Nano material for in-vivo transformation of chimeric antigen receptor CD34 + stem cells, preparation method thereof and application thereof in products for treating aortic dissection
By transforming chimeric antigen receptor CD34+ stem cells into nanomaterials in vivo, the time-consuming and side-effect problems of traditional CAR-T cell therapy have been solved, enabling rapid and precise treatment of aortic dissection and enhancing the targeting and repair functions of CD34+ stem cells.
Patent Information
- Application Number
- CN202510596579.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-11-11
AI Technical Summary
Traditional CAR-T cell therapy suffers from problems such as time consumption, high cost, technical difficulty, immune escape, and strong side effects. Moreover, current technologies are not effective in treating vascular diseases such as aortic dissection.
Using nanomaterials that transform chimeric antigen receptor CD34+ stem cells in vivo, CAR-mRNA is encapsulated in liposome nanoparticles and targeted modified to directly transform CD34+ stem cells in vivo, enabling them to express VCAM-1scFv and VEGFA, thereby enhancing their homing and repair functions.
It achieves rapid and precise treatment results, reduces side effects, improves the targeting and repair effect of aortic dissection treatment, and provides a more flexible and cost-effective treatment option.
Smart Images

Figure CN120924609A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of stem cell therapy technology, specifically relating to a nanomaterial for in vivo transformation of chimeric antigen receptor CD34+ stem cells, its preparation method, and its application in products for treating aortic dissection. Background Technology
[0002] CAR-T cell therapy is an innovative immunotherapy method that uses genetic engineering to modify T cells, enabling them to recognize and attack tumor cells. It has already shown significant success in the treatment of certain hematologic malignancies. CAR-T cells activate the killing function of T cells by expressing chimeric antigen receptors (CARs) on their T cells, thereby recognizing specific antigens on the surface of tumor cells and exhibiting powerful anti-tumor capabilities.
[0003] Traditional CAR-T cell therapy faces several challenges: A complex and time-consuming process: Current CAR-T cell therapy requires isolating T cells from the patient, expanding them in vitro, genetically modifying and culturing them, and then reinfusing them into the patient. This process is not only time-consuming and costly, but also presents technical difficulties and heterogeneity issues. Immune escape and side effects: Traditional CAR-T cell therapy also carries the risk of immune escape, with some tumor cells escaping the immune system by losing the CAR target antigen. Simultaneously, CAR-T cell therapy may trigger a strong immune response, producing side effects such as cytokine release syndrome (CRS). Cell function decline: During in vitro expansion, T cells may lose their function, affecting treatment efficacy, especially with long-term use. Therefore, while in vitro engineered CAR-T therapy is effective, its application still faces some bottlenecks, urgently requiring more efficient, precise, and flexible new technologies.
[0004] To address the limitations of traditional CAR-T therapy, in vivo CAR conversion technology has emerged. In vivo CAR conversion is an emerging gene therapy strategy that aims to transform cells directly into CAR cells with specific functions within the body. This technology delivers CAR genes or mRNA directly in vivo, bypassing complex in vitro expansion and culture steps, greatly simplifying the treatment process while preserving the original characteristics of the cells and reducing cell functional decline. Its advantages include: 1. No in vitro expansion or culture is required, avoiding the cumbersome cell separation, expansion, and reinfusion processes of traditional CAR-T therapy, thus shortening treatment time. 2. By designing specific delivery vectors (such as liposomes, viral vectors, etc.), targeted conversion of specific cell populations (such as T cells, stem cells, etc.) can be achieved, reducing off-target effects and improving treatment accuracy. 3. By adjusting the delivery amount of the vector and the intensity of cell conversion, the number and activity of CAR cells in vivo can be precisely controlled, thereby reducing side effects (such as CRS) in traditional CAR-T therapy. 4. Through nanotechnology and efficient gene delivery systems, CAR genes or mRNA can rapidly enter target cells, achieving ideal conversion effects. Meanwhile, the application of nanocarriers can improve drug bioavailability and reduce drug toxicity and side effects. This technology overcomes the limitations of traditional CAR cell therapy, which relies on in vitro engineering processes, and provides a faster, more flexible, and lower-cost treatment option.
[0005] In 2022, a study on in vivo CAR-T cell-targeted therapy for myocardial fibrosis was featured on the cover of Science. This study used liposomal nanoparticles (LNPs) as carriers to load CAR plasmid mRNA, targeting circulating T cells. By transforming T cells in vivo through CAR-T conversion, the study enabled them to target myocardial fibrosis damage. Another study utilized in vivo injection of macrophage-targeting nanomicelles (encapsulating CAR plasmids) to program macrophages, generating CAR-M1 macrophages with guided phagocytosis and anti-tumor activity. This in vivo CAR cell conversion method allows for a degree of controllability by adjusting the dosage of nanoparticles to control the number of converted cells. Simultaneously, the nano-drug delivery system itself has the functions of sustained drug release, reduced drug toxicity, and improved bioavailability, significantly reducing the possibility of cytokine release syndrome.
[0006] Aortic dissection (AD) is a critical disease characterized by high morbidity and mortality. Advances in endovascular instruments and surgical techniques have improved treatment outcomes and brought various benefits to patients. However, due to comorbidities, advanced age, and other factors, some patients are considered unsuitable for surgical treatment. Furthermore, for certain early intimal injuries (such as intramural hematomas and localized intimal tears), endovascular or surgical intervention may not be appropriate. Therefore, it is essential to develop drugs that can effectively repair early injuries, inhibit TAAD dilation, and prevent its rupture.
[0007] Studies have shown that aortic endothelial cells (ECs) play a crucial role in the development and progression of aortic dilatation disease and may be a potential therapeutic target. Repairing the endothelial barrier early in AD may be key to preventing further damage to aortic mediators. Circulating CD34+ progenitor cells (PCs) have been shown to be mobilized from the bone marrow and play a repair and angiogenesis role in cardiovascular disease. They can directly differentiate into endothelial cells (ECs) and release bioactive molecules, such as exosomes and PPAR agonists, to enhance EC activity. Studies have found that injection of CD34+ PCs improves EC growth on vascular grafts. To address these challenges, current research has explored methods for recruiting CD34+ cells at lesion sites, such as using custom scaffolds designed to enhance CD34+ cell survival in wounds. Our focus is on increasing the quantity and function of CD34+ cells in the lesion site and guiding them to homing (targeting) to the injury site. Chimeric antigen receptor T cells (CAR-T) and macrophages (CAR-M) have been widely used in targeted cancer therapy and have shown significant efficacy. Studies have shown that genetically engineered CAR hematopoietic stem cells (CAR-HPSCs) can be used to generate allogeneic iNKT (AlloHSC-iNKT) hematopoietic stem cell technology, which effectively targets tumor cells. These findings suggest that using CAR-based technologies in stem cell therapy may be feasible and holds great promise for the future. Summary of the Invention
[0008] This invention is made to solve the above-mentioned problems, and aims to provide a nanomaterial for in vivo transformation of chimeric antigen receptor CD34+ stem cells, its preparation method, and its application in products for treating aortic dissection.
[0009] This invention provides a method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells, characterized by the following steps: Step a1, constructing and transcribed amplifying CAR-mRNA expressing VCAM-1scFv and VEGFA; Step a2, encapsulating the CAR-mRNA with liposome nanoparticles (LNPs) to obtain LNPs encapsulated with CAR-mRNA, and then targeting and modifying the LNPs encapsulated with CAR-mRNA to obtain CD34 antibody-modified LNPs encapsulated with CAR-mRNA.
[0010] The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells provided by the present invention may also have the following features: in step a1, the CAR structure is composed of scFv targeting VCAM-1, CD28 hinge region, CD28 transmembrane region and VEGFA activation domain, and the CAR gene is cloned into pmRVac vector plasmid, which carries luciferase Luc gene and contains T7 promoter, 5'UTR, 3'UTR and poly-A tail.
[0011] The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells provided by the present invention may also have the following features: wherein, in step a1, the nucleotide sequence of scFv targeting VCAM-1 is as shown in SEQ ID No: 1, and the gene base sequence of VEGFA is as shown in SEQ ID No: 2.
[0012] The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells provided by this invention may also have the following characteristics: In step a2, the lipid components of LNP include DLin-MC3-DMA, DSPC, cholesterol, and DSPE-PEG2000 in a molar ratio of 50:10:38.5:1.5. LNP encapsulation is performed using an Ignite Nanoassemblr device, and the mixture is carried out under the following conditions according to the ratio of aqueous phase: organic phase = 4:1: aqueous phase: 50mM sodium citrate buffer (pH = 4) containing CAR-mRNA; organic phase: ethanol solution containing LNP; the flow rate during encapsulation is set to 6mL / min.
[0013] The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells provided by this invention may also have the following features: In step a2, the targeted modification process is as follows: 1) Concentrate the prepared CD34 monoclonal antibody to 1-10 mg / mL; 2) Mix the CD34 monoclonal antibody with LNPs encapsulated with CAR-mRNA at a molar ratio of 1:1; 3) Prepare 2 mL of PBS buffer with pH 7.4 to ensure the stability and good binding of the antibody; 4) Incubate the mixture at 25°C for 2 hours at room temperature to promote antibody insertion; 5) After incubation, purify the sample using size exclusion chromatography, collect the fraction containing antibody-modified LNPs, and concentrate it to obtain CD34 antibody-modified LNPs encapsulated with CAR-mRNA.
[0014] The present invention also provides a nanomaterial for in vivo transformation of chimeric antigen receptor CD34+ stem cells, characterized in that it is prepared by the above-mentioned method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells.
[0015] This invention also provides the application of the above-mentioned nanomaterials, which are transformed into chimeric antigen receptor CD34+ stem cells in vivo, in products for the treatment of aortic dissection.
[0016] In the application of the nanomaterials of in vivo transformation of chimeric antigen receptor CD34+ stem cells provided by this invention in products for treating aortic dissection, the following features are also included: Step b1, obtaining CD34+ stem cells and simulating the vascular endothelial cell microenvironment; Step b2, safety assessment of LNP transfection with CD34 antibody-modified CAR-mRNA; Step b3, uptake detection and in vivo lysozyme escape detection of CD34+ stem cells transfected with CD34 antibody-modified CAR-mRNA; Step b4, in vitro transfection of CD34+ stem cells with CD34 antibody-modified CAR-mRNA. mRNA expression analysis; Step b5, validation of CD34+ stem cell function of LNP modified with CD34 antibody encapsulating CAR-mRNA; Step b6, construction of animal model of aortic dissection; Step b7, in vivo transformation assessment of CAR-CD34+ stem cells; Step b8, efficacy assessment by histological staining; Step b9, in vivo bioavailability analysis of LNP modified with CD34 antibody encapsulating CAR-mRNA; Step b10, in vivo circulating safety assessment of LNP modified with CD34 antibody encapsulating CAR-mRNA.
[0017] In the application of the nanomaterials of in vivo transformed chimeric antigen receptor CD34+ stem cells provided by this invention in products for treating aortic dissection, the following features may also be included: In step b1, CD34+ stem cells are obtained from the femoral bone marrow of C57BL / 6J mice and purified using density gradient centrifugation and magnetic bead separation; in step b3, uptake detection is performed by confocal fluorescence microscopy and flow cytometry; in step b4, expression analysis includes: flow cytometry detection of scFv expression and stability, qPCR detection of VEGFA mRNA transcription, and Western blotting. In step b5, the function verification of CD34+ stem cells by LNP modified with CD34 antibody encapsulating CAR-mRNA included: cell proliferation, migration, adhesion, and tubule formation. In step b6, the construction of the aortic dissection animal model included the following steps: 3-week-old male C57BL / 6J mice were fed BAPN for 21 consecutive days to establish the TAAD model. Three specific detection time points were determined. Half of the aortic specimens from animals that died during the TAAD model induction process and from animals dissected at the experimental endpoint were stored at -80°C and the other half were stored in 4% paraformaldehyde. In step b7, the in vivo transformation assessment was performed by flow cytometry on peripheral blood from mice. In step b9, the in vivo bioavailability analysis was performed by assessing luciferase expression in mouse tissues 24 and 48 hours after treatment using a stable luciferase assay.
[0018] In the application of the nanomaterials of in vivo transformed chimeric antigen receptor CD34+ stem cells provided by the present invention in products for treating aortic dissection, the product for treating aortic dissection may also have the following characteristics: wherein the product for treating aortic dissection is a drug for treating cardiovascular endothelial injury.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] This invention successfully constructed nanoparticles that transform chimeric antigen receptor CD34+ cells in vivo. These nanoparticles express CAR-modified CD34+ PCs containing vascular endothelial growth factor A (VEGFA) and scFv targeting vascular cell adhesion molecule-1 (VCAM-1) to enhance homing and repair functions. This invention experimentally verified the targeting and repair effects of CAR CD34+ stem cell in vivo transformation on an aortic dissection disease model, providing a new approach for targeted therapy of aortic dissection. Attached Figure Description
[0021] Figure 1 This is a schematic diagram of the CAR mRNA structure and plasmid construction in an embodiment of the present invention;
[0022] Figure 2 This is a schematic diagram representing the LNP in an embodiment of the present invention;
[0023] Figure 3 This is a flowchart illustrating the extraction process of CD34+ stem cells in an embodiment of the present invention;
[0024] Figure 4 This is a phenotypic identification diagram of CD34+ stem cells in an embodiment of the present invention;
[0025] Figure 5 This is a cell viability analysis diagram of each group processed in the embodiments of the present invention;
[0026] Figure 6 This is an uptake map of LNPs between groups in an embodiment of the present invention;
[0027] Figure 7 This is a diagram showing the in vivo escape analysis of LNP lysozyme in an embodiment of the present invention;
[0028] Figure 8 This is a diagram of the positive control CAR plasmid and virus construction in an embodiment of the present invention;
[0029] Figure 9 This is a graph showing the expression and stability analysis of CAR-scFv among the groups in this embodiment of the invention;
[0030] Figure 10 This is a VEGFA expression level analysis diagram in an embodiment of the present invention;
[0031] Figure 11 These are EDU proliferation analysis diagrams of cells in each group in this embodiment of the invention;
[0032] Figure 12 This is an analysis diagram of changes in cell function in each group in the embodiments of the present invention;
[0033] Figure 13 This is a diagram illustrating the construction and reliability analysis of the aortic dissection model in an embodiment of the present invention.
[0034] Figure 14 This is a diagram illustrating the in vivo expression of LNP for CAR and the interstitial targeting ability in an embodiment of the present invention.
[0035] Figure 15 This is an evaluation diagram of the inter-group treatment effect of the incision in each embodiment of the present invention;
[0036] Figure 16 These are histopathological analysis diagrams of each group in the embodiments of the present invention;
[0037] Figure 17 This is a graph showing the in vivo bioavailability analysis of LNP in an embodiment of the present invention;
[0038] Figure 18This is an in vivo circulation safety assessment of LNP in this embodiment of the invention. Detailed Implementation
[0039] To make the technical means, creative features, objectives and effects of this invention easier to understand, the following embodiments, in conjunction with the accompanying drawings, specifically illustrate the nanomaterials of in vivo transformation of chimeric antigen receptor CD34+ stem cells, their preparation methods, and their application in products for treating aortic dissection.
[0040] Example
[0041] This embodiment provides a nanomaterial for in vivo transformation of chimeric antigen receptor CD34+ stem cells, its preparation method, and its application in products for treating aortic dissection. Details are as follows:
[0042] 1. Preparation of nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells
[0043] 1.1 Construction and transcriptional amplification of CAR-mRNA expressing VCAM-1scFv and VEGFA
[0044] The construct consists of a first-generation anti-VCAM-1 CAR construct and a mouse VEGFA linked by a cleavable 2A peptide sequence, forming a CAR mRNA structure as follows: Figure 1 As shown in Figure a.
[0045] The CAR structure consists of the scFv targeting VCAM-1, the CD28 hinge region, the CD28 transmembrane region, and the VEGFA activation domain.
[0046] Among them, the nucleotide sequence of the scFv targeting VCAM-1 (as shown in SEQ ID No: 1) is as follows: CAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATTAATCCTTACAATGATGGACTAAGTACAATGAGAAGTTCAAAGGCAAGGCCACACTGACTTCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTACTGTGCAAGATCCTATAGGTACGGTCGATATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGTTCTGGCGGTGGCGGATCGGACATTGTGCTGACCCAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATGCAGGGCCAGCCAAAGTGTCAGTACATCTAGCTATAGTTATATGCACTGGTACCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCAAGTATGCATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATACTGCAACATATTACTGTCAGCACAGTTGGGAGATTCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAACGG,
[0047] The gene base sequence of VEGFA (as shown in SEQ ID No: 2) is as follows:
[0048] GAGCCGCGAGGAACCGAAGCCCGCGCCCGGAGGCGGGGTGGAGGGGGTCGGGGCTCGCGGGATTGCACGGAAACT
[0049] TTTCGTCCAACTTCTGGGCTCTTCTCGCTCCGTAGTAGCCGTGGTCTGCGCCGCAGGAGACAAACCGATCGGAGC
[0050] TGGGAGAAGTGCTAGCTCGGGCCTGGAGAAGCCGGGGCCCGAGAAGAGAGGGGAGGAAGAGAAGGAAGAGGAGAG
[0051] GGGGCCGCAGTGGGCGCTCGGCTCTCAGGAGCCGAGCTCATGGACGGGTGAGGCGGCCGTGTGCGCAGACAGTGC
[0052] TCCAGCCGCGCGCGCGCCCCAGGCCCCGGCCCGGGCCTCGGTTCCAGAAGGGAGAGGAGCCCGCCAAGGCGCGCA
[0053] AGAGAGCGGGCTGCCTCGCAGTCCGAGCCGGAGAGGGAGCGCGAGCCGCGCCGGCCCCGGACGGGCCTCCGAAAC
[0054] CATGAACTTTCTGCTCTCTTGGGTGCACTGGACCCTGGCTTTACTGCTGTACCTCCACCATGCCAAGTGGTCCCA
[0055] GGCTGCACCCACGACAGAAGGAGAGCAGAAGTCCCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTA
[0056] CTGCCGTCCGATTGAGACCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTTCAAGCCGTC
[0057] CTGTGTGCCGCTGATGCGCTGTGCAGGCTGCTGTAACGATGAAGCCCTGGAGTGCGTGCCCACGTCAGAGAGCAA
[0058] CATCACCATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAG
[0059] CAGATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAATCACTGTGAGCCTTGTTCAGAGCGGAGAAA
[0060] GCATTTGTTTGTCCAAGATCCGCAGACGTGTAAATGTTCCTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGATGTGACAAGCCAAGGCGG.
[0061] The CAR gene was cloned into the pmRVac vector plasmid, which carries the luciferase (Luc) gene and contains a T7 promoter, 5'UTR, 3'UTR, and a poly-A tail. The CAR mRNA plasmid structure is shown below. Figure 1 As shown in b.
[0062] The linearized plasmid mRNA was synthesized using the MEGAScript T7 kit. The transcription system was prepared as follows:
[0063] 1) Linearized DNA template: 1-2 μg;
[0064] 2) Reverse transcription buffer: 1x;
[0065] 3) MgCl2: 2mM;
[0066] 4) NTPs: 1 mM (except for UTPs, other NTPs are at standard concentrations);
[0067] 5) m1Ψ-5'-triphosphate: Used to replace UTP, final concentration 1mM;
[0068] 6) CleanCap: Final concentration 50 μM;
[0069] 7) T7 RNA polymerase: appropriate amount
[0070] 8) ddH2O: appropriate amount;
[0071] 9) MEGAScript T7 Reverse Transcription Kit: Use according to standard operating procedures;
[0072] 10) UTP replacement: Use m1Ψ-5'-triphosphate (TriLink, N-1081) to replace UTP in order to improve mRNA stability and reduce immunogenicity;
[0073] 11) CleanCap (TriLink, N-7113): 5' cap modification via CleanCap enhances mRNA stability and translation efficiency.
[0074] The reaction was carried out under the following conditions: temperature: 37℃; time: 4-6 hours; RNA purification was performed using the Megaclear kit. The quality of the transcripts was assessed by denaturing agarose gel electrophoresis (1% gel, 100V); RNA concentration was detected by NanoDrop or Qubit; purified mRNA should be stored at -80℃ for later use.
[0075] 1.2 Construction and Targeting Modification of LNPs Encapsulated with CAR-mRNA
[0076] 1.2.1 CAR-mRNA was encapsulated with liposome nanoparticles (LNPs) to obtain LNPs encapsulated with CAR-mRNA.
[0077] The lipid component of LNP consists of DLin-MC3-DMA, DSPC, cholesterol and DSPE-PEG2000 in a molar ratio of 50:10:38.5:1.5.
[0078] LNPs were assembled using an Ignite Nanoassemblr (Precision NanoSystems Inc., Vancouver, Canada). Synthesis was performed at a 4:1 ratio (aqueous phase:organic phase). The aqueous phase:organic phase was mixed under the following conditions at a 4:1 ratio:
[0079] Aqueous phase: 50mM sodium citrate buffer containing CAR-mRNA (pH=4);
[0080] Organic phase: ethanol solution containing LNP;
[0081] The flow rate was set to 6 mL / min during the encapsulation process.
[0082] 1.2.2 The LNPs encapsulated with CAR-mRNA were targeted and modified to obtain CD34 antibody-modified LNPs encapsulated with CAR-mRNA.
[0083] The process of targeted modification is as follows:
[0084] 1) Concentrate the prepared CD34 monoclonal antibody to 1-10 mg / mL;
[0085] 2) The CD34 monoclonal antibody was mixed with LNPs encapsulated with CAR-mRNA at a 1:1 molar ratio;
[0086] 3) To ensure antibody stability and good binding, prepare 2 mL of PBS buffer with a pH of 7.4;
[0087] 4) Incubate the mixture at 25°C for 2 hours at room temperature to promote antibody insertion;
[0088] 5) After incubation, purify the sample using size exclusion chromatography (e.g., a Sepharose CL-4B column) to separate unbound antibodies and modified LNPs. Collect the fraction containing antibody-modified LNPs and concentrate it.
[0089] 6) The particle size, dispersibility, and zeta potential of the purified LNP were measured using dynamic light scattering (DLS) technology;
[0090] 7) After aliquoting the purified CD34 antibody-modified LNP (i.e., CD34 antibody-modified LNP encapsulating CAR-mRNA, denoted as CD34 / LNP-CAR mRNA), store it at -80℃ to maintain stability.
[0091] Electron micrographs of CD34 antibody-modified LNP (CD34 / LNP-CAR mRNA) encapsulating CAR-mRNA are shown below. Figure 2 As shown in Figure A, the particle size is as follows: Figure 2 As shown in B characterization, the Zeta potential is as follows: Figure 2 As shown in C, the particle stability is as follows: Figure 2 As shown in D.
[0092] 2. In vitro experimental validation and efficacy analysis of LNP
[0093] 2.1 Acquisition of CD34+ stem cells and simulation of the vascular endothelial cell microenvironment
[0094] CD34+ stem cells were obtained from the femoral bone marrow of C57BL / 6J mice and purified using density gradient centrifugation and magnetic bead separation. MACS CD34 MicroBeads were used as the magnetic beads, and the procedures were performed according to the kit instructions. The specific process is as follows: Figure 3 As shown in the figure. The obtained CD34+ stem cells were co-cultured with 10 ng / mL VEGF to simulate the in vivo vascular environment. CD34+ stem cell surface markers were specifically labeled using CD34 antibody, and CD34+ stem cell fluorescent staining was performed as shown in the figure. Figure 4 As shown in Figure a, the results of flow cytometry detection of CD34 are as follows: Figure 4 As shown in b.
[0095] 2.2 Safety assessment of LNP transfection
[0096] CD34+ stem cells were used at a rate of 1×10 4Cells were seeded at a density of 100 cells / well in 96-well plates and cultured overnight. Group settings: 1) Control group: PBS solution (no treatment); 2) LNP group: LNPs without mRNA encapsulation; 3) CD34 / LNP group: CD34 antibody-modified LNPs without mRNA encapsulation; 4) LNP-CAR mRNA group: LNPs encapsulated with CAR-mRNA; 5) CD34 / LNP-CAR mRNA group: CD34 antibody-modified LNPs encapsulated with CAR-mRNA. The CD34 / LNP-CAR mRNA dosage ranged from 0.1 μg / mL to 0.8 μg / mL, and an appropriate amount of treatment solution was added. After 6 hours, the culture medium in each well was gently aspirated, and 200 μL of fresh complete culture medium (containing 10% FBS) was added. Cells were cultured for another 18 hours, and the cell viability was detected using a CCK-8 assay kit. The cell viability results for each group after treatment are shown below. Figure 5 As shown.
[0097] 2.3 Detection of uptake and lysosomal escape of LNP-transfected CD34+ stem cells
[0098] LNP uptake was detected using confocal fluorescence microscopy and analyzed by flow cytometry. Cy5 was used to label mRNA; DIO (green) was used to label the cell membrane, and DAPI (blue) was used.
[0099] Confocal microscopy identification involved the following steps: 1. Seed CD34+ cells in 24-well plates and incubated overnight; 2. Grouping and treatment: 1) PBS group; 2) Free mRNA (Fr-mRNA) group; 3) LNP-encapsulated mRNA containing the CAR gene (LNP-CARmRNA) group; 4) CD34 antibody-modified LNP-encapsulated CAR-mRNA (CD34 / LNP-CAR mRNA) group; cultured at 37°C and 5% CO2 for 4 hours.
[0100] Further fluorescence imaging analysis of the cells was performed using laser scanning confocal microscopy (CLSM) to qualitatively assess cellular uptake. Figure 6 As shown in Figure A. After co-culture, the cells were centrifuged to prepare a cell suspension, and flow cytometry was used for quantitative analysis to evaluate the mRNA uptake effect of different treatment groups. The results are shown below. Figure 6 As shown in B.
[0101] In the lysosome escape assay, LNP-CAR mRNA was labeled with Cy5 and CD34+ stem cells were treated and incubated for 1 hour, 3 hours and 6 hours to assess cell uptake dynamics at different time points. After incubation, Hochest 33342 (for staining cell nuclei) and LysoTracker Green (for labeling lysosomes) were added, with a final concentration of 5 μg / mL for Hochest 33342 and a final concentration of 50 nM for LysoTracker Green. The cells were incubated at 37°C for another 30 minutes, and then fixed with 4% paraformaldehyde for 15 minutes.
[0102] Cell imaging analysis was performed using a laser scanning confocal microscope (CLSM, Nikon, Tokyo, Japan). Analysis software: ImageJ; calculation method: Manders Coefficient. Fluorescence results are shown below. Figure 7 A. Analytical Methods: Manders colocalization coefficient was used to assess the degree of colocalization between LNP-CAR mRNA and lysosomes within the cell. Results are as follows: Figure 7 B.
[0103] 2.4 Analysis of CAR mRNA expression in CD34+ stem cells transfected with LNP in vitro
[0104] Analysis of CAR mRNA expression in CD34+ stem cells transfected with LNP in vitro included: flow cytometry to detect scFv expression and stability, qPCR to detect VEGFA mRNA transcription, and Western blot to detect VEGFA protein expression.
[0105] As a positive control, a viral transfection CAR was constructed. The plasmid and viral structure are as follows: Figure 8 As shown.
[0106] 2.4.1 Flow cytometry analysis of scFv expression stability
[0107] Groups: a) PBS: negative control group; b) LV-IgG-CAR: lentiviral vector overexpressing IgG-scFv-CAR plasmid, used to assess non-specific CAR expression; c) LV-VCAM-1-CAR: lentiviral vector overexpressing anti-VCAM-1-scFv-CAR plasmid, used to assess specific CAR (anti-VCAM-1) expression; d) 0.1 μg / mL CD34 / LNP: CD34 antibody-modified LNP, used to assess mRNA delivery efficiency; e) 0.1 μg / mL CD34 / LNP-CAR mRNA: CD34 antibody-modified LNP encapsulating CAR-mRNA, used to assess CAR gene transfection efficiency. Recombinant mouse VCAM-1 (C-Fc) antibody (FITC-labeled) was used to label transfected cells. VCAM-1 scFv expression differences were detected within one day post-transfection. Furthermore, the expression stability of LNP modified with CD34 antibody encapsulating CAR-mRNA (CD34 / LNP-CAR mRNA) was investigated from day 1 to 4. Flow cytometry results are shown below. Figure 9 As shown.
[0108] 2.4.2 qPCR detection of VEGFA mRNA levels
[0109] RNA was extracted from cells using the TRIzol method, and the RNA was reverse transcribed into cDNA using a reverse transcription kit. Specific primers were designed based on the target gene VEGFA sequence, and GAPDH was selected as the internal control gene. The Ct value of the target gene VEGFA was corrected using the Ct value of the internal control gene, and the ΔCt value was calculated to compare the differences between different experimental groups.
[0110] 2.4.3 Western blot detection of VEGFA mRNA protein expression
[0111] Cellular proteins were extracted using the BCA method. Antibodies: anti-VEGFA antibody, GAPDH. ImageJ was used for quantitative analysis of band grayscale values. VEGFA expression levels were as follows: Figure 10 As shown.
[0112] Validation of CD34+ stem cell function using 2.5LNP
[0113] LNP validation of CD34+ stem cell function includes: cell proliferation capacity detection, migration capacity detection, adhesion capacity detection, and tubule formation capacity detection.
[0114] 2.5.1 Cell proliferation capacity detection
[0115] Cell proliferation after LNP treatment was detected using the edu method. The study groups were: a) PBS; b) 0.2 mg / ml CD34 / LNP; c) 0.2 mg / ml LV-CAR mRNA; d) 0.2 mg / ml CD34 / LNP-CAR mRNA. Cells were cultured in 6-well plates, with 50 nM EdU working solution added to each well, and cultured for 1.5 hours. Cells were fluorescently labeled using Alexa Fluor 647, and cell nuclei were labeled using Hochest. Cells were observed under a fluorescence microscope, and the proportion of EdU-positive cells was calculated using ImageJ (proliferation rate = number of EdU-positive cells / total number of cells × 100%). The experimental results for each group are shown below. Figure 11 As shown.
[0116] 2.5.2 Migration Ability Detection
[0117] Migration ability was assessed using a wound healing assay and Transwell assay. In the wound healing assay, a wound model was created using a p20 pipette tip, and the wound healing area or width was measured using ImageJ under an optical microscope to calculate the number of migrating cells. In the Transwell assay, the cell density was 2 × 10⁻⁶ cells / year. 4 Cells / 100 μL; using Transwell chambers with an 8 μm pore size; after incubation, cells were fixed and stained with 0.1% crystal violet solution for 10 minutes. The cells were then observed and images of migrating cells on the submembrane surface were captured under a light microscope. The number of migrating cells was counted in five random fields of view. The migration ability test results are as follows: Figure 12 As shown in A and 12B.
[0118] 2.5.3 Adhesion ability test
[0119] Adhesion ability was assessed using a fibronectin solution (working concentration of 10 μg / mL), stained with 0.3% crystal violet solution. Cell images were taken in five randomly selected fields of view under an optical microscope, and the number of attached cells was counted. The adhesion ability results are as follows: Figure 12 As shown in C and 12D.
[0120] 2.5.4 Tube Formation Ability Test
[0121] Tube formation assay: Matrigel was plated in 96-well plates, with 2 × 10⁴ tubes / well added to the top of the plate and incubated for 12 hours. Images were taken from five randomly selected fields of view under a light microscope to record the formation of tubular structures (e.g., branching, annular structures). Tube formation capacity test results are as follows: Figure 12 As shown in E and 12F.
[0122] 3. Application of LNP in the treatment of aortic dissection
[0123] 3.1 Construction of an animal model of aortic dissection
[0124] The steps for constructing an animal model of aortic dissection are as follows:
[0125] Three-week-old male C57BL / 6J mice were fed β-aminopropionitrile (BAPN) at a dose of 1 g / kg / day for 21 consecutive days to establish a TAAD model. Three specific time points were determined (days 7, 14, and 21). Half of the aortic specimens from animals that died during TAAD model induction and from animals dissected at the experimental endpoint were stored at -80°C, and the other half were stored in 4% paraformaldehyde. The animal model establishment procedure is as follows: Figure 13 As shown in A, Figure 13 B shows representative ultrasound images of the interstitial space at different time points. Figure 13 C is a representative pathological image of the aorta. Figure 13 D shows representative intimal electron micrographs of blood vessels at different time points.
[0126] The groups were divided into the following treatment groups, with different drugs administered via tail vein injection at doses of 10 μg. Groups: Control, CD34 / LNP, CD34 / LNP-VEGFAmRNA, and CD34 / LNP-CAR mRNA groups.
[0127] 3.2 In vivo transformation assessment of CAR-CD34+ stem cells
[0128] In vivo transformation of CAR-CD34+ cells was assessed by flow cytometry using peripheral blood from mice. Antibodies used included recombinant mouse VCAM-1 (C-Fc), anti-CD31-FITC, anti-VE-CAD-PE, and anti-6XHis tag. Groups were defined as Control, CD34 / LNP, CAR-mRNA, and CD34 / LNP-CAR mRNA groups. Flow cytometry results are shown below. Figure 14 As shown in Figure A.
[0129] 3.3 Localization of LNP in animal circulation and injury sites
[0130] The localization of LNPs in the animal circulation and at sites of injury was analyzed using immunofluorescence staining. The mRNA of the nanoparticles was labeled with Cy5, and the vascular intima was labeled with CD31. Confocal microscopy was used for imaging and analysis. The immunofluorescence staining results are as follows: Figure 14 As shown in Figure B, nanoparticles with CD34 targeting modification were successfully taken up by endothelial cells.
[0131] To investigate the repair effects among the groups, CD34 / LNP-VEGFA mRNA was used as a positive control group for the repair effect, and 10 μg of different therapeutic drugs were injected via tail vein. Groups included: Control / saline, CD34 / LNP, CD34 / LNP-VEGFA mRNA, and CD34 / LNP-CAR mRNA groups. Administration was performed every two days. Figure 15 The treatment process is shown in A, with weight measured every 3 days. The weight change curve is as follows: Figure 15 As shown in B, the mortality rates of mice in each group are as follows: Figure 15 As shown in Figure C, ultrasound assessment of aortic dilation among groups is presented, with structures as follows: Figure 15 As shown in Figure D-15E, Figure 15F illustrates the incidence of infiltration between groups. Figure 15 G shows the gross anatomical specimens of the aorta in each group.
[0132] 3.4 Histological staining for efficacy assessment
[0133] The specific process for histological staining to assess treatment efficacy is as follows:
[0134] C57BL / 6J mouse aortic tissue was fixed in 4% paraformaldehyde for 24 hours after treatment with different groups (Control / saline, CD34 / LNP, CD34 / LNP-VEGF AmRNA, and CD34 / LNP-CAR mRNA groups). Paraffin sections (4 μm) were prepared. Morphological staining was performed with hematoxylin and eosin, Masson staining was used to analyze collagen, and EVG staining was used to analyze elastic fiber expression levels. Blind evaluation of the stained sections was conducted: 1 point for degradation levels below 25%, 2 points for degradation levels between 25% and 50%, 3 points for degradation levels between 50% and 75%, and 4 points for degradation levels exceeding 75%.
[0135] Histopathological staining results as follows Figure 16 As shown in A-16B. EVANs staining was used to assess the level of vascular reendothelialization, and the results are as follows. Figure 16 As shown in C-16D. Electron microscopy was used to observe the integrity of the intima between groups, and the results are as follows. Figure 16 As shown in E.
[0136] The endometrial repair status was assessed using immunofluorescence staining analysis. Primary antibodies used were VCAM-1, CD34, and CD31, and nuclear staining solution DAPI was employed. Fluorescence microscopy was used for observation, and ImageProPlus 3.0 was used to evaluate the results. Results are as follows... Figure 16 As shown in F-16H.
[0137] 3.5 LNP bioavailability analysis
[0138] LNP bioavailability analysis was performed using a stable luciferase assay (Promega) to assess luciferase expression in mouse tissues at 24 and 48 hours after treatment in different groups (Control / saline, CD34 / LNP, CD34 / LNP-VEGFAmRNA, and CD34 / LNP-CAR mRNA groups). Mouse tissues were weighed and homogenized three times in 500 mL of GLO lysis buffer using a FastPrep homogenizer (ThermoScientific) at speed set to "6". After dilution of the homogenized samples in GLO lysis buffer, readings were taken using a new white plate reader (Bio-Rad, Shanghai, China). Results are shown below. Figure 17 As shown.
[0139] 3.6 Safety assessment of LNP in vivo circulation
[0140] The safety of LNP in vivo circulation was assessed by collecting samples from major organs of mice, including heart, kidney, lung, liver, brain, and spleen, 24 hours after treatment with different groups (Control / saline, CD34 / LNP, CD34 / LNP-VEGF mRNA, and CD34 / LNP-CAR mRNA). HE staining was used for evaluation. Simultaneously, blood samples were collected via the retroorbital route. A Pointcare M4 biochemical analyzer was used to analyze serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), blood urea nitrogen (BUN), hemoglobin, and red blood cell (RBC) counts. Results are as follows: Figure 18 As shown.
[0141] Those skilled in the art should understand that this invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to this invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells, characterized in that, Includes the following steps: Step a1: Construction and transcriptional amplification of CAR-mRNA expressing VCAM-1scFv and VEGFA; Step a2: CAR-mRNA is encapsulated with liposome nanoparticles (LNPs) to obtain LNPs encapsulated with CAR-mRNA. The LNPs encapsulated with CAR-mRNA are then targeted and modified to obtain CD34 antibody-modified LNPs encapsulating CAR-mRNA.
2. The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells according to claim 1, characterized in that: in, In step a1, the CAR structure consists of the scFv targeting VCAM-1, the CD28 hinge region, the CD28 transmembrane region, and the VEGFA activation domain. The CAR gene was cloned into the pmRVac vector plasmid, which carries the luciferase Luc gene and contains a T7 promoter, 5'UTR, 3'UTR, and a poly-A tail.
3. The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells according to claim 2, characterized in that: in, In step a1, the nucleotide sequence of the scFv targeting VCAM-1 is shown in SEQ ID No:
1. The gene base sequence of VEGFA is shown in SEQ ID No:
2.
4. The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells according to claim 1, characterized in that: in, In step a2, the lipid components of the LNP include DLin-MC3-DMA, DSPC, cholesterol, and DSPE-PEG2000, with a molar ratio of 50:10:38.5:1.
5. LNP packaging was performed using an Ignite Nanoassemblr device, with the aqueous phase:organic phase mixed at a ratio of 4:1 under the following conditions: Aqueous phase: 50mM sodium citrate buffer containing CAR-mRNA (pH=4); Organic phase: An ethanol solution containing the LNP; The flow rate was set to 6 mL / min during the encapsulation process.
5. The method for preparing nanomaterials for in vivo transformation of chimeric antigen receptor CD34+ stem cells according to claim 1, Its features are: In step a2, the targeted modification process is as follows: 1) Concentrate the prepared CD34 monoclonal antibody to 1-10 mg / mL; 2) Mix the CD34 monoclonal antibody with LNP encapsulated with CAR-mRNA at a 1:1 molar ratio; 3) To ensure the stability and good binding of the antibody, prepare 2 mL of PBS buffer with pH 7.
4. 4) Incubate the mixture at 25°C for 2 hours at room temperature to promote antibody insertion; 5) After incubation, purify the sample using size exclusion chromatography, collect the fraction containing antibody-modified LNPs, and concentrate to obtain CD34 antibody-modified LNPs encapsulating CAR-mRNA.
6. A nanomaterial for in vivo transformation of chimeric antigen receptor CD34+ stem cells, characterized in that, It was prepared using the method for preparing nanomaterials of in vivo transformed chimeric antigen receptor CD34+ stem cells as described in any one of claims 1-5.
7. Application of nanomaterials derived from in vivo chimeric antigen receptor CD34+ stem cells in products for the treatment of aortic dissection.
8. The application of the nanomaterials of in vivo transformed chimeric antigen receptor CD34+ stem cells according to claim 7 in products for the treatment of aortic dissection. Its features are: in, The applications include: Step b1: Obtaining CD34+ stem cells and simulating the vascular endothelial cell microenvironment; Step b2: Safety assessment of LNP transfection modified with CD34 antibody encapsulating CAR-mRNA; Step b3: CD34 antibody-modified LNP transfected with CAR-mRNA is used for uptake detection and lysosomal escape detection in CD34+ stem cells. Step b4: Analysis of CAR mRNA expression in CD34+ stem cells transfected in vitro with LNP modified with CD34 antibody encapsulating CAR-mRNA; Step b5: Verification of CD34+ stem cell function by modifying LNP with CD34 antibody encapsulating CAR-mRNA; Step b6, Construction of an animal model of aortic dissection; Step b7, in vivo transformation assessment of CAR-CD34+ stem cells; Step b8, histological staining for efficacy assessment; Step b9: In vivo bioavailability analysis of LNP modified with CD34 antibody encapsulating CAR-mRNA; Step b10: In vivo circulation safety assessment of CD34 antibody-modified LNP encapsulated with CAR-mRNA.
9. The application of the nanomaterial of in vivo transformed chimeric antigen receptor CD34+ stem cells according to claim 8 in a product for treating aortic dissection, characterized in that: in, In step b1, the CD34+ stem cells were obtained from the femoral bone marrow of C57BL / 6J mice and purified using density gradient centrifugation and magnetic bead separation. In step b3, the uptake detection was performed by confocal fluorescence microscopy and flow cytometry. In step b4, the expression analysis includes: flow cytometry to detect scFv expression and stability, qPCR to detect VEGFA mRNA transcription, and Western blot to detect VEGFA protein expression. In step b5, the validation of CD34+ stem cell function by LNP modified with CD34 antibody encapsulating CAR-mRNA includes: cell proliferation ability detection, migration ability detection, adhesion ability detection, and tubule formation ability detection. In step b6, the construction of the aortic dissection animal model includes the following steps: 3-week-old male C57BL / 6J mice were fed β-aminopropionitrile (BAPN) for 21 consecutive days to establish the TAAD model. Three specific detection time points were determined. Half of the aortic specimens from animals that died during the TAAD model induction process and from animals dissected at the experimental endpoint were stored at -80°C and the other half were stored in 4% paraformaldehyde. In step b8, in vivo transformation assessment is performed by flow cytometry analysis of peripheral blood from mice. In step b9, in vivo bioavailability analysis was performed by assessing luciferase expression in mouse tissues at 24 and 48 hours post-treatment using a stable luciferase assay.
10. The application of the nanomaterial of in vivo transformation of chimeric antigen receptor CD34+ stem cells according to claim 8 in a product for treating aortic dissection, characterized in that: in, The product mentioned for treating aortic dissection is a drug for treating cardiovascular endothelial injury.