Application of motherwort N-methyltransferase gene and recombinant vector thereof in synthesis of stachydrine

Abstract

The invention provides an application of a motherwort N-methyltransferase gene and a recombinant vector thereof in synthesis of stachydrine. The N-methyltransferase gene is LjNMT37, has double functions, and can act on both proline and N-methylproline; the sequence of the LjNMT37 gene is as shown in SEQ ID No.1 (sequence identifier number 1). According to the invention, the LjNMT37 gene participating in a stachydrine synthesis route is cloned from motherwort for the first time. The enzyme coded by the LjNMT37 participates in a process from proline to N-methylproline, and also catalyzes the N-methylproline to generate stachydrine.

Description

Technical Field

[0001] This invention relates to the fields of plant molecular biotechnology and genetic engineering technology, specifically to the application of a Leonurus japonicus N-methyltransferase gene and its recombinant vector in the synthesis of stachydrine. Background Technology

[0002] Motherwort herb refers to the fresh or dried aerial parts of the plant *Leonurus japonicus*, belonging to the Lamiaceae family. It is a commonly used and widely distributed medicinal material in clinical practice, possessing the effects of promoting blood circulation and regulating menstruation, promoting diuresis and reducing swelling, and clearing heat and detoxifying. As a traditional Chinese medicine, it has been widely used for over 2000 years. Modern pharmacological studies have shown that motherwort not only has therapeutic effects on gynecological diseases but also possesses many other functions, such as cardioprotective and neuroprotective activities.

[0003] Stachydrine is one of the main bioactive compounds accumulated in Leonurus japonicus. According to the Pharmacopoeia of the People's Republic of China (2020 Edition), stachydrine is used as the official indicator for monitoring the quality of Leonurus japonicus herbs and preparations containing stachydrine. It has positive effects in cardiovascular and cerebrovascular diseases, neuroprotection, anti-cancer activity, uterine regulation, anti-inflammation, obesity treatment, and respiratory diseases. With the increasing incidence of cardiovascular diseases worldwide, stachydrine has attracted the attention of many scientists in the medical community.

[0004] To date, there are no reports on the functions of enzyme genes related to stachydrine biosynthesis. In the existing technology, during the 1950s and 60s, a Canadian team published articles on stachydrine biosynthesis for five consecutive years, but these articles only concluded that proline was a precursor for stachydrine biosynthesis. In the last two decades, researchers have found that feeding alfalfa with isotopically labeled proline can detect isotopically labeled stachydrine, further confirming that proline is the precursor of stachydrine. Other studies on stachydrine have focused on its physiological functions. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the existing technology and to provide an application of the Leonurus japonicus N-methyltransferase gene and its recombinant vector in the synthesis of stachydrine.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides an application of the Leonurus japonicus N-methyltransferase gene in the synthesis of stachydrine, wherein the N-methyltransferase gene is the LjNMT37 gene, and the enzyme encoded by the LjNMT37 gene catalyzes the following reaction: (a) N-methylproline is generated from proline as a substrate; (b) Stachyine is generated using N-methylproline as a substrate.

[0007] Preferably, the nucleotide sequence of the LjNMT37 gene is as shown in SEQ ID No. 1, or is a variant sequence of SEQ ID No. 1 that retains catalytic function by adding, deleting, or substituting one or more nucleotides.

[0008] Preferably, the amino acid sequence of the protein encoded by the LjNMT37 gene is shown in SEQ ID No. 2.

[0009] The present invention also provides a primer composition for amplifying the N-methyltransferase gene involved in the above-mentioned applications, wherein the primers for amplifying the LjNMT37 gene comprise: (a) First primer pair: SEQ ID No. 3 and SEQ ID No. 4; (b) Second primer pair: SEQ ID No. 5 and SEQ ID No. 6.

[0010] Preferably, SEQ ID No. 3 and SEQ ID No. 4 contain BamHI and SalI (prokaryotic vector) restriction sites; and SEQ ID No. 5 and SEQ ID No. 6 contain KpnI and SalI (tobacco vector) restriction sites.

[0011] The present invention also provides a recombinant vector in which the LjNMT37 gene is inserted.

[0012] Preferably, the method for preparing the recombinant vector includes: S1. Design and synthesis of primers with BamH1, Sal1 (prokaryotic vector) and KpnⅠ, SalⅠ (tobacco vector) restriction sites; S2. Total RNA extraction and cDNA synthesis from Leonurus japonicus; S3. After PCR amplification of the target gene, the overexpression vector is ligated via homologous recombination (Novizan ClonExpress II OneStep Cloning Kit). S4. After screening for positive clones, the recombinant vector is obtained.

[0013] Preferably, the vector is a prokaryotic expression vector pET-32a or a eukaryotic expression vector pCAMBIA1300.

[0014] This invention also provides two methods for synthesizing stachydrine using the above-described recombinant vector. One method includes the steps of: (a) introducing the recombinant vector into host cells to express a crude enzyme; and (b) generating stachydrine in vitro using N-methylproline as a substrate, catalyzed by the crude enzyme, wherein the total protein concentration of the crude enzyme is 0.5–0.7 μg / μL. The other method includes the steps of: (a) introducing the recombinant vector into tobacco cells to obtain transgenic tobacco; and (b) feeding the transgenic tobacco with proline, catalyzing the generation of stachydrine in vivo using a crude enzyme expressed in vivo.

[0015] The present invention also provides biomaterials containing the above-mentioned recombinant vector, including any one of the following: A1. Bioengineered bacteria containing the recombinant vector described above; A2. A transgenic tobacco cell line containing the recombinant vector described above.

[0016] This invention marks the first cloning of the gene LjNMT37, which encodes a component involved in the stachydrine synthesis pathway, from *Leonurus japonicus*, a medicinal plant belonging to the genus *Leonurus* in the Lamiaceae family. The enzyme encoded by LjNMT37 catalyzes the formation of N-methylproline from the precursor proline for stachydrine synthesis; the enzyme also acts on N-methylproline to generate stachydrine.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention is the first to clone the LjNMT37 gene, which encodes a gene involved in the synthesis of stachydrine, from Leonurus japonicus, a medicinal plant of the genus Leonurus in the Lamiaceae family. The gene sequence is an N-methyltransferase gene derived from Leonurus japonicus, and the enzyme it encodes can participate in the biosynthesis of stachydrine. This provides a theoretical basis for the large-scale production of stachydrine and also lays a solid foundation for the industrial production of other related compounds. Attached Figure Description

[0018] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 This is a graph showing the LC-MS detection results in Example 2 of the present invention. The first row shows the stachydrine standard (200 ng / mL), the second row shows the empty vector (EV), and the third row shows the crude enzyme system expressing LjNMT37 in prokaryotes. Figure 2 This is a graph showing the LC-MS detection results in Example 3 of the present invention. The first row shows the stachydrine standard (200 ng / mL), the second row shows EV representing the empty vector, and the third row shows the system of tobacco overexpression of LjNMT37. Figure 3 The reaction formula for the formation of stachydrine from LjNMT37. Detailed Implementation

[0019] This invention elucidates the process of stachydrine formation in Leonurus japonicus, obtains and clones a Leonurus japonicus N-methyltransferase LjNMT37, and synthesizes stachydrine in Escherichia coli using N-methylproline as a substrate. It also synthesizes stachydrine in tobacco using N-methyltransferase LjNMT37 as a proline substrate. This provides a theoretical basis for the large-scale production of stachydrine and lays a solid foundation for the industrial production of other related compounds.

[0020] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings to enable a better understanding of the invention. However, the following embodiments do not limit the scope of the invention.

[0021] Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared according to conventional methods, unless otherwise specified.

[0022] Example 1 This example illustrates the cloning of the Leonurus japonicus N-methyltransferase gene LjNMT37, the construction of its prokaryotic expression vector, and the construction process of its expression vector in tobacco. The specific construction process is as follows: (1) Design and synthesis of primers for LjNMT37 gene Full-length primers were designed based on the gene sequence. BamH1 (prokaryotic vector) / KpnⅠ (tobacco vector) restriction sites were added to the 5' end of the LjNMT37 primer, and Sal1 (prokaryotic vector and tobacco vector) restriction sites were added to the 3' end (restriction sites are indicated by underscores).

[0023] LjNMT37-32a-F: GCCATGGCTGATATC GGATCC ATGGCAATGGTTAATGGATCAAA (SEQ ID No. 3); LjNMT37-32a-R: TGCGGCCGCAAGCTT GTCGAC TCATGGAAAAACCTCGATCACA (SEQ ID No. 4); LjNMT37-p1300-F: ATTTGGAGAGGACAG GGTACC ATGGCAATGGTTAATGGATCAAA (SEQ ID No. 5); LjNMT37-p1300-R: CACCATGGTACTAGT GTCGACTGGAAAAACCTCGATCACAGACC (SEQ ID No. 6); The primers mentioned above were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0024] (2) Cloning of the LjNMT37 gene Using Leonurus japonicus leaves as material, total RNA was extracted from the leaves using an RNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., DP432) according to the instructions. cDNA from the leaves was obtained by reverse transcription using a reverse transcription kit (Tiangen Biotech (Beijing) Co., Ltd., KR118) according to the instructions.

[0025] Using cDNA as a template, PCR amplification reactions were performed with primers LjNMT37-32a-F, LjNMT37-32a-R and LjNMT37-p1300-F, LjNMT37-p1300-R to obtain the LjNMT37 gene. PCR reaction system: cDNA 2 μL, upstream primer 3 μL, downstream primer 3 μL, 10×KOD plus Buffer 5 μL, dNTP mixture 5 μL, MgSO4 3 μL, ddH2O 29 μL; The PCR program settings are: 1) 98 ℃, 3 min; 2) 98 ℃, 15 s; 3) 57 ℃, 30 s; 4) 68 ℃, 2 min; 5) 68 ℃, 10 min; cycles from 2) to 4), for a total of 30 cycles.

[0026] After PCR amplification, the product was detected by electrophoresis using a 1% agarose gel, yielding the 1080 bp LjNMT37 gene.

[0027] (3) Construct pET-32a-LjNMT37 and pCAMBIA1300-LjNMT37 overexpression vectors First, the corresponding vector is cut with the corresponding restriction endonuclease. The PCR product and the cut vector in step (2) are recovered using the Tiangen gel extraction kit (DP204-03) to recover the specific band. The concentration of the recovered product is measured, and then homologous recombination reaction is performed.

[0028] Homologous recombination reaction: PCR product 100 ng (4 μL), cut vector (1 μL), ClonExpress II OneStep Cloning Kit enzyme (2×) 5 μL; incubate at 50 ℃ for 15 min to obtain recombinant vector.

[0029] The above reaction product was transformed into Escherichia coli DH5α (the plasmid was added to the competent cell suspension, placed on ice for 20 min, heat-shocked at 42 °C for 1.5 min, quickly transferred to ice for 5 min, added to antibiotic-free LB medium, and incubated at 37 °C for 1 h). The bacterial culture (OD) 600 =0.2) was plated on LB solid medium containing 40 mg / L ampicillin (prokaryotic vector) / kanamycin (plant vector) and incubated overnight at 37 ℃. The next day, single colonies were picked for colony PCR verification. The primers used for LjNMT37 were their corresponding SEQ ID Nos. 3-6. The colony PCR system consisted of 10 μL of 2×Master Mix (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., 10102ES03), 0.5 μM each of upstream and downstream primers, and sterile water to a final volume of 20 μL. Single colonies were picked and PCR was performed. The PCR program was as follows: ① 94 ℃ denaturation for 5 min, ② 94 ℃ denaturation for 30 s, ③ 57 ℃ annealing for 30 s, ④ 72 ℃ extension for 2 min, repeated ②-④ 30 times, ⑤ 72 ℃ final extension for 10 min, ⑥ storage at 10 ℃. Positive clones were sent to a biotechnology company for sequencing. Based on the sequencing results, plasmids were extracted according to the instructions of the plasmid extraction kit (Tiangen Biotech (Beijing) Co., Ltd., DP103) to obtain plasmids pET32a-LjNMT37 and pCAMBIA1300-LjNMT37.

[0030] Example 2 This embodiment verifies in a prokaryotic expression system that the Leonurus japonicus LjNMT37 gene has the protein function of generating stachydrine using N-methylproline as a substrate. The specific verification process and results are as follows: Expression of the Leonurus japonicus LjNMT37 gene protein in Escherichia coli strain Rosetta (DE3): The prokaryotic expression vector pET32a-LjNMT37 was transformed into competent cells of Escherichia coli Rosetta (DE3) using conventional chemical transformation methods to obtain an E. coli strain containing the target gene. At the same time, an empty plasmid containing pET-32a (Ubimicron Biotechnology Co., Ltd., VT1216) was transformed as a negative control. The cells were grown overnight at 37 °C in LB solid medium containing 50 mg / L ampicillin.

[0031] Then, single colonies were selected for PCR verification. The reaction system consisted of 10 μL of 2×Master Mix (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., 10102ES03), 0.5 μM each of upstream and downstream primers, and sterile water to a final volume of 20 μL. Single colonies were selected and added to the system for PCR. The PCR primers were SEQ ID No. 3 and 4. The reaction program was as follows: ① denaturation at 94 ℃ for 5 min, ② denaturation at 94 ℃ for 30 s, ③ annealing at 57 ℃ for 30 s, ④ extension at 72 ℃ for 2 min, repeated 30 times from ② to ④, followed by a final extension at 72 ℃ for 10 min, and finally storage at 10 ℃. Approximately 10 positive monoclonal antibodies were selected and cultured overnight at 37°C and 200 rpm in 10 mL of LB liquid medium containing 50 mg / L ampicillin and 34 mg / L chloramphenicol. The culture was then transferred to 200 mL of fresh LB liquid medium containing at least 50 mg / L ampicillin and 34 mg / L chloramphenicol until OD500 was reached. 600 When the concentration reaches 0.5-1.0, add IPTG to a final concentration of 40 μM. Incubate at 16 ℃ and 200 rpm for 16 h. After collecting the bacterial cells by centrifugation at 4 ℃ and 10000 rpm, resuspend the cells in lysis buffer (aqueous solution containing 25 mM Tris–HCl pH 8.0, 50 mM NaCl, and 0.5 mM Tris), and then lyse the cells using a high-pressure cell disruptor. After centrifugation at 10000 rpm for 15 min, collect the supernatant, which is the crude enzyme solution containing LjNMT37. Perform the enzymatic reaction of LjNMT37 according to the following system: 30 μL crude enzyme solution (total protein concentration 0.5 μg / μL), 100 μM N-Pro (N-methylproline), 100 μM SAM (S-adenosylmethionine), 100 μM MgCl2, 0.1 M Tris-HCl (pH 7.5), and distilled water to a final volume of 300 μL. After reacting in a water bath at 30 ℃ for 3 h, 700 μL of methanol was added to terminate the reaction. After centrifugation at 12000 rpm for 10 min, the supernatant was collected and filtered through a 0.22 μM organic filter membrane (purchased from Titan Exploration Platform, 02036326) to obtain the sample, which was then analyzed by LC-MS.

[0032] LC-MS detection conditions: An ACQUITY UPLC HSS T3 1.8 µm 2.1 x 100 mm Columbus column was used for sample separation at 40 °C, with binary gradient elution using 0.1% formic acid aqueous solution (A) and acetonitrile (B). The elution program was as follows: 1) 0–2 min, 5%–5% B; 2) 2–5.5 min, 5%–40% B; 3) 5.5–6.5 min, 40%–95% B; 4) 6.5–8 min, 95%–95% B; 5) 8–8.1 min, 95%–5% B; 6) 8.1–11 min, 5%–5% B. Flow rate: 0.30 mL / min; column temperature: 40 °C; injection volume: 2 μL. Mass spectrometry conditions: positive ion mode, multiple reaction monitoring (MRM) scan, Declustering Potential 40, Entrance Potential 10, collision gas medium, ion spray voltage 5500 V, gas temperature 500 °C, ion source gases 1 and 2 50. The instrument used in this invention is an AB SCIEX 6500+, and the data processing software is SCIEXOS software (version 1.7).

[0033] The results are as follows Figure 1 As shown, Figure 1 The image shows the LC-MS detection results of this invention, with the horizontal axis representing time and the vertical axis representing relative intensity. The results indicate that after prokaryotic expression of LjNMT37, LjNMT37 in the crude enzyme reaction system can catalyze the formation of stachydrine (Sta) from N-methylproline, while no corresponding product is generated in the crude enzyme system expressed by the empty vector (EV). Example 3 This embodiment verifies the dual-function nature of the Leonurus japonicus LjNMT37 gene in a tobacco system. The specific verification process and results are as follows: The LjNMT37 gene is overexpressed in tobacco.

[0034] First, pCAMBIA1300-LjNMT37 and pCAMBIA1300 (EV) were transferred into Agrobacterium GV3101 and used to infect tobacco. The procedure was as follows: 1) The Agrobacterium was removed from -80℃ and thawed on ice 20 minutes in advance (Agrobacterium takes a long time to thaw). 2) After thawing, 1 µL of plasmid was added to the bacterial culture, placed on ice for 20 minutes, then in liquid nitrogen for 5 minutes, then in a 37℃ water bath for 5 minutes, and then on ice for 5 minutes. 3) 700 µL of YEB medium was added to a clean bench and incubated at 28℃ for 2-3 hours. 4) The culture was centrifuged at 5000 rpm for 2 minutes, and 700 µL of supernatant was removed. The remaining supernatant was resuspended in the bacterial cells, and about 50 µL of the bacterial culture was transferred to the corresponding plate (with rifampin and kanamycin added). The bacterial culture was evenly distributed using a disposable spreader. 5) The plates were incubated in a 28℃ oven for 2 days. 6) Once single colonies have grown on the plate, perform colony PCR verification. Culture several correct single colonies in liquid to obtain the target bacterial solution. 7) Add the bacterial solution obtained in step 6) to 40 mL of YEB medium containing rifampicin and kanamycin (with 0.4 mL of 1 M MES and 4 µL of 0.2 M AS) at a ratio of 1:500. Incubate overnight at 28°C with shaking at 220 rpm. 8) Collect the shaken bacterial solution and centrifuge at 4000 rpm for 20 min. Collect the supernatant and precipitate. 9) Prepare the injection solution as follows: Add 1 mL of 1 M M Mes, 1 mL of 1 M MgCl2, and 75 µL of 0.2 M AS to 100 mL of water. 10) Resuspend the bacterial cells in the injection solution and adjust the OD600 value to approximately 0.8. Incubate the prepared bacterial solution at room temperature for 2 hours. 11) Select tobacco leaves in good growth condition. Use a syringe to inject the bacterial solution into the tobacco leaves from the back, ensuring the entire leaf is filled. After injection, the tobacco needs to be dark-treated for one day. 12) After one day of dark treatment, allow the leaves to grow normally for another day. Then, inject the substrate (100 μM Pro, 100 μM SAM, 100 μM MgCl2) into the infected leaves. Allow the leaves to grow for another day before sampling. The sampling process is as follows: 1) Cut off the plant leaves, quickly wrap them in aluminum foil, and place them in liquid nitrogen. 2) Add two small steel balls to a 2 mL centrifuge tube and mark the tube. Then, crush the leaves by hand (to facilitate sample homogenization and weighing). Weigh approximately 0.1 g of the sample and place it in the centrifuge tube, then quickly place it in liquid nitrogen (the centrifuge tube and weighing spoon should be pre-cooled in liquid nitrogen during the process). 3) Place the grinding module of the high-throughput tissue homogenizer in liquid nitrogen for pre-cooling. Place the weighed sample from step 2) into the grinding module. Set the machine to grind at 60 Hz for 60 s to grind the leaves into powder.4) Add 70% methanol to a centrifuge tube containing the sample powder at a ratio of 0.1 g of fresh plant sample to 1 mL of 70% methanol, then sonicate for 2 h (low-temperature sonication). After sonication, place the tube at 4°C for cold extraction overnight. 5) After cold extraction, centrifuge the sample at 12000 rpm for 15 min at 4°C, collect the supernatant, and filter it through a 0.22 µm filter into a detection vial (0.5 mL-1 mL of liquid does not require an inner liner tube; less than 0.5 mL requires an inner liner tube). The sample is then ready for analysis, and finally, LC-MS analysis is performed.

[0035] LC-MS detection conditions: An ACQUITY UPLC HSS T3 1.8 µm 2.1 x 100 mm Columbus column was used for sample separation at 40 °C, with binary gradient elution using 0.1% formic acid aqueous solution (A) and acetonitrile (B). The elution program was as follows: 1) 0–2 min, 5%–5% B; 2) 2–5.5 min, 5%–40% B; 3) 5.5–6.5 min, 40%–95% B; 4) 6.5–8 min, 95%–95% B; 5) 8–8.1 min, 95%–5% B; 6) 8.1–11 min, 5%–5% B. Flow rate: 0.30 mL / min; column temperature: 40 °C; injection volume: 2 μL. Mass spectrometry conditions: positive ion mode, multiple reaction monitoring (MRM) scan, Declustering Potential 40, Entrance Potential 10, collision gas medium, ion spray voltage 5500 V, gas temperature 500 °C, ion source gases 1 and 2 50. The instrument used in this invention is an AB SCIEX 6500+, and the data processing software is SCIEXOS software (version 1.7).

[0036] The LC-MS detection results in this embodiment are as follows: Figure 2 As shown, the horizontal axis represents time, and the vertical axis represents relative intensity. The first row contains stachydrine standard (200 ng / mL), and EV represents the empty vector (i.e., pCAMBIA1300). This result indicates that overexpression of LjNMT37 protein in the tobacco system with proline (Pro) as a substrate can generate a large amount of stachydrine, meaning that LjNMT37 protein exhibits bifunctionality in the tobacco in vivo system.

[0037] The reaction formula for the formation of stachydrine from proline using LjNMT37 as a substrate is shown below. Figure 3 In the diagram, Proline represents proline, N-Proline represents N-methylproline, and Stachydrine represents stachydrine.

[0038] It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. Unless otherwise specified, the embodiments and features described in these embodiments can be arbitrarily combined with each other.

Claims

1. The application of a Leonurus japonicus N-methyltransferase gene in the synthesis of stachydrine, characterized in that, The N-methyltransferase gene is the LjNMT37 gene, and the enzyme encoded by the LjNMT37 gene catalyzes the following reaction: (a) N-methylproline is generated from proline as a substrate; (b) Stachyine is generated using N-methylproline as a substrate.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the LjNMT37 gene is shown in SEQ ID No. 1, or is a variant sequence of SEQ ID No. 1 that retains catalytic function by adding, deleting, or substituting one or more nucleotides.

3. The application according to claim 1 or 2, characterized in that, The amino acid sequence of the protein encoded by the LjNMT37 gene is shown in SEQ ID No.

2.

4. A primer composition for amplifying the N-methyltransferase gene involved in the application as described in claim 1, characterized in that, The primers used to amplify the LjNMT37 gene include: (a) First primer pair: SEQ ID No. 3 and SEQ ID No. 4; (b) Second primer pair: SEQ ID No. 5 and SEQ ID No.

6.

5. The primer composition according to claim 4, characterized in that, SEQ ID No. 3 and SEQ ID No. 4 contain BamHI and SalI restriction sites; SEQ ID No. 5 and SEQ ID No. 6 contain KpnI and SalI restriction sites.

6. A recombinant vector, characterized in that, The LjNMT37 gene as described in claim 1 is inserted.

7. The recombinant vector according to claim 6, characterized in that, The vector is either the prokaryotic expression vector pET-32a or the eukaryotic expression vector pCAMBIA1300.

8. A method for synthesizing stachydrine, characterized in that, The method includes the following steps: (a) introducing the recombinant vector of claim 6 or 7 into a host cell to express the crude enzyme; (b) generating stachydrine in vitro using N-methylproline as a substrate, catalyzed by the crude enzyme; wherein the total protein concentration of the crude enzyme is 0.5–0.7 μg / μL.

9. A method for synthesizing stachydrine, characterized in that, Including the following steps: (a) Introducing the recombinant vector of claim 6 or 7 into tobacco cells to obtain transgenic tobacco; (b) Feeding the transgenic tobacco with proline to generate stachydrine via in vivo expression of a crude enzyme.

10. A biomaterial, characterized in that, The recombinant vector comprising claim 6 or 7, wherein the biomaterial is any one of the following: A1. Bioengineered bacteria containing the recombinant vector described above; A2. A transgenic tobacco cell line containing the recombinant vector described above.

Images