Esophageal squamous cell carcinoma diagnostic kit based on peripheral blood mononuclear cell methylation marker and application

Abstract

The invention belongs to the technical field of gene engineering, and relates to an esophageal squamous cell carcinoma diagnostic kit based on a peripheral blood mononuclear cell methylation marker and application. The kit comprises a primer pair which is used for detecting the methylation of a cg05914150 site, a cg06769875 site, a cg07475126 site, a cg08433285 site, a cg10038907 site, a cg17968322 site, a cg19572487 site, a cg20184330 site, a cg22741248 site and a cg22823192 site. According to the detection kit provided by the invention, the type of a detected sample is peripheral blood, the sample is relatively easy to obtain and non-invasive, and the patient compliance is relatively good. Abnormal methylation changes mostly exist in the early progression process of tumors, early diagnosis of ESCC can be achieved through the methylation detection method provided by the invention, and the five-year survival rate of ESCC patients is effectively increased.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to a diagnostic kit for esophageal squamous cell carcinoma based on peripheral blood mononuclear cell methylation markers and its application. Background Technology

[0002] Esophageal cancer (EC) is a common malignant tumor of the digestive tract worldwide, with China accounting for 43.8% of new EC cases and 42.1% of EC-related deaths globally. In my country, esophageal squamous cell carcinoma (ESCC) is the most prevalent histological subtype of EC, accounting for approximately 90% of all esophageal cancer cases. Epidemiological studies have confirmed that risk factors such as smoking, alcohol consumption, and hot food consumption are significantly associated with the occurrence of ESCC. Although the 5-year survival rate for early-stage ESCC is close to 90%, most patients only develop symptoms when the disease progresses to an advanced stage. This delayed diagnosis is the main reason for the persistently high mortality rate of ESCC. Achieving early diagnosis is crucial to improving the prognosis and survival rate of ESCC patients. Currently, endoscopy is the gold standard for diagnosis. However, endoscopy is an invasive procedure with poor patient compliance; moreover, it is highly dependent on equipment and the clinical experience and professional skills of the physician, making it time-consuming, labor-intensive, and costly. Developing non-invasive and convenient biomarkers for the early diagnosis of ESCC is an urgent clinical need to overcome current screening bottlenecks and optimize the allocation of medical resources.

[0003] DNA methylation, as an important epigenetic modification, shows abnormal changes in the early stages of tumor development and even precancerous stages, making it a highly promising early biomarker. In recent years, methylation detection technologies based on circulating cell-free DNA (cfDNA) have made progress in the early screening of various cancers, but cfDNA still faces application challenges such as low content and easy degradation. Peripheral blood mononuclear cells (PBMCs), as core components of the immune system, exhibit characteristic changes in their genomic DNA methylation profiles due to the body's systemic immune response during tumor development. PBMC samples are easily obtained through non-invasive peripheral blood collection, have high DNA yield, good stability, and low cost, making them an ideal source for non-invasive detection.

[0004] Based on the characteristic changes in DNA methylation of PBMCs, the development of an efficient and non-invasive early diagnostic kit for ESCC is of great scientific significance and clinical application value for improving the early diagnosis rate of ESCC and improving patient prognosis in my country. Summary of the Invention

[0005] This invention addresses the technical problems of invasiveness, high cost, and low throughput in early ESCC diagnostic technologies by proposing a non-invasive technical solution. This solution is based on an ESCC diagnostic kit that tracks the methylation levels of cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192 sites. This kit exhibits high detection sensitivity and specificity, aiming to achieve accurate and rapid diagnosis of early ESCC.

[0006] To achieve the above objectives, the present invention is implemented using the following technical solution: Application of substances that detect methylation levels in peripheral blood mononuclear cells in diagnostic or auxiliary diagnostic kits for esophageal squamous cell carcinoma.

[0007] The present invention proposes that the above-mentioned kit contains primer pairs for detecting methylation at sites cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192.

[0008] cg05914150 amplified region sequence: 5'-GAGCCTGGTTGTACAGAGCAGTCTGATTTTACGTTTTTATGAAAAGTGAATTCAGAGAATGTGTTAGAATTCCTATTATGTGTCCAGCAGAGGACAAAGGACCACTCTCCAAAGGTTTAAGAGGAGAGGTGACTGGCCATACGGCTGTCCATCTGTCCTCCATCAATGGTGTGACCGAAGACAGGGCTCCACTT-3'.

[0009] cg06769875 amplified region sequence: 5'-ggagtgatgtaattctatcttggttatgttagtcattatatgactatgcatttatcactcctcaccgaactttatgctgaaagagcaaattttactacatgtaaattgtatcttaatTTTTTTAAAGTCTCCTGGATATTGAAAGATAGGGTTGAGATGGCATCC-3'.

[0010] Amplification region sequence of cg07475126: 5’-GGCTGAGCTGTTTCTGAAGCTCAGAGCAGCTGTGACTCATCCCTCCTGCAGTCCGTTAACTTCCCACTCCTGTCACCAGACCAGCTACTCCTCTCGCTCTGACTCCTACAAACCCACTTATTTTCAAATTTGCTCAATAACCATGACATTCAAACCCAACATGCTCTGTGCACAGGACGCTGTGAAAACACACAGTGAGAATTAAGGGTCCACAGAAGAAATAATGGCCAGAGTAAGAACTGTTTTCTTGGATGCTGGGTGATGAG-3’.

[0011] Amplification region sequence of cg08433285: 5’-ATTAATGGTAGATGGTATGTGAAGACTAAAATATCCCTCAGTTGCATTTTACTTGAAGTGGAGCATGACATCTTCCTCTTGCAGTTCCCCTTGAAAAATTCTTTTATTCCTTTTGGTACTTTGTGTTTTCTTTTAGGACAGTCCTGCTTTTGTAATTCCTCCCTTTGCATGTTTGCAGATAACTTACGTGTTCTTGGTTTGAAAGATTACAAGATGTGAGAT-3’.

[0012] Amplification region sequence of cg10038907: 5’-GGATCTTGAGGCTGCCGTGCCTTCTTTGGTTTCCCCGACCCATGCGAGGAGTTTAATGTTTCTTCTAGGCGGGCCGAGGCTCTTCTGCACATGTCAAACTGAGCCCGAGAAGCTGCAACCTATCTATGGCAGCCGGTTATCAACATTGTGACCTGGACAGCTCTCAGGCTCCCGGGAAGGTTGCTGAGACATAAGATGAGAGACCCGAGAAAGCCCACTTGCACGTCTGCAGTTGCCAATTTATGTGAAAGTCAGG-3’.

[0013] Amplification region sequence of cg17968322: 5’-aacaaagctggCAGTAGTGGGGAAGCAGTAGTTCATCAGAAAAATGAACACTTATGGTTACGGTAGGTAAAGAATGACTCATAAAGAAAGGATTTCAACAGCAGTTAAAGGATAGATAATACTCTGACAGGCAGAAATGAGGCAAGAGAGCATT-3’。

[0014] Amplification region sequence of cg19572487: 5’-TCCAGGGGAAGCCCCAAGGCTCCAAGCCACCCCCACTCCAACCCGGGGCTTCCCCGGCACAGCCTCTTCATGGAGCCCTGTAGGAGAGTTTGGGGCCTGAGGTCCAATTTCCTAGCAAGACCTGGAAGGTCCTTACAGAACCACTTCCCCCAAAACAATCTTGCCCTATGAAGACTGCAACCAGAGAAGGGTATAAGAGACATCCCAGAATGTCTTGGCCAGGAAACTGAGGAGGGGGAGTGTCAGGGGCAGAAGTGATC-3’。

[0015] Amplification region sequence of cg20184330: 5’-ttctgtgATTACAGTAAGTGAATAGAGGAGCTAGGGAAACCACCTTCTACAAAAAAAAGCCCGGGCTCCCCGATTTAGCATctgtgatgacagtattgttcctggcagctctcagagcacttctccatacagtctcctgaagagccctgcatgtgagttttatctctctcaatctgtggatgtactgaggttcagagag-3’。

[0016] Amplification region sequence of cg22741248: 5’-CAGAATCAGTTCTGAGATGGCTGCCCTCTGCTCCCGAAACTCCCTCAGGCACCTGAGTCACCCGCAGGCTTTGGCTTCTGAGTTCTGTCCTGGCTGCACAGCCCTGGCCCCGCTGGCCTGAAGGGCAAGTGGGAGGGGAAAGACCTGTGTTGTGGAGTTGCCATGG-3’。

[0017] cg22823192 amplified region sequence: 5'-GTCATTGTGAGTCTGGCTTTTGATTAGTCATCTGATGTCTTCCCTAATGTGATGTGACTAAGCCGTAGCTTCTCAGCCTGCAGTTAAATTGCAGAAATGATAGGGCTTACATTAGTTTTGTTTTT ATTTGATGTTGAAGATCTTTGAGTCACACTAGAAACGAGGAGTATTTTTCATGTGGCACTAATGAGTTAATTCATAATATGAttttttgagacaaagtctctgttgcccaggctggagtgcagt-3'.

[0018] The nucleotide sequence of the forward primer for detecting cg05914150 site is shown in SEQ ID NO.1, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer for detecting cg06769875 site is shown in SEQ ID NO.3, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.4; The nucleotide sequence of the forward primer for detecting cg07475126 site is shown in SEQ ID NO.5, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.6; The nucleotide sequence of the forward primer for detecting cg08433285 site is shown in SEQ ID NO.7, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.8; The nucleotide sequence of the forward primer for detecting cg10038907 site is shown in SEQ ID NO.9, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.10. The nucleotide sequence of the forward primer for cg17968322 site detection is shown in SEQ ID NO.11, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.12. The nucleotide sequence of the forward primer for detecting cg19572487 site is shown in SEQ ID NO.13, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.14. The nucleotide sequence of the forward primer for cg20184330 site detection is shown in SEQ ID NO.15, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.16. The nucleotide sequence of the forward primer for detecting cg22741248 site is shown in SEQ ID NO.17, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.18. The nucleotide sequence of the forward primer for detecting cg22823192 site is shown in SEQ ID NO.19, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.20.

[0019] Preferably, the above kit also includes a diagnostic model, the formula of which is as follows: Score=1 / [1+exp(2.33-8.12*cg05914150-0.15*cg06769875+15.59*cg07475126-15.72*cg08433285-6.14*cg10038907+14.55*cg17968322+4.74*cg19572487+11.02*cg20184330+0.31*cg22741248+9.61*cg22823192)], a model score of Score less than or equal to 0.43 indicates a negative result, which is non-esophageal squamous cell carcinoma; a model score of Score greater than 0.43 indicates a positive result, which is esophageal squamous cell carcinoma.

[0020] This invention proposes an ESCC diagnostic kit, comprising at least detection reagents that specifically identify the cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192 sites.

[0021] Compared with the prior art, the advantages and positive effects of the present invention are as follows: 1. The test kit provided by this invention can detect peripheral blood as the sample type. The sample is easy to obtain, non-invasive, and has good patient compliance.

[0022] 2. The detection kit provided by this invention designs specific primers for the loci cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192. Multiplex PCR is used to enrich the target fragments, improving detection sensitivity. Combined with Illumina next-generation sequencing, this enhances detection accuracy.

[0023] 3. Abnormal changes in methylation are often present during the early progression of tumors. The methylation detection method provided by this invention can achieve early diagnosis of ESCC and effectively improve the five-year survival rate of ESCC patients. Attached Figure Description

[0024] Figure 1 The diagram below illustrates the detection results for sites cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192 in the examples. The vertical axis represents the methylation level at each site, and the horizontal axis represents different populations tested. ESCC: esophageal squamous cell carcinoma patients; HC: healthy subjects.

[0025] Figure 2 The ROC curves for the combined diagnosis of ESCC at the following loci in the example are shown.

[0026] Figure 3 The ROC curves for the combined diagnosis of early ESCC at the loci cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192 are shown in the examples. Detailed Implementation

[0027] To better understand the above-mentioned objectives, features, and advantages of the present invention, the present invention will be further described below with reference to specific embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in these embodiments can be combined with each other.

[0028] Numerous specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways than those described herein, and therefore the invention is not limited to the specific embodiments disclosed in the following specification.

[0029] The manufacturers or components of some reagents in the following examples are as follows: EDTA-K2 anticoagulant tube: Medical purple blood collection tube.

[0030] PBS buffer: Seville Biotechnology, composition: 8mM Na2HPO4, 2mM NaH2PO4, 150mM NaCl; pH 7.2-7.4 at 25℃. Dissolve each packet of dry powder in 2L of deionized water before use.

[0031] Ficoll lymphocyte separation solution: Tianjin Haoyang.

[0032] PBMC DNA extraction was performed using the Tiangen Blood / Cell / Tissue Genomic DNA Extraction Kit (DP304), which includes: Buffer GA, Proteinase K solution, Buffer GB, Buffer GD, Wash Buffer PW, and Elution Buffer TE.

[0033] Bisulfite conversion was performed using the EZ DNA Methylation-Gold Kit, which includes: CTConversion Reagent, M-DesµLphonation Buffer, M-Binding Buffer, M-Wash Buffer, and M-Elution Buffer.

[0034] The PCR reaction solution comes from the KAPA2G Robust HotStart PCR Kit, which contains: Taq enzyme, PCR buffer, dUTP, and dNTPs.

[0035] Example 1 1. Preparation and usage of the reagent kit The kit includes the following components: PCR reaction solution and primers.

[0036] (1) The PCR reaction solution includes hot-start Taq enzyme, PCR buffer, MgCl2, dUTP, and dNTPs.

[0037] (2) The primers include forward and backward primers for the sites cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192.

[0038] The nucleotide sequence of the forward primer for detecting cg05914150 is GAGTTTGGTTGTATAGAGTAGTTTGATTTT, and the nucleotide sequence of the backward primer is AAATAAAACCCTATCTTCRATCACACC.

[0039] The nucleotide sequence of the forward primer for detecting cg06769875 site is ggagtgatgtaattttattttggttatgtt, and the nucleotide sequence of the backward primer is AAATACCATCTCAACCCTATCTTTC.

[0040] The nucleotide sequence of the forward primer for cg07475126 site detection is GGTTGAGTTGTTTTTGAAGTTTAGAGTAG, and the nucleotide sequence of the backward primer is CTCATCACCCAACATCCAAAA.

[0041] The nucleotide sequence of the forward primer for detecting cg08433285 site is ATTAATGGTAGATGGTATGTGAAGA, and the nucleotide sequence of the backward primer is ATCTCACATCTTATAATCTTTCAAACCAA.

[0042] The nucleotide sequence of the forward primer for cg10038907 site detection is GGATTTTGAGGTTGTYGTGTTT, and the nucleotide sequence of the backward primer is CCTAACTTTCACATAAATTAACAACTACAA.

[0043] The nucleotide sequence of the forward primer for cg17968322 site detection is aataaagttggTAGTAGTGGGGAAGTAG, and the nucleotide sequence of the backward primer is AATACTCTCTTACCTCATTTCTACCTATCAAAA.

[0044] The nucleotide sequence of the forward primer for detecting cg19572487 is TTTAGGGGGAAGTTTTAAGGTTTTAAGTTATT, and the nucleotide sequence of the backward primer is AATCACTTCTACCCCTAACACTCC.

[0045] The nucleotide sequence of the forward primer for cg20184330 site detection is ttttgtgATTATAGTAAGTGAATAGAGGAGTT, and the nucleotide sequence of the backward primer is ctctctaaacctcaatacatccacaa.

[0046] The nucleotide sequence of the forward primer for cg22741248 site detection is TAGAATTAGTTTTGAGATGGTTGTTTT, and the nucleotide sequence of the backward primer is CCATAACAACTCCACAACACAAATC.

[0047] The nucleotide sequence of the forward primer for detecting cg22823192 site is GTTATTGTGAGTTTGGTTTTTGATTAG, and the nucleotide sequence of the backward primer is actacactccaacctaaacaacaaaaac.

[0048] 2. Experimental Procedure 2.1 Separation of PBMCs The subjects' samples were obtained from the Department of Hematology at Qilu Hospital of Shandong University, and the samples were collected with the subjects' informed consent. Subjects fasted the night before blood collection. On the day of collection, 3 ml of peripheral venous blood was collected using an EDTA-K2 anticoagulant tube. After standing at room temperature for 30 minutes, the following procedures were performed: A 15 ml sterile centrifuge tube was taken, and 3 ml of Histopaque-1077 (Sigma) lymphocyte separation medium was added. The peripheral blood was gently mixed with a plastic pipette, and then gently and slowly added to the upper layer of the lymphocyte separation medium at a 45° angle along the tube wall. The centrifuge tube was carefully placed in a horizontal centrifuge and centrifuged at 450 xg for 30 minutes at room temperature. The cells in the middle cloud-like white membrane layer were carefully aspirated and placed in another centrifuge tube. 10 ml of PBS buffer was added, and the tube was centrifuged at 450 xg for 10 minutes to wash away excess Ficoll. The supernatant was discarded, and the cells were mixed with 1 ml of PBS buffer by pipetting. 10 ml of PBS buffer was added, and the tube was centrifuged at 250 xg for 10 minutes. The above steps were repeated to wash the cells again, and the supernatant was discarded to obtain the cell pellet.

[0049] 2.2 DNA extraction from PBMCs Following the standard operating procedure of the Tiangen Blood / Cell / Tissue Genomic DNA Extraction Kit (DP304): Add 200 μL of buffer GA to the cell pellet, vortex until completely suspended, add 20 μL of Proteinase K solution, and mix well; add 200 μL of buffer GB, invert thoroughly to mix, and incubate at 70°C for 10 min; add 200 μL of anhydrous ethanol, vortex thoroughly for 15 sec; add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (place the adsorption column in the collection tube), centrifuge (12,000 rpm, 30 s), and discard the waste liquid; add 500 μL of buffer GD to the adsorption column CB3, centrifuge (12,000 rpm, 30 s), and discard the waste liquid; add 600 μL of wash buffer PW to the adsorption column CB3, centrifuge (12,000 rpm, 30 s), and discard the waste liquid; repeat the above steps; place the adsorption column CB3 back into the collection tube, centrifuge (12,000 rpm, 2... (min), discard the waste liquid; place CB3 at room temperature for several minutes to thoroughly dry any residual rinsing solution in the adsorbent material; transfer the adsorption column CB3 into a clean centrifuge tube, add 200 μL of elution buffer TE dropwise to the center of the adsorption membrane, place at room temperature for 5 min, centrifuge (12,000 rpm, 2 min), and collect the solution in the centrifuge tube. Measure the concentration using a NanoDrop ND-1000 (Thermo Scientific) spectrophotometer.

[0050] 2.3 Bisulfite Conversion The DNA samples obtained from the above extraction were converted to bisulfite using Zymo Research as per the manufacturer's instructions. The specific operating steps are as follows: Add 130µL LCT Conversion Reagent (prepare fresh before use, and avoid light during operation) to the extracted 1000ng DNA sample, vortex to mix, and perform transformation according to the reaction conditions of 98℃, 10min; 64℃, 2.5h; 4℃, ∞; Add 600µL M-Binding Buffer to the adsorption column, then add the transformed sample, mix, centrifuge (10000rpm, 30s), and discard the waste liquid; Add 100µL M-Wash Buffer to the adsorption column, centrifuge (10000rpm, 30s), and discard the waste liquid; Add 200µL M-DesµL phonation Buffer to the adsorption column, incubate at room temperature for 20min, centrifuge (10000rpm, 1min), and discard the waste liquid; Add 200µL M-Wash Buffer to the adsorption column, centrifuge (10000rpm, 1min), and discard the waste liquid; Add 200µL M-Wash Buffer to the adsorption column, centrifuge (10000rpm, 1min), and discard the waste liquid; Add 200µL M-Wash Buffer to the adsorption column. Buffer, centrifuge (10000 rpm, 1 min), discard waste liquid; transfer the adsorption column to a new collection tube, add 20 μL M-Elution Buffer, let stand at room temperature for 5 min, centrifuge (10000 rpm, 1 min) to obtain the DNA sample after sulfite conversion.

[0051] Samples should be tested as soon as possible after processing. The storage time at -20℃ is generally no more than 4 months. If longer storage is required, please place the sample at -70℃ and avoid repeated freeze-thaw cycles.

[0052] 2.4 PCR reaction system and reaction conditions The final concentration composition of the PCR amplification reaction system is as follows: 1x PCR reaction solution; 0.1-1 μM cg05914150 methylated primer, 0.1-1 μM cg06769875 methylated primer, 0.1-1 μM cg07475126 methylated primer, 0.1-1 μM cg08433285 methylated primer, 0.1-1 μM cg10038907 methylated primer, 0.1-1 μM cg17968322 methylated primer, 0.1-1 μM cg19572487 methylated primer, 0.1-1 μM cg20184330 methylated primer, 0.1-1 μM cg22741248 methylated primer, and 0.1-1 μM cg22823192 methylated primer.

[0053] 2.4.1 Reagent Preparation Take 5 μL of PCR reaction solution and add the following primers respectively: cg05914150 methylation forward primer, cg05914150 methylation backward primer, cg06769875 methylation forward primer, cg06769875 methylation backward primer, cg07475126 methylation forward primer, cg07475126 methylation backward primer, cg08433285 methylation forward primer, cg08433285 methylation backward primer, cg10038907 methylation forward primer, and cg10038907 methylation backward primer. 0.25 µL each of the following primers: forward primer (cg17968322), backward primer (cg17968322), forward primer (cg19572487), backward primer (cg19572487), forward primer (cg20184330), backward primer (cg20184330), forward primer (cg22741248), backward primer (cg22741248), forward primer (cg22823192), and backward primer (cg22823192).

[0054] 2.4.2 Multiplex PCR amplification and Illumina next-generation sequencing Multiplex PCR amplification was performed using the transformed sample genome as a template. Primers containing the index sequence were used to introduce a specific tag sequence compatible with the Illumina platform into the library ends via PCR amplification. An 11-cycle PCR program was used to minimize PCR bias. Equal volumes of the index PCR amplification products from all samples were mixed and recovered via gel extraction to obtain the final MethylTarget sequencing library. The fragment length distribution of the library was validated using an Agilent 2100 Bioanalyzer. After precise quantification of the library molar concentration, high-throughput sequencing was performed on the Illumina HiSeq platform in 2×150 bp paired-end sequencing mode to obtain FastQ data.

[0055] 2.4.3 Sequencing Results Analysis The amount and quality of raw sequencing data for each sample were evaluated (cytosine transformation efficiency statistics, effective read screening statistics), and the methylation level of the sites was calculated.

[0056] 2.4.4 Calculation Model Scoring Based on the methylation levels at sites cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192, the model score was calculated using a logistic regression model. Score=1 / [1+exp(2.33-8.12*cg05914150-0.15*cg06769875+15.59*cg07475126-15.72*cg08433285-6.14*cg 10038907+14.55*cg17968322+4.74*cg19572487+11.02*cg20184330+0.31*cg22741248+9.61*cg22823192)].

[0057] If the score is less than or equal to 0.43, the result is negative and the diagnosis is non-esophageal squamous cell carcinoma; if the score is greater than 0.43, the result is positive and the diagnosis is esophageal squamous cell carcinoma.

[0058] 3. Accuracy verification This embodiment provides a verification of the detection accuracy of the kit. Using the kit and experimental method provided in Example 1, 97 clinical samples were tested. The methylation levels of the following sites were measured: cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192. Figure 1 As shown.

[0059] The results of 97 clinical samples were compared with those of the gold standard method for ESCC detection (esophagoscopy combined with pathological examination). 46 samples had normal pathological diagnoses, while 51 samples showed ESCC. Using the method described in Example 1, the detection method correctly identified 86.27% of esophageal cancers and 86.67% of early-stage esophageal cancers. Specific comparison results are shown in Table 1.

[0060] Table 1. Comparison of ESCC methylation detection results in ESCC patient and healthy control samples. 4. Receiver Operating Characteristic Curves for Healthy Controls and ESCC Patients This embodiment provides model scores and receiver operating characteristic (ROC) curves for healthy controls and ESCC patients. The kits and experimental methods provided in Example 1 were used to conduct experimental tests on healthy controls and ESCC patients. Results are as follows... Figure 2 As shown in the figure, this experimental example demonstrates that the ESCC DNA methylation detection technology can clearly distinguish between healthy controls and ESCC patients, with an area under the curve (AUC) of 0.91.

[0061] 5. Receiver Operating Characteristic Curves for Healthy Controls and Early-Stage ESCC Patients Experimental tests were conducted on healthy controls and patients with early-stage ESCC using the kit and experimental methods provided in Example 1.

[0062] like Figure 3 As shown, the PBMCs DNA methylation detection technology provided in this experimental example can clearly distinguish between healthy controls and early ESCC patients, with an area under the curve (AUC) of 0.90.

[0063] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments for application in other fields. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. Application of substances that detect methylation levels in peripheral blood mononuclear cells in diagnostic or auxiliary diagnostic kits for esophageal squamous cell carcinoma.

2. The application according to claim 1, characterized in that, The kit contains primer pairs for detecting methylation at the following sites: cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192. The nucleotide sequence of the forward primer for detecting cg05914150 site is shown in SEQ ID NO.1, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer for detecting cg06769875 site is shown in SEQ ID NO.3, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.

4. The nucleotide sequence of the forward primer for detecting cg07475126 site is shown in SEQ ID NO.5, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.6; The nucleotide sequence of the forward primer for detecting cg08433285 site is shown in SEQ ID NO.7, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.8; The nucleotide sequence of the forward primer for detecting cg10038907 site is shown in SEQ ID NO.9, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.

10. The nucleotide sequence of the forward primer for cg17968322 site detection is shown in SEQ ID NO.11, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.

12. The nucleotide sequence of the forward primer for detecting cg19572487 site is shown in SEQ ID NO.13, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.

14. The nucleotide sequence of the forward primer for cg20184330 site detection is shown in SEQ ID NO.15, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.

16. The nucleotide sequence of the forward primer for detecting cg22741248 site is shown in SEQ ID NO.17, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.

18. The nucleotide sequence of the forward primer for detecting cg22823192 site is shown in SEQ ID NO.19, and the nucleotide sequence of the backward primer is shown in SEQ ID NO.

20.

3. The application according to claim 2, characterized in that, The kit also includes a diagnostic model, the formula of which is as follows: Score=1 / [1+exp(2.33-8.12*cg05914150-0.15*cg06769875+15.59*cg07475126-15.72*cg08433285-6.14*cg 10038907+14.55*cg17968322+4.74*cg19572487+11.02*cg20184330+0.31*cg22741248+9.61*cg22823192)], A model score of 0.43 or less indicates a negative result, meaning it is not esophageal squamous cell carcinoma; a model score of 0.43 or greater indicates a positive result, meaning it is esophageal squamous cell carcinoma.

4. A diagnostic or auxiliary diagnostic kit for esophageal squamous cell carcinoma, characterized in that, This includes detection reagents that specifically identify the cg05914150, cg06769875, cg07475126, cg08433285, cg10038907, cg17968322, cg19572487, cg20184330, cg22741248, and cg22823192 loci.

Images