Pichia pastoris as well as construction method and application thereof

Abstract

The invention relates to the technical field of biology, and particularly discloses pichia pastoris as well as a construction method and application thereof. According to the pichia pastoris disclosed by the invention, beta-glucan is knocked out to synthesize a related gene gas1. By deleting the beta-glucan coding gene gas1 gene of the pichia pastoris cell wall, the cell size is reduced, the transmission distance from the cell surface to the cell nucleus is reduced, oxygen transmission and product secretion during high-density culture are improved, and the fermentation production efficiency is improved. In addition, the pichia pastoris constructed by the invention enhances the synthesis of the intracellular product bisabolol, and also can enhance the secretion ability of the intracellular product bisabolol. By reducing the cell size, reducing the carbon flow flowing to the cell wall polysaccharide synthesis and increasing the carbon source flowing to the target product synthesis, the application has great significance in industrial production.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to a Pichia pastoris yeast, its construction method, and its application. Background Technology

[0002] Pichia pastoris is a methyltrophic yeast that has become an important expression system in biopharmaceuticals, industrial enzyme preparations, and other fields due to its efficient protein secretion capacity, flexible gene manipulation system, and industrial-grade fermentation adaptability. Among them, the GS115 strain (Mut+ phenotype) is widely used in laboratory research and industrial production because of its complete methionine synthesis capacity and stable exogenous protein expression performance.

[0003] GS115 is a methanol-utilizing strain of *Pichia pastoris*. GS115 cells are oval or elliptical in shape, approximately 3-10 μm in diameter. The GS115 genome is available in GenBank accession: AAP34473. GS115 utilizes methanol as its sole carbon and energy source, oxidizing it to formaldehyde via alcohol oxidase (AOX), which then enters the energy cycle. Methanol-inducible promoters in GS115 (such as AOX1) can regulate the expression of exogenous genes, enabling them to synthesize high-density proteins during the methanol-inducible phase.

[0004] Currently, no research has shown that the cell size of Pichia pastoris GS115 affects the secretion of intracellular products, nor have there been any reports of using gene editing technology to reduce the cell size of GS115. There are no reports on reducing the cell size of Pichia pastoris GS115. Regarding improving the secretion efficiency of intracellular products in other yeasts, the addition of permeability enhancers, such as calcium, is often employed. 2+ Fermentation strategies such as (Biotechnology Bulletin, 2018, Vol. 34, No. 3, pp. 208-216), proanthocyanidins (China Brewing, 2024, Vol. 43, No. 11, pp. 64-69), and antibacterial active substances produced by Lactobacillus (China Dairy Industry, 2015, No. 2, pp. 28-31) are complicated to operate and control, and the slightest carelessness can promote excessive fermentation and lead to cell death. Summary of the Invention

[0005] The purpose of this application is to overcome the shortcomings of the prior art and provide a Pichia pastoris, its construction method, and its application.

[0006] To achieve the above objectives, the technical solution adopted in this application is as follows:

[0007] This application provides a Pichia pastoris yeast in which the β-glucan synthesis-related gene gas1 is knocked out.

[0008] This application reduces cell size and shortens the transfer distance from the cell surface to the nucleus by deleting the gas1 gene, which encodes β-glucan in the cell wall of Pichia pastoris, thereby improving oxygen transfer and product secretion during high-density culture and enhancing fermentation production efficiency.

[0009] As a preferred embodiment of the Pichia pastoris described in this application, the Pichia pastoris includes yeast GS115.

[0010] This application also provides a method for constructing the above-mentioned Pichia pastoris, characterized by comprising the following steps:

[0011] S1. Constructing a knockout plasmid: Query the sgRNA guide sequence of the β-glucan synthesis-related gene gas1, design primers to amplify and obtain a linearized knockout plasmid containing the sgRNA sequence of the β-glucan synthesis-related gene gas1. Then, purify the product, recover the DNA fragment, assemble it, and transform it into the host bacteria to obtain a circularized knockout plasmid containing the sgRNA sequence of the β-glucan synthesis-related gene gas1.

[0012] S2. Constructing overlapping arms: Using Pichia pastoris as a template, primers were designed upstream and downstream of the β-glucan synthesis-related gene gas1 to amplify upstream and downstream homologous arms respectively. The gene fragments of the upstream and downstream homologous arms were amplified and fused to obtain the overlapping arm of the β-glucan synthesis-related gene gas1.

[0013] S3. The circularized knockout plasmid obtained in step S1 and the overlapping arm in step S2 are introduced into competent cells to obtain Pichia pastoris.

[0014] In this application, the deletion of the gas1 gene, which is related to the synthesis of β-glucan in the cell wall of *Pichia pastoris*, reduces cell size and thus increases the secretion rate of intracellular products. The constructed *Pichia pastoris* (novel *P. pastoris* chassis cells) eliminates the need for traditional strategies (such as adding cell membrane permeability enhancers), reducing operational difficulty and exhibiting stable characteristics, which is of great significance for metabolic engineering. This application, by reducing cell size, decreases the carbon flow to cell wall polysaccharide synthesis and increases the carbon source flow to target product synthesis, which is of great significance for industrial production.

[0015] In some specific embodiments, the average size of the Pichia pastoris is 0.8–1.0 μm.

[0016] Knocking out gas1, a gene related to β-glucan synthesis in Pichia pastoris, resulted in smaller cell morphology in the resulting Pichia pastoris (GS115Δgas1). This is the first report of gas1 affecting cell size, indicating that gas1 has a novel function in regulating cell size.

[0017] In some specific embodiments, the nucleotide sequence of the sgRNA guide sequence is such as GGGTTATAGATCGATCCCTG.

[0018] In some specific embodiments, the host bacterium includes JM109.

[0019] In a preferred embodiment of the method for constructing Pichia pastoris according to this application, the nucleotide sequence of the primer in step S1 is shown in SEQ ID NO: 5-6.

[0020] In a preferred embodiment of the method for constructing Pichia pastoris according to this application, the nucleotide sequences of the primers in step S2 are shown in SEQ ID NO: 1-4.

[0021] In a preferred embodiment of the method for constructing Pichia pastoris described in this application, in step S2, the upstream and downstream lengths of the β-glucan synthesis-related gene gas1 are set to 1000 bp.

[0022] In some specific embodiments, assembly is performed using the ClonExpress-II One Step Cloning Kit.

[0023] In some specific embodiments, in step S3, the circularized knockout plasmid obtained in step S1 and the overlapping arm in step S2 are introduced into competent cells, then plated on YPD solid plates containing bleomycin, and verified by colony PCR. Subsequently, positive transformants are identified by gene sequencing to obtain Pichia pastoris.

[0024] This application also provides the application of the above-mentioned Pichia pastoris in enhancing intracellular product secretion and / or synthesis.

[0025] In a preferred embodiment of the application described in this application, the intracellular product includes (-)-α-bisabolol.

[0026] The Pichia pastoris constructed using this application enhances the synthesis of the intracellular product bisabolol and also enhances the secretion capacity of the intracellular product bisabolol.

[0027] This application also provides the application of knocking out the β-glucan synthesis-related gene gas1 in reducing the cell size of Pichia pastoris.

[0028] This application also provides a method for promoting the secretion and / or synthesis of (-)-α-bisabolol, using the above-mentioned Pichia pastoris.

[0029] This application aims to reduce the cell size of Pichia pastoris by knocking out the β-glucan synthesis-related gene gas1, thereby increasing the secretion of intracellular products.

[0030] Compared with the prior art, this application has the following beneficial effects:

[0031] This application provides a *Pichia pastoris* yeast, its construction method, and its applications. The *Pichia pastoris* yeast of this application knocks out the β-glucan synthesis-related gene *gas1*. By deleting the *gas1* gene, which encodes β-glucan in the cell wall of *Pichia pastoris*, this application reduces cell size, decreases the transfer distance from the cell surface to the nucleus, improves oxygen transfer and product secretion during high-density culture, and enhances fermentation efficiency. Furthermore, the *Pichia pastoris* yeast constructed using this application enhances the synthesis of the intracellular product bisabolol and also enhances its secretion capacity. This application, by reducing cell size and decreasing the carbon flow to cell wall polysaccharide synthesis while increasing the carbon source flow to target product synthesis, has significant implications for industrial production. Attached Figure Description

[0032] Figure 1 Flowchart for constructing the α-bisabolol expression plasmid;

[0033] Figure 2 The standard curve for GC-MS analysis of (-)-α-bisabolol standard;

[0034] Figure 3 TEM images of P. pastoris GS115 and GS115Δgas1 (the subscripts are unclear but do not affect the substantive content, and are disclosed here).

[0035] Figure 4 This is a graph showing the amount of synthesis by strain GS115Δgas1. Detailed Implementation

[0036] To better illustrate the purpose, technical solution, and advantages of this application, the following description will be provided in conjunction with the accompanying drawings and specific embodiments.

[0037] In the following embodiments, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used are commercially available unless otherwise specified, and the raw materials used in each parallel experiment are the same.

[0038] To investigate the effect of changes in dextran content caused by changes in cell wall structure on BO synthesis, we attempted to influence cell wall plasticity by disrupting the gas1 protein-coding gene, which is related to cell wall assembly, and deleting cell wall proteins. The aim was to verify whether a cell wall with lower viscosity would lead to a more permeable structure, thereby promoting the secretion of the target product.

[0039] Example 1

[0040] This embodiment provides a Pichia pastoris and its construction method;

[0041] The specific construction method includes the following steps:

[0042] 1. Preparation of competent cells of E. coli JM109:

[0043] 1) Take 5 μL of Escherichia coli JM109 (Wild-type strain) {ChengB J,Yu KY,Weng X,et al.Impact of cell wall polysaccharide modifications on the performance of Pichia pastoris:novel mutants with enhanced fitness and functionality for bioproduction applications[J].Microbial Cell Factories,2024,23(1):55-69.} bacterial culture from a glycerol tube preserved in the laboratory, inoculate it into LB liquid medium, and culture at 37℃ and 220 rpm;

[0044] 2) Control the initial OD 600 0.02 mg was transferred to 50 mL of LB liquid medium and cultured with shaking at 37 °C and 220 rpm for 2.5 h. When the OD of the bacterial culture... 600 Once the solution reaches 0.6, place it on ice for 30 minutes.

[0045] 3) Centrifuge at 4℃ and 4000rpm for 10 minutes;

[0046] 4) Discard the supernatant and resuspend the bacterial pellet in 40 mL of pre-cooled 0.1 mol·L⁻¹ solution. -1 Centrifuge at 4℃ and 4000rpm for 10min in CaCl2 solution, and repeat the operation twice;

[0047] 5) Add 1 mL of 0.1 mol·L⁻¹ to the collected bacterial cells. -1 Resuspend the bacterial cells in CaCl2 and 1 mL of 30% glycerol, aliquot 200 μL into pre-chilled 1.5 mL centrifuge tubes, label them, and store them at -80°C.

[0048] 2. Preparation of GS115 yeast competent cells:

[0049] 1) Take 5 μL of Pichia pastoris culture (Cheng BJ, Yu KY, Weng X, et al. Impact of cell wall polysaccharide modifications on the performance of Pichia pastoris: novel mutants with enhanced fitness and functionality for bioproduction applications[J]. Microbial Cell Factories, 2024, 23(1):55-69.) from a glycerol tube preserved in the laboratory and inoculate it into YPD liquid medium. Incubate at 30℃ and 220 rpm for 2 days with shaking.

[0050] 2) Transfer the bacterial culture to 50 mL of YPD liquid medium and control the initial OD. 600 The value was 0.2. The culture was carried out at 30℃ and 220rpm for 4 hours on a shaker. When the OD of the bacterial culture reached 0.2... 600 Once the bacterial culture reaches 0.8, place it on ice for 10 minutes.

[0051] 3) Transfer the pre-cooled bacterial culture to a sterile and pre-cooled 50mL centrifuge tube, and centrifuge at 4℃ and 4000rpm for 5min;

[0052] 4) Discard the supernatant and resuspend the bacterial pellet in 9 mL of pre-chilled BEDS (10 mmol·L⁻¹). -1 pH 8.3, Bicine-NaOH, 3% ethylene glycol, 5% dimethyl sulfoxide, 1 mol·L⁻¹ -1 Add 1 mL of 1.0 mol·L⁻¹ to the D-sorbitol solution. -1 Dithiothreitol was cultured at 30°C and 220 rpm for 5 min with shaking.

[0053] 5) Collect the bacterial cells by centrifugation at 4℃ and 4000rpm for 5min, resuspend them in 1mL of pre-cooled BEDS solution, aliquot 100μL into each pre-cooled 1.5mL centrifuge tube, label them accordingly, and store them in a -80℃ refrigerator.

[0054] 3. Strain knockout process:

[0055] (1) Construction of knockout plasmid: The 20bp sgRNA guide sequence (GGGTTATAGATCGATCCCTG, as shown in SEQ ID NO: 9) of the target gene (β-glucan synthesis-related gene gas1) was found on the website chopchop. Primers (pPpT4-gas1-F and pPpT4-gas1-R) were designed, mainly targeting the replacement of the 6bp sequence of HH ribozyme and the 20bp sequence of sgRNA. Using the original knockout plasmid pPpT4 as a template, linearized knockout plasmids containing the sgRNA sequence of the target gene (β-glucan synthesis-related gene gas1) were amplified using primers pPpT4-gas1-F and pPpT4-gas1-R (Table 1). The DNA fragments were recovered using a product purification kit and assembled using the ClonExpress-II One Step Cloning Kit. After ligation, the plasmids were chemically transformed into E. coli. In the JM109 clone master, a circularized knockout plasmid containing the sgRNA sequence of the target gene (β-glucan synthesis-related gene gas1) was obtained.

[0056] Table 1

[0057]

[0058] (2) Construction of overlapping arms: Using the P. pastoris GS115 genome as a template, primers gas1-up-F, gas1-up-R and gas1-down-F, gas1-down-R were designed at approximately 1,000 bp upstream and downstream of the target gene, respectively, to amplify the upstream and downstream homologous arms. Then, the two gene fragments were amplified and fused using up-F and down-R to obtain the overlapping arms of the target gene.

[0059] (3) Using electroporation, the knockout plasmid and overlapping arm were simultaneously electroporated into GS115 competent cells, then plated on YPD solid plates containing bleomycin, and verified by colony PCR. Positive transformants were then identified by gene sequencing.

[0060] 4. Construction of (-)-α-bisabolol expression plasmid in Pichia pastoris:

[0061] Based on the codon preference of Pichia pastoris, the codons of mrbbs derived from German chamomile were optimized and synthesized by Genewiz Biotechnology Co., Ltd. (Suzhou).

[0062] Expression plasmid construction: Primers mrbbs-F / R (Table 1) were designed to amplify the gene fragment mrbbs. Using the constitutive expression plasmid pGAPZ A, a one-step cloning method was used to ligate the expression plasmid pGAPZ A-mrbbs. Positive transformants were finally obtained through colony PCR verification and gene sequencing screening. The flowchart for α-bisabolol expression plasmid construction is shown below. Figure 1 As shown.

[0063] 5. Transformation of Pichia pastoris expression plasmids and screening of positive transformants:

[0064] For the correct recombinant expression plasmid pGAPZ A-mrbbs (containing P) GAP Promoter linearization was performed using a single restriction enzyme digestion: XmaJI rapid restriction endonuclease was used for digestion. The linearized recombinant plasmid was then introduced into GS115 competent cells via electroporation, and the transformation product was then evenly spread onto a substrate containing 100 μg / mL of [recombinant plasmid]. -1 Bleomycin-resistant YPD solid medium was cultured at 30°C for 2-3 days. Preliminary validation was performed using colony PCR, followed by gene sequencing analysis to ultimately screen for the expected recombinant strain.

[0065] 6. Production strain culture method:

[0066] Take an appropriate amount of bacterial culture from the glycerol tube and inoculate it onto a YPD solid plate containing the corresponding resistance using the streak plating method. Then, incubate the plate at 30°C for 2-3 days. After incubation, pick a single colony from the plate and inoculate it into a test tube containing 3 mL of the corresponding resistance YPD liquid medium for secondary activation culture. Calcium disulfide (OD200) of the activated secondary seed culture is then used to convert the culture into a liquid culture medium. 600 An inoculum of 0.2 g was inoculated into BMGY shake flask culture medium. After 48 hours of culture, the culture was analyzed for P... GAP The promoter-induced recombinant strain was supplemented with 1 mL of 50% glycerol every 24 hours; the entire culture process lasted 132 hours, during which samples were taken every 12 hours, and the samples taken will be used for subsequent analysis and detection.

[0067] Buffered glycerol-complex medium (BMGY) (1L): glycerol (10ml), yeast extract (10g), amino-free yeast nitrogen source (13.4g), peptone (20g), potassium phosphate buffer (pH 6.0, 0.1mol·L⁻¹). -1 ) and biotin (4.10 -4 g·L -1 ).

[0068] 7. GC-MS determination of (-)-α-bisabolol:

[0069] 1) Centrifuge the culture at 12,000 rpm for 10 min to separate the bacterial precipitate and supernatant;

[0070] 2) Mix the separated supernatant with 10% (v·v) -1 Mix with n-dodecane and incubate at 30°C and 220 rpm for 30 min, then centrifuge at 12,000 rpm for 10 min. Separate the organic layer for GC-MS analysis.

[0071] 3) Dissolve 10 mg of (-)-α-bisabolol (Cat. No. 23089-26-1, Sigma Aldrich) standard in 100 mL of n-dodecane to form 100 mg·L⁻¹ -1 (-)-α-bisabolol standard solution was used for qualitative analysis of (-)-α-bisabolol in the culture medium; 10 g·L -1 The (-)-α-bisabolol standard solution was diluted with n-dodecane to prepare concentrations of 5, 10, 20, 40, 80, 160, and 320 mg·L⁻¹. -1 Used for quantitative analysis. GC-MS analysis of different concentrations of (-)-α-bisabolol standards showed that the concentration range of (-)-α-bisabolol was 10-160 mg·L⁻¹. -1 At that time, the linear relationship was good. The regression equation was y = 1.96 × 10⁻⁶. 8 x + 1.4 × 10 9 R 2 = 0.9940, where x represents the concentration of (-)-α-bisabolol and y represents the peak area. The detection limit is 7.69 ppb. The GC-MS standard curve for (-)-α-bisabolol standards is shown below. Figure 2 As shown.

[0072] 4) GC-MS (SCIONSQ-456-GC, Bruker) detection conditions: injection port temperature 280℃, injection volume 1μL, splitless; column HP-5MS (30m×0.250mm×0.25μm); column flow rate maintained at 1mL·min -1 The oven temperature was initially maintained at 50°C for 30 seconds, then increased at 15°C / min. -1 The temperature was raised to 280°C and held at 280°C for 7 minutes. Helium was used as the carrier gas, with an inlet pressure of 5.58 psi and an electron energy of 70 eV. The analysis time for a single sample was 13 minutes.

[0073] Yeast cell walls are reported to consist of three layers: an outermost electron-dense layer, mainly composed of mannan and mannoproteins; a middle, lower-density layer, mainly composed of β-1,3-glucan and chitinous structures; and an inner dense layer connected to the plasma membrane. Since the gene gas1 is involved in the formation and maintenance of cell wall assembly, this study used TEM to observe cell morphology. Transmission electron microscopy was performed on strains GS115 and GS115Δgas1, and the results are as follows: Figure 3 As shown, GS115 cells have an average size of 2.4–3.0 μm and thinner, more compact cell walls. In contrast, GS115Δgas1 cells are even smaller (0.8–1.0 μm). This is the first report of gas1 influencing cell size, suggesting a novel function of gas1 in regulating cell size.

[0074] like Figure 4 As shown, the bisabolol synthesis of Pichia pastoris constructed in this application is enhanced, with GS115Δgas1 / pGAPZ A-mrbbs reaching the highest level of 66.80 mg·L⁻¹. -1 It is 12.07 times better than GS115 / pGAPZ A-mrbbs.

[0075] The cofactor NADPH is mainly produced by the pentose phosphate pathway, the tricarboxylic acid cycle, and the dehydrogenase system. Most NADPH resides intracellularly, while a small portion is secreted extracellularly through the cell membrane. Therefore, extracellular NADPH levels can be used to evaluate cell membrane permeability. The extracellular NADPH levels of GS115 and GS115Δgas1 were 1.29 μM and 2.23 μM, respectively. Compared to GS115, the extracellular NADPH content of GS115Δgas1 increased by 72.87%, indicating a significantly enhanced cell membrane permeability, which is beneficial for the secretion of intracellular products.

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application and are not intended to limit the scope of protection of this application. Although this application has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of this application without departing from the substance and scope of the technical solutions of this application.

Claims

1. A Pichia pastoris, characterized in that, The Pichia pastoris was found to have knocked out the gas1 gene, which is related to β-glucan synthesis.

2. The Pichia pastoris as described in claim 1, characterized in that, The Pichia pastoris includes yeast GS115.

3. The method for constructing Pichia pastoris as described in claim 1, characterized in that, Includes the following steps: S1. Constructing a knockout plasmid: Query the sgRNA guide sequence of the β-glucan synthesis-related gene gas1, design primers to amplify and obtain a linearized knockout plasmid containing the sgRNA sequence of the β-glucan synthesis-related gene gas1. Then, purify the product, recover the DNA fragment, assemble it, and transform it into the host bacteria to obtain a circularized knockout plasmid containing the sgRNA sequence of the β-glucan synthesis-related gene gas1. S2. Constructing overlapping arms: Using Pichia pastoris as a template, primers were designed upstream and downstream of the β-glucan synthesis-related gene gas1 to amplify upstream and downstream homologous arms respectively. The gene fragments of the upstream and downstream homologous arms were amplified and fused to obtain the overlapping arm of the β-glucan synthesis-related gene gas1. S3. The circularized knockout plasmid obtained in step S1 and the overlapping arm in step S2 are introduced into competent cells to obtain Pichia pastoris.

4. The method for constructing Pichia pastoris as described in claim 3, characterized in that, In step S1, the nucleotide sequence of the primer is shown in SEQ ID NO: 5-6.

5. The method for constructing Pichia pastoris as described in claim 3, characterized in that, In step S2, the nucleotide sequences of the primers are shown in SEQ ID NO: 1-4.

6. The method for constructing Pichia pastoris as described in claim 3, characterized in that, In step S2, the upstream and downstream lengths of the β-glucan synthesis-related gene gas1 are set to 1000 bp.

7. The use of Pichia pastoris as described in claim 1 or 2 in enhancing intracellular product secretion and / or synthesis.

8. The application as described in claim 7, characterized in that, The intracellular products include (-)-α-bisabolol.

9. Application of knocking out the β-glucan synthesis-related gene gas1 in reducing the cell size of Pichia pastoris.

10. A method for promoting the secretion and / or synthesis of (-)-α-bisabolol, characterized in that, The Pichia pastoris as described in claim 1 or 2 is used.

Images