial sequence of each probe, and then generate the final MIRA probe of the application through marking or replacing treatment.

[0052] The initial sequence of each probe is as follows:

[0053] The initial sequence of the probe pagA probe for identifying the protective antigen pagA gene on the pXO1 plasmid of Bacillus anthracis is: 5'-TGTGGCAGCTTATCCGATTGTACATGTAGATATGGAGA ATATTATTCT-3';

[0054] The initial sequence of the probe capB probe for identifying the capsule capB gene on the pXO2 plasmid is: 5'-ATTTGTGAATGTATGGCAGTTCAACCCGATTATCAAATTATCTTCCAA-3';

[0055] The initial sequence of the probe BA5345 probe for identifying the BA5345 gene on the chromosome is: 5'-GTATGTAATGCACCAAGTATATTTTGGAATTGCTTGGGTGATGAATCAA-3'.

[0056] The initial sequence of the above-mentioned pagA gene probe is modified by labeling the 31st base T from the 5' end with a fluorescent group FAM, replacing the 32nd base A with THF, labeling the 33rd base T with a quenching group BHQl, and adding a C3-spacer blocking group to the 3' end. The final MIRA probe sequence of the pagA gene is shown in Table 1.

[0057] The initial sequence of the above-mentioned capB gene probe is modified by labeling the 31st base T from the 5' end with a fluorescent group FAM, replacing the 32nd base A with THF, labeling the 33rd base T with a quenching group BHQl, and adding a C3-spacer blocking group to the 3' end. The final MIRA probe sequence of the capB gene is shown in Table 1.

[0058] The initial sequence of the above-mentioned BA5345 gene probe is modified by labeling the 31st base T from the 5' end with a fluorescent group FAM, replacing the 33rd base C with THF, labeling the 34th base T with a quenching group BHQl, and adding a C3-spacer blocking group to the 3' end. The final MIRA probe sequence of the BA5345 gene is shown in Table 1.

[0059] Example 2 Establishment of a B. anthracis MIRA reaction system

[0060] (1) Preparation of the MIRA reaction system

[0061] The total volume of the MIRA reaction system is controlled to be 25 μL, and specifically includes:

[0062] A Buffer 14.7 μL;

[0063] 10 pmol / μL Primer-F 1 μL;

[0064] 10 pmol / μL Primer-R 1 μL;

[0065] 10 pmol / μL Probe 0.3 μL;

[0066] RNase Free ddH2O 4.75 μL;

[0067] DNA template 2 μL;

[0068] B Buffer 1.25 μL.

[0069] In the MIRA lyophilized enzyme powder, add 29.4 μL of B Buffer, 2 μL of upstream primer (10 pmol / μL Primer-F) and downstream primer (10 pmol / μL Primer-R), 0.6 μL of probe (10 pmol / μL Probe), and 9.5 μL of RNase Free ddH2O, mix well, and then aliquot 21.75 μL; add 2 μL of DNA template to the aliquoted mixture, add 1.25 μL of B Buffer on the reaction tube cap, mix well by inverting the reaction tube, and then perform MIRA amplification.

[0070] The template of the negative control is ddH2O, and the template of the positive control is the DNA template of Bacillus anthracis No. 2 vaccine strain (CVCC40202, GenBank: GCF_024396775.1).

[0071] (2) MIRA reaction system amplification

[0072] The reaction temperature is controlled at 38℃, and the constant temperature amplification is performed for 30 min.

[0073] In this embodiment, the amplification curve result is judged by a fluorescence quantitative detector, and the visual result is directly judged by the naked eye using a portable blue light electrophoresis monitor (MBE-300) of Major Science Co., Ltd. in a dark room.

[0074] Quality control standard: the negative control has no amplification curve or visual result is colorless, and the positive control has an amplification curve or visual result is green, and the experimental result is valid, otherwise the experimental result is invalid and needs to be retested.

[0075] Result description and judgment: the sample to be detected has no amplification curve or visual result is colorless, and the sample is judged to be negative; the amplification curve appears or the visual result is green, and the sample is judged to be positive.

[0076] Example 3: Screening of the optimal reaction temperature of Bacillus anthracis MIRA

[0077] In order to screen the optimal reaction temperature of the Bacillus anthracis MIRA detection method of the application, six groups (1: 42℃; 2: 41℃; 3: 40℃; 4: 39℃; 5: 38℃; 6: 37℃) of different temperature reaction conditions were set, and the sample adding method of Example 2 was used to screen the optimal reaction temperature of MIRA nucleic acid amplification of pagA, capB and BA5345 genes.

[0078] Reference pMD TM18-T vector cloning kit instructions, the construction of pMD-18T-pagA, pMD-18T-capB and pMD-18T-BA5345 recombinant plasmid. Set up 6 groups of different reaction temperature (37℃, 38℃, 39℃, 40℃, 41℃ and 42℃), with 10 2 copies / μL of the recombinant plasmid as the reaction template, and a negative control, according to the sample loading method of Example 2, MIRA nucleic acid amplification was carried out, and the detection results are shown in Figure 3

[0079] Through Figure 3 The results in A-C of the above table show that the optimal reaction temperature of the MIRA primers designed for pagA, capB and BA5345 genes in the application is determined, the optimal reaction temperature of the MIRA primers for pagA gene is controlled at 38℃, and the optimal reaction temperature of the MIRA primers for capB gene and BA5345 gene is controlled at 42℃.

[0080] Example 4 Sensitivity detection of MIRA primers and probes for Bacillus anthracis

[0081] In order to detect the sensitivity of the MIRA detection method for Bacillus anthracis in the application, different concentrations of Bacillus anthracis DNA templates were set up, and MIRA nucleic acid amplification was carried out according to the sample loading method of Example 2 and the reaction temperature of Example 3.

[0082] According to the DNA extraction reagent instructions, the DNA of Bacillus anthracis with a bacterial amount of 10 5 CFU, 10 4 CFU, 10 3 CFU, 10 2 CFU, 10 CFU and 1 CFU was extracted, 100 μL eluent was eluted, 2 μL of which was added as the reaction template for each reaction system, and a negative control was set up, and MIRA nucleic acid amplification was carried out according to the sample loading method of Example 2, and the detection results are shown in Figure 1

[0083] Through Figure 1 The results in A-F of the above table show that the MIRA primers and probe combination designed for pagA, capB and BA5345 genes in the application can ensure the sensitivity of the detection, among which the MIRA instrument detection sensitivity of pagA gene can reach 0.2 CFU / reaction, the MIRA instrument detection sensitivity of capB gene can reach 0.2 CFU / reaction, and the MIRA instrument detection sensitivity of BA5345 gene can reach 0.02 CFU / reaction. The sensitivity of visual detection can also be consistent with the sensitivity of instrument detection.

[0084] Example 5 MIRA specific detection of Bacillus anthracis ​​

[0085] In order to investigate the specificity of the anthrax Bacillus MIRA detection method, in this embodiment, Klebsiella pneumoniae ATCC700603, Bacillus pacificus ATCC10987, Bacillus thuringiensis ATCC10792, Bacillus subtilis niger ATCC9372, Bacillus subtilis ATCC6633, Bacillus licheniformis ATCC11946, Bacillus cereus ATCC11778, Enterobacter cloacae ATCC700323, Vibrio vulnificus ATCC27562, Escherichia coli ATCC35150, Vibrio parahaemolyticus ATCC17802, Escherichia coli O157 EDL933, Bacillus cereus ACCC11077, Salmonella cholerae suis ATCC13312, Enterobacter cloacae ATCC13047, Pseudomonas aeruginosa ATCC27853, Salmonella typhimurium CMCC(B)50115, Shigella dysenteriae CMCC51252, Enterococcus faecalis ATCC29212, Staphylococcus aureus ATCC25923, Yersinia pestis vaccine strain, Aeromonas hydrophila ATCC7966, Proteus mirabilis isolate Q1, Proteus vulgaris isolate Q9b, Enterococcus faecium ATCC35667, Shigella sonnei ATCC25931, Escherichia coli ATCC8739, Brucella abortus vaccine strain 16M, Clostridium perfringens ATCC13124, Acinetobacter baumannii 1-209, Bacillus cereus ATCC14579, Yersinia enterocolitica CMCC52204, Acinetobacter lwoffi Iz4b, Streptococcus suis type 7, Streptococcus suis type 9 sp5, Streptococcus suis type 2 ZY458, Streptococcus suis type 2 1330, Klebsiella oxytoca isolate, and Pasteurella multocida ATCC11859, and Bacillus anthracis No. 2 vaccine strain CMCC40202 were used as positive reaction templates, and a negative control was set, and MIRA nucleic acid amplification was performed according to the sample adding method of Example 2. The reaction temperature of pagA gene MIRA was controlled at 38℃, the reaction temperature of capB gene and BA5345 gene was controlled at 42℃, and MIRA was isothermally amplified for 30 min.

[0086] Through Figure 2 The results of A-C show that, in addition to the test group corresponding to the Bacillus anthracis positive DNA template, a normal fluorescence detection curve result appears, and the other bacteria and the negative control group do not appear amplification curve. The results show that the primers and probes of the present application can realize specific detection of Bacillus anthracis, and do not have cross reaction with other related bacteria, and have good specificity.

[0087] Example 6: Results of repeatability experiment of Bacillus anthracis MIRA detection method

[0088] To evaluate the repeatability of the MIRA detection method of Bacillus anthracis, high, medium and low concentrations of DNA templates of Bacillus anthracis were used, the sample loading method of Example 2 was followed, and the reaction temperature of Example 4 was used for MIRA nucleic acid amplification. The repeatability test was performed on the target genes pagA, capB and BA5345, with 3 repeats in batch and 3 repeats in batch.

[0089] As shown by the results in Table 2, the coefficient of variation CV values of the MIRA batch repeatability test for detecting the pagA gene were between 2.41% and 6.42%, the coefficient of variation CV values of the batch repeatability test were between 2.71% and 11.89%; the coefficient of variation CV values of the MIRA batch repeatability test for detecting the capB gene were between 0.00% and 5.41%, the coefficient of variation CV values of the batch repeatability test were between 0.83% and 12.03%; the coefficient of variation CV values of the MIRA batch repeatability test for detecting the BA5345 gene were between 0.00% and 8.30%, the coefficient of variation CV values of the batch repeatability test were between 0.00% and 4.60%, and the results showed that the MIRA detection method of Bacillus anthracis had good repeatability.

[0090] Table 2 pagA, capB and BA5345 repeatability test

[0091]

[0092] Example 7 Simulation of clinical blood samples

[0093] To verify the practicability of the MIRA detection method of Bacillus anthracis, sterile bovine whole blood and sterile sheep whole blood were mixed with different concentrations of Bacillus anthracis CVCC40202 to simulate clinical blood samples. In the BSL-2 laboratory, Bacillus anthracis II vaccine strain CVCC40202 was inoculated into 5 mL brain heart broth and cultured at 37°C for 6 h. 5 mL of the inoculum was centrifuged at 12000 rpm for 2 min, the supernatant was discarded, and the inoculum was washed 3 times with physiological saline and resuspended with 1 mL of physiological saline. The resuspended solution was diluted by 10 times, 20 uL of each gradient was taken and mixed with 180 uL of blood to simulate clinical bovine and sheep blood samples, and the Bacillus anthracis concentration in the 200 uL simulated clinical bovine and sheep blood samples was 7.4×10 6 CFU, 7.4×10 5 CFU, 7.4×10 4 CFU, 7.4×10 3 CFU, 7.4×10 2 CFU, 7.4×10 1 CFU and 7.4 CFU.

[0094] DNA of the simulated clinical blood sample was extracted using the blood genome kit, 100 uL of eluent was eluted, and the DNA of the simulated clinical blood sample was obtained, sterile deionized water was used as a negative control, and MIRA nucleic acid amplification was performed according to the sample adding method of Example 2. The pagA gene MIRA reaction temperature was controlled at 38 DEG C, the capB gene and the BA5345 gene reaction temperature was controlled at 42 DEG C, and MIRA was isothermally amplified for 30 min.

[0095] In the simulated clinical blood samples of cattle and sheep, the detection line of the pagA and capB genes was 14.8 CFU / reaction, and the detection line of the BA5345 gene was 1.48 CFU / reaction.

[0096] It can be seen that the anthrax bacillus MIRA detection method of the present application can be used for simple, rapid, sensitive and visual detection of anthrax bacillus and its clinical samples. The method of the present application is time-saving, simple to operate, suitable for instant detection in resource-limited environments, grass-roots and on-site, and can truly realize portable rapid nucleic acid detection, providing technical support for the diagnosis, prevention and control and regional purification of anthrax bacillus.

[0097] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features, but these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A MIRA primer pair and a probe for detecting Bacillus anthracis, characterized by, The MIRA primer pair comprises: upstream and downstream primers for identifying the protective antigen pagA gene on the pXO1 plasmid of Bacillus anthracis, upstream and downstream primers of the capsule capB gene on the pXO2 plasmid, and upstream and downstream primers of the unique gene BA5345 on the chromosome; The upstream and downstream primer sequences of the pagA gene are: pagA-F: CGTACAGTGATTTCGAAAAGGTTACAGGACGGATT; pagA-R: CTATCAGTATTCTGTGTGGATTGATCCTCATTTTT; The upstream and downstream primer sequences of the capB gene are: capB-F: TATCGGTGAGCAACGCAGGGTAGTTAAAGA; capB-R: ATCACTCCAACATTTGCTTGAATCATTTTA; The upstream and downstream primer sequences of the BA5345 gene are: BA5345-F: AAAGGTTTGGGGTTACTGGTCTCTTTAGCCGC; BA5345-R: TTTCTTTTCAATGATGCTTTTGATTTCATCAAAATTT; The MIRA probe comprises: the probe pagA probe for identifying the protective antigen pagA gene on the pXO1 plasmid of Bacillus anthracis, the probe capB probe of the capsule capB gene on the pXO2 plasmid, and the probe BA5345 probe of the unique gene BA5345 on the chromosome; The probe pagA probe sequence of the pagA gene is: 5'-TGTGGCAGCTTATCCGATT GTACATGTAGA(FAM-dT)(THF)(BHQ1-dT)GGAGAATATTATTCT[C3-spacer]-3'; The probe capB probe sequence of the capB gene is: 5'-ATTTGTGAATGTATGGCAG TTCAACCCGAT(FAM-dT)(THF)(BHQ1-dT)CAAATTATCTTCCAA[C3-spacer]-3'; The probe BA5345 probe sequence of the BA5345 gene is: 5'-GTATGTAATGCACCA AGTATATTTTGGAAT(FAM-dT)G(THF)(BHQ1-dT)TGGGTGATGAATCAA[C3-spacer]-3'.

2. A MIRA kit for detecting Bacillus anthracis, characterized by, The MIRA kit contains the MIRA primer pair and the probe for detecting Bacillus anthracis according to claim 1.

3. The MIRA kit for detecting Bacillus anthracis according to claim 2, wherein The MIRA kit further contains A Buffer, nuclease-free water, B Buffer, and a fluorescent basic reaction unit.

4. The MIRA kit for detecting Bacillus anthracis according to claim 3, wherein the Bacillus anthracis is a Bacillus anthracis Sterne strain. The fluorescent basic reaction unit comprises recombinase, single-strand binding protein, accessory protein, DNA polymerase, and DNA helicase.

5. A method for detecting Bacillus anthracis MIRA, characterized by, The MIRA kit for detecting Bacillus anthracis according to claim 2 is realized, and comprises the following steps: (1) extracting DNA of the sample to be detected; (2) taking the extracted DNA as a template to perform MIRA amplification, and the reaction conditions of pagA gene, capB gene and BA5345 gene are controlled to be constant temperature amplification at 37-42 DEG C for 30 min; (3) result determination.

6. The method of detecting B. anthracis MIRA according to claim 5, wherein, In step (1), the DNA of the sample to be detected is extracted by using a bacterial genome kit, or the DNA of the sample to be detected is obtained by using a nucleic acid release agent.

7. The method of claim 5, wherein the Bacillus anthracis MIRA is selected from the group consisting of SEQ ID NOs: 1-4. In step (3), the result determination is performed by using a fluorescence quantitative detector or a portable blue light detector.

8. The method of claim 5, wherein the Bacillus anthracis MIRA is selected from the group consisting of SEQ ID NOs: 1-4. In step (3), the quality control standard in the result determination is that: no amplification curve or visual result is colorless for the negative control, and the positive control appears an amplification curve or a visual result is green, so that the experimental result is valid, otherwise the experimental result is invalid.

9. The method of claim 5, wherein the Bacillus anthracis MIRA is selected from the group consisting of SEQ ID NOs: 1-4. In step (3), in the result determination, if the sample to be detected has no amplification curve or visual result is colorless, it is determined to be negative; If the sample to be detected appears an amplification curve or a visual result is green, it is determined to be positive.

Images