Rice salt stress regulation gene osmta1 and application thereof

CN120924554BActive Publication Date: 2026-06-23INST OF BOTANY CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511343890.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2026-06-23
Estimated Expiration
2045-09-19

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively address the problem of yield loss in rice under soil salinization conditions, especially the role of RNA methyltransferase OsMTA1 in salt stress response has not been fully utilized.

Method used

By knocking out the rice OsMTA1 gene using CRISPR/Cas9 gene editing technology, its expression level is reduced or its function is weakened, causing the plant to exhibit a salt-sensitive phenotype, thereby regulating the rice's salt stress response.

Benefits of technology

The study successfully altered the salt stress phenotype of rice, providing a theoretical basis for breeding transgenic plants with reduced salt tolerance and elucidating the molecular mechanism by which plants regulate salt stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924554B_ABST
    Figure CN120924554B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biology, and particularly relates to a salt stress regulation gene OsMTA1 of rice and application thereof, the present application obtains the transgenic rice after CRISPR gene editing of the OsMTA1 gene, compared with the receptor rice Zhonghua 11 (ZH11), after 180mM NaCl simulation salt stress treatment of two independent strains of the transgenic rice OsMTA1 gene knockout mutant, the phenotype is observed after recovery treatment and the survival rate is counted, it is confirmed that the osmta1 mutant presents salt-sensitive phenotype compared with the wild type ZH11, which indicates that the OsMTA1 gene plays an important role in the process of responding to salt stress of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a rice salt stress regulatory gene OsMTA1 and its applications. Background Technology

[0002] Rice is one of the world's most important food crops, and ensuring rice production is of paramount importance to national food security. The intensification of global warming has exacerbated soil salinization, posing a particularly serious threat to rice yields.

[0003] Recent findings have increasingly highlighted the role of epigenetics in regulating rice's salt stress response, including histone methylation, acetylation, and DNA methylation. This invention relates to RNAm... 6 A modification belongs to RNA methylation modification, specifically referring to RNA N modification. 6 This is a highly conserved type of chemical modification formed when a hydrogen atom (H) is replaced by a methyl group (CH3). The rice salt stress regulator OsMTA1 involved in this invention belongs to the RNA methyltransferase family and is responsible for methylating hydrogen atoms (H). 6 A modification is changed to methyl (CH3). This study found that after CRISPR gene editing and knockout of the OsMTA1 gene in rice, two different lines of the osmta1 knockout mutant exhibited a salt-sensitive phenotype compared to the recipient rice Zhonghua 11 (ZH11), demonstrating that the OsMTA1 gene mediates RNAm... 6 A modification plays an important role in the response to salt stress in rice. Further research on OsMTA1 and its downstream regulatory genes... 6 The study of A modification will examine m 6 Modification of A is of great significance in regulating the salt stress response of rice. Summary of the Invention

[0004] Based on the deficiencies in the prior art, the primary objective of this invention is to provide a rice salt stress regulatory gene, OsMTA1. This invention, by knocking out the OsMTA1 gene in rice plants, found that compared to the recipient rice variety Zhonghua 11 (ZH11), two lines of the osmta1 knockout mutant exhibited a salt-sensitive phenotype after salt stress treatment, thus successfully altering the salt stress phenotype of the target plant.

[0005] Another object of the present invention is to provide an OsMTA1 protein, the amino acid sequence of which is shown in SEQ ID NO:3. Knockout of the OsMTA1 gene significantly reduces the expression level of the OsMTA1 protein, thereby causing the plant to exhibit a salt-sensitive phenotype.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a rice salt stress regulatory gene, OsMTA1, the nucleotide sequence of which is shown in SEQ ID NO.1. Knocking out this gene in rice significantly reduces its expression level, thereby inducing a salt-sensitive phenotype in the plant.

[0008] Preferably, the CDS sequence of the rice salt stress regulatory gene OsMTA1 is shown in SEQ ID NO.2.

[0009] The present invention also provides a protein encoded by the rice salt stress regulatory gene OsMTA1, the amino acid sequence of which is shown in SEQ ID NO.3.

[0010] The present invention also provides a biological material, which is an expression cassette, vector, host cell, transgenic cell line or transgenic plant containing the rice salt stress regulatory gene OsMTA1.

[0011] This invention also provides the application of the rice salt stress regulatory gene OsMTA1, the protein, or the biomaterial in regulating rice salt stress or constructing a rice model with reduced salt tolerance.

[0012] Preferably, the application is to reduce the expression level of the rice OsMTA1 gene or weaken the function of the rice OsMTA1 gene, thereby reducing the salt tolerance of rice.

[0013] Preferably, the reduction of the expression level of the rice OsMTA1 gene or the weakening of the function of the rice OsMTA1 gene is achieved by targeting and knocking out the OsMTA1 gene in rice using CRISPR / Cas gene editing technology.

[0014] The present invention also provides a method for cultivating salt-sensitive rice, which improves the salt sensitivity of rice by reducing the expression level of the rice salt stress regulatory gene OsMTA1 or by reducing the activity of the protein.

[0015] The present invention has the following technical effects and advantages:

[0016] This invention experimentally demonstrates that knocking out the OsMTA1 gene in wild-type rice can yield transgenic rice with altered salt stress phenotypes. Compared to the recipient rice, OsMTA1 gene expression is reduced in the transgenic rice, with no significant difference in heading date under long-day and short-day conditions. Therefore, the OsMTA1 gene is associated with rice's response to salt stress, laying a theoretical foundation for breeding transgenic plants that positively regulate salt stress response.

[0017] This invention has important theoretical significance for further elucidating the molecular mechanism of plant regulation of salt stress and for cultivating new salt-tolerant crop varieties through genetic engineering. Attached Figure Description

[0018] Figure 1 The mutation types of the osmta1 mutants in the ZH11 background obtained using CRISPR / Cas9 technology were named osmta1-1 and osmta1-2, respectively, both of which are loss-of-function mutants.

[0019] Figure 2 Phenotypic images of wild-type ZH11 and mutants osmta1-1 and osmta1-2 after treatment with 180 mM NaCl salt stress were taken. First, photos were taken before treatment. During treatment, 180 mM NaCl was added to the nutrient solution. Photos were taken 14 days after treatment. Then, normal nutrient solution without salt was added during recovery. Photos were taken 14 days after recovery, and the survival rate was calculated.

[0020] Figure 3 A statistical chart showing the survival rates of homozygous mutants osmta1-1, osmta1-2, and wild-type ZH11 materials after salt stress recovery. Detailed Implementation

[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] The experimental material used in this invention is the commonly used japonica rice variety Zhonghua 11 (ZH11).

[0024] The CRISPR / Cas9 vectors used in the following examples were kindly provided by the laboratory of Liu Yaoguang at South China Agricultural University.

[0025] The Agrobacterium EHA105 competent cells in the following examples were produced in our laboratory, and the same competent cells are also available commercially.

[0026] Example 1: Cloning of the rice salt stress response gene OsMTA1

[0027] The inventors of this invention isolated and cloned a salt stress-responsive rice gene OsMTA1 from the rice variety Zhonghua 11, as shown in SEQ ID NO.1, and named the protein it encodes as OsMTA1 protein, as shown in SEQ ID NO.3.

[0028] Total RNA was extracted from rice variety Zhonghua 11 and reverse transcribed into cDNA. PCR amplification was performed using primers F (as shown in SEQ ID NO.4): ATGTTCTTGCAGTTGGCTGA and R (as shown in SEQ ID NO.5): TTAGTTCTTCTGTGGGGGTG. The PCR system was as follows: 10 μL of 2×Rapid Taq MasterMix (Vazyme), 1 μL of template, 0.5 μL each of forward primer (F) and reverse primer (R), and 8 μL of ddH2O, for a total of 20 μL. The PCR reaction program was: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. The PCR products were then subjected to Sanger sequencing. Sequencing results showed that the nucleotide sequence of the PCR amplification product was as shown in SEQ ID NO.1, and its coding sequence was nucleotides 1-2295 as shown in SEQ ID NO.2, encoding the OsMTA1 protein (amino acids 1-764 as shown in SEQ ID NO.3); the DNA shown in SEQ ID NO.1 was named the OsMTA1 gene.

[0029] Example 2 Construction of OsMTA1-deficient mutant rice

[0030] (1) Construction of vector and recombinant bacteria

[0031] Suitable targets were screened on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) using the DNA sequence shown in SEQ ID NO.1. Based on the score and target location, TGACAAAATTAGACAGCGGAA (as shown in SEQ ID NO.6), located in the exon of the OsMTA1 gene, was selected as the CRISPR / Cas9 target. Primer sequences F (as shown in SEQ ID NO.7): ggcaTGACAAATTAGACAGCGGAA and R (as shown in SEQ ID NO.8): aaacTTCCGCTGTCTAATTTGTCA were synthesized. After constructing the pCRISPR / Cas9 plasmid, the vector pCRISPR / Cas9-OsMTA1 was finally obtained. The plasmid pCRISPR / Cas9-OsMTA1 was transformed into Agrobacterium EHA105 competent cells to obtain recombinant Agrobacterium pCRISPR / Cas9-OsMTA1.

[0032] (2) pCRISPR / Cas9-OsMTA1 transformation in rice

[0033] The genetic transformation of rice was carried out by Wuhan Boyuan Biotechnology Co., Ltd., which obtained the T0 generation transgenic line of CRISPR / Cas9-OsMTA1 under the ZH11 background, namely the T0 generation of rice osmta1 mutant.

[0034] Example 3: Identification of transgenic rice CRISPR / Cas9-OsMTA1 T0 generation plants

[0035] DNA was extracted from leaves of the T0 generation of the rice osmta1 mutant. Using the extracted DNA as a template, PCR amplification was performed using primers specific to the OsMTA1 gene. The primer sequences were: F (as shown in SEQ ID NO. 9): TGTTAAAGAGATGATCGGCAGGAT; R (as shown in SEQ ID NO. 10): AGCTCGCCCATGGAAACTC. The PCR system was as follows: 10 μL of 2×Rapid TaqMaster Mix (Vazyme), 1 μL of template, 0.5 μL each of forward primer (F) and reverse primer (R), and 8 μL of ddH2O, for a total of 20 μL. The PCR reaction program was: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. The PCR products were subjected to Sanger sequencing to check for mutations at the target site. Leaf DNA extraction was performed according to the CTAB method.

[0036] The identification results showed that two independent transgenic plants with mutations in the OsMTA1 gene were finally identified (osmta1-1 and osmta1-2, respectively). DNA sequence alignment revealed the mutation sites as follows: Figure 1 As shown, osmta1-1 loses a G base, causing a frameshift mutation in OsMTA1, resulting in its loss of function. osmta1-2 inserts a 19bp base, similarly causing a frameshift mutation and resulting in its loss of function.

[0037] Example 4 Salt tolerance analysis of osmta1 mutant plants

[0038] Following the same culture conditions, wild-type ZH11 and osmta1-1, osmta1-2 mutant materials were grown for three weeks and then subjected to simulated salt stress treatment with 180 mM NaCl. After 14 days of treatment, photos were taken of both the treated and untreated materials. Recovery treatment then began, and after 14 days of recovery, photos were taken again. Figure 2 As shown. After 14 days of recovery treatment, the survival rates of the three groups were calculated, as follows: Figure 3As shown, the survival rate of ZH11 was approximately 55%, while the survival rates of osmta1-1 and osmta1-2 were only about 20%. This result indicates that the loss of function of OsMTA1 leads to greater sensitivity of plants to salt stress. Therefore, OsMTA1 plays a positive regulatory role in plant responses to salt stress.

[0039] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of the rice salt stress regulatory gene OsMTA1 in constructing a rice model with reduced salt tolerance, characterized in that... The nucleotide sequence of the rice salt stress regulatory gene OsMTA1 is shown in SEQ ID NO.1; The application is to reduce the expression level of the rice OsMTA1 gene or weaken the function of the rice OsMTA1 gene, thereby reducing the salt tolerance of rice.

2. The application according to claim 1, characterized in that, The CDS sequence of the rice salt stress regulatory gene OsMTA1 is shown in SEQ ID NO.

2.

3. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the OsMTA1 gene is shown in SEQ ID NO.

3.

4. The application according to claim 1, characterized in that, The reduction in the expression level of the rice OsMTA1 gene or the weakening of the function of the rice OsMTA1 gene is achieved by targeting and knocking out the OsMTA1 gene in rice using CRISPR / Cas9 gene editing technology.

5. A method for constructing a rice model with reduced salt tolerance, characterized in that, Salt tolerance in rice can be reduced by decreasing the expression level of the rice salt stress regulatory gene OsMTA1 or by reducing the activity of the protein encoded by the OsMTA1 gene. The nucleotide sequence of the rice salt stress regulatory gene OsMTA1 is shown in SEQ ID NO.1; The amino acid sequence of the protein encoded by the OsMTA1 gene is shown in SEQ ID NO.3.

Citation Information

Patent Citations

  • Plant salt-stress-induced gene OsSIR1 and encoded protein and application thereof

    CN104480119A