Pichia pastoris engineering bacteria expressing full-length human collagen type Ⅲ and application thereof

Abstract

This invention relates to the fields of molecular cloning and protein expression, and particularly to a Pichia pastoris engineered strain expressing full-length human type III collagen and its applications. The engineered Pichia pastoris strain is obtained by cloning the enzymatically digested human type III collagen gene sequence into an expression vector to obtain a recombinant expression vector, which is then transformed into Pichia pastoris. This engineered Pichia pastoris strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 6, 2024, with accession number CGMCC NO.32510. The Pichia pastoris engineered strain obtained by this invention can efficiently produce the desired human type III collagen through fermentation, exhibiting excellent characteristics such as high yield and absence of endotoxins.

Description

Technical Field

[0001] This invention relates to the fields of molecular cloning and protein expression, and more particularly to a Pichia pastoris engineered strain expressing full-length human type III collagen and its applications. Background Technology

[0002] Type III collagen is widely found in various tissues of mammals and possesses strong tensile strength, hemostatic and coagulant properties, and the ability to promote wound healing. It provides mechanical stability and integrity to animal tissues, thus finding widespread application in the fields of aesthetic medicine and medical devices. The enormous potential of recombinant collagen is built upon the comprehensive rise of the beauty industry and the rapid development of tissue engineering. In the beauty sector, collagen represents a market worth tens of billions of yuan; in tissue engineering, collagen is a high-performance basic material; furthermore, in medical settings, collagen can be used in hemostatic bandages and drug sustained-release technology, demonstrating significant practical application value.

[0003] However, type III collagen is present in low amounts in the body, and the production capacity of animal-derived type III collagen is limited. Existing recombinant collagen products in China are either collagen fragments or artificially designed analogs of non-natural sequences. These not only fail to cover all functional regions of natural collagen but also struggle to achieve the structural strength of natural collagen. Furthermore, the non-natural amino acid sequences raise concerns about biocompatibility and safety. Similarly, some designs add affinity purification tags to both ends when expressing full-sequence human collagen. While this facilitates purification, the immunogenicity of the purification tags also adds additional safety risks. Therefore, there is an urgent need to construct engineered bacteria that can express full-sequence human type III collagen with low production costs, high yields, easy purification, and good biocompatibility. Summary of the Invention

[0004] The purpose of this invention is to provide a Pichia pastoris engineered strain expressing full-length human type III collagen and its applications, in order to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: A Pichia pastoris engineered strain expressing full-length human type III collagen, characterized in that the Pichia pastoris engineered strain is obtained by cloning the enzymatically digested human type III collagen gene sequence into an expression vector to obtain a recombinant expression vector and then transforming it into Pichia pastoris. The engineered Pichia pastoris strain was deposited at the China General Microbiological Culture Collection Center on November 6, 2024, with accession number CGMCC NO.32510, and its classification name is Pichia pastoris, specifically named JLU-COL3A1.

[0006] Furthermore, the recombinant expression vector is pPICZ-INVE-COL3A1, and the specific construction method includes the following steps: The human type III collagen gene sequence after enzyme digestion was cloned into the pUC57 vector to obtain the pUC57-COL3A1 recombinant vector; The sequence encoding the INVE signal peptide was synthesized into the pPICZ B vector to obtain the vector pPICZ-INVE; The pPICZ-INVE and pUC57-COL3A1 plasmids were double-digested, and the digestion products were then recovered by gel extraction and ligated to obtain the recombinant expression vector pPICZ-INVE-COL3A1.

[0007] Furthermore, the nucleotide sequence of the human type III collagen gene after enzyme digestion is shown in SEQ ID NO.2.

[0008] Furthermore, the nucleotide sequence encoding the INVE signal peptide is shown in SEQ ID NO.3.

[0009] Furthermore, the amino acid sequence of the recombinant human type III collagen expressed by the Pichia pastoris engineered strain is shown in SEQ ID NO.1.

[0010] Furthermore, the recombinant human type III collagen expressed by the Pichia pastoris engineered strain has a trimer structure.

[0011] Furthermore, the recombinant human type III collagen expressed by the Pichia pastoris engineered strain has the N-propeptide removed from the natural full sequence, and from the amino terminus it sequentially includes an N-terminal peptide, a triple helix functional region and a C-propeptide, covering the full length of the mature peptide of human type III collagen.

[0012] The above-mentioned engineered Pichia pastoris strain expressing full-length human type III collagen was used in the fermentation production of recombinant human type III collagen.

[0013] Compared with the prior art, the beneficial effects of the present invention are: 1. This invention constructs a Pichia pastoris engineered strain expressing human type III collagen, possessing all the functional domains of natural collagen, and without adding affinity purification tags, significantly reducing biocompatibility and safety issues. Furthermore, the choice to express it along with the C-propeptide allows the expression product to form a stable trimer structure through disulfide bonds in the C-propeptide. This trimer structure more closely resembles the natural conformation of type III collagen when it performs its full biological function in vivo. Compared to the monomer, the trimer exhibits higher structural stability, enabling the formation of more robust cell adhesion sites, thereby more effectively supporting cell adhesion, migration, and proliferation. Simultaneously, it lays the foundation for future acquisition of recombinant human type III collagen with a structure close to the natural triple helix.

[0014] 2. The human full-sequence type III collagen obtained by the present invention through fermentation tank has excellent characteristics such as high yield and no endotoxins, meeting the requirements of cosmetic raw materials, medical devices and medical-grade high-purity collagen, and has important practical significance in the industrial production of recombinant human type III collagen. Attached Figure Description

[0015] Figure 1 The image shows an agarose gel electrophoresis diagram of the enzyme digestion identification of the recombinant plasmid pPICZ-INVE-COL3A1 of this invention. Lane M is the protein marker, lane 1 is the pPICZ-INVE plasmid, and lanes 2-5 are the results of double digestion of pPICZ-INVE-COL3A1 with Xho I and Not I. Figure 2 The results of SDS-PAGE electrophoresis of the shake-flask fermentation of the recombinant human type III collagen α1 chain expression engineered bacteria of this invention are shown. Lane M is the protein marker, and lanes 1-4 are the supernatant of X-33 shake-flask culture (uninduced), and the supernatant of engineered bacteria shake-flask culture induced with methanol for 24 h, 48 h, and 72 h, respectively. Figure 3 This is a graph showing the results of mass spectrometry analysis of type III collagen peptide coverage (representative peptides). Figure 4 The results are obtained by non-denaturing electrophoresis after purification of the supernatant from shake-flask fermentation of the engineered bacteria expressing recombinant human type III collagen α1 chain. Lane M is the marker, and lanes 1-4 are the supernatant from the shake-flask fermentation of the engineered bacteria after methanol induction for 24 h, 48 h, 72 h, and 96 h, respectively. Figure 5 The results showed that the obtained recombinant human COL3A1 protein promoted Hacat cell migration. Figure 6 The results of SDS-PAGE electrophoresis of the supernatant from the high-density fermentation of the engineered bacteria expressing recombinant human type III collagen α1 chain in this invention are shown. Lane M is the marker, and lanes 1-4 are the supernatant from the high-density fermentation of the engineered bacteria after methanol induction for 24 h, 48 h, and 72 h.

[0016] Figure 7 The results of SDS-PAGE electrophoresis detection of the supernatant purified from the high-density fermentation culture of recombinant human type III collagen α1 chain in this invention are shown. Lane M is the marker, lane 1 is the protein supernatant after methanol induction from the high-density fermentation culture of engineered bacteria, lane 2 is the fermentation broth supernatant that flows through the ion exchange column, and lanes 3-5 are the samples eluted by the ion exchange column. Figure 8The acne-removing effect of the subjects in Example 3 of the present invention (VIsIA7 natural light source mode, polarized light mode photo). Detailed Implementation

[0017] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0018] Please see Figures 1 to 7 The present invention provides: To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below.

[0019] Construction of the pPICZ-INVE-COL3A1 recombinant vector. The α-factor in pPICZαA was replaced with the INVE signal peptide through gene synthesis to obtain the empty vector pPICZ-INVE. The coding sequence for the triple helix functional region of human type III collagen was obtained from a gene bank, codon optimized, and cloned into pPICZ-INVE to obtain the pPICZ-INVE-COL3A1 expression vector.

[0020] The expression vector was plated on YPD solid medium, and positive clones were screened. After sequencing identification, the corresponding strains were labeled and stored. The positive strains were first activated in BMGY medium, then transferred to BMMY medium, and induced to express for 24 h, 48 h, and 72 h with a final concentration of 1% methanol. The supernatant of the fermentation broth was collected, and quantitative analysis was performed by SDS-PAGE. The engineered strain JLU-COL3A1 with a high expression level was successfully screened.

[0021] The engineered bacteria were fermented at high density in basal salt medium (BSM) for 72 hours. After methanol induction, the supernatant of the fermentation broth was collected. Dissolved oxygen was maintained above 30 g / L and pH was kept constant at 5.0 during fermentation. The final wet weight of the bacterial cells reached 300 g / L. Based on the grayscale analysis of the electrophoretic bands, the expression level of the target protein was approximately 2 g / L.

[0022] COL3A1 was purified by ion exchange column chromatography, and the peptide coverage was >95% as determined by mass spectrometry.

[0023] The human full-sequence type III collagen prepared by the above method has high yield and activity, and is free of endotoxins, meeting the requirements for cosmetic raw materials, medical devices, and medical-grade high-purity collagen.

[0024] The specific construction of the engineered Pichia pastoris is shown below: Example 1

[0025] The method for constructing Pichia pastoris engineered strain containing human full-sequence type III collagen provided in this embodiment includes the following steps.

[0026] (1) Codon optimization and gene synthesis of human COL3A1 gene Based on the human type III collagen α1 chain coding sequence (NM_000090.4) in the GenBank database, the portion expressing the full-length mature peptide, including the N-terminal peptide, triple helix domain, and C-propeptide, was selected. Its amino acid sequence is shown in SEQ NO:1.

[0027] The codons were optimized based on the Pichia pastoris preference, and Xho I was introduced at the 5' end and Not I restriction enzyme sites were introduced at the 3' end. The optimized nucleotide sequence is shown in SEQ ID NO.2:

[0028] The optimized type III collagen gene sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The above sequence was cloned into the pUC57 vector to obtain the pUC57-COL3A1 recombinant vector.

[0029] (2) Construction of pPICZ-INVE vector The sequence encoding the INVE signal peptide was directly synthesized into the pPICZ B vector. The coding sequence of INVE is shown in SEQ ID NO.3. The new vector was named pPICZ-INVE.

[0030] SEQ ID NO.3: ATGCTTTTGCAAGCTTTCCTTTTCCTTTGGCTGGTTTTGCAGCCAAAATATCTGCA.

[0031] (3) Construction of the pPICZ-INVE-COL3A1 recombinant vector pPICZ-INVE and pUC57-COL3A1 plasmids were double-digested, and the digestion products were then recovered by gel electrophoresis and ligated. Positive clones were identified, and the results are shown in the figure. Figure 1 .

[0032] (4) Electroporation of Pichia pastoris strain X33 The recombinant plasmid pPICZ-INVE-COL3A1 was linearized using the restriction endonuclease Sac I. The linearized product was then recovered by gel extraction and transformed into competent cells of Pichia pastoris X33 (purchased from Fenghui Biotechnology Co., Ltd., catalog number JZ057).

[0033] (5) Shake flask screening of transformants Pick all positive clones and inoculate them into 20 mL Erlenmeyer flasks containing BMGY (100 μg / mL Zeocin). Cover the flasks with 8 layers of sterile gauze. Incubate overnight at 220-250 rpm and 28°C until the culture reaches the logarithmic growth phase OD. 600 = 2-6 (approximately 24-28 hours).

[0034] Under aseptic conditions, take 500 μL of bacterial culture and add 500 μL of sterile 50% glycerol to prepare glycerol culture. Take 2 mL of the culture from the previous step and inoculate it into a 20 mL BMMY Erlenmeyer flask. Incubate overnight at 220-250 rpm and 28°C. Every 24 h, add 200 μL of methanol using a sterile syringe until the final concentration is 1% to maintain induction.

[0035] After culturing for 24 h, 48 h, and 72 h, 1 mL of culture was transferred to a 1.5 mL centrifuge tube and centrifuged at 12000 rpm for 5 min at room temperature. The protein concentration of each sample was determined using a BCA protein quantification kit. Samples with higher protein concentrations were then selected for SDS-PAGE electrophoresis to detect the expression level of the target protein. By comparing the expression level of COL3A1 in each strain (based on the intensity of the electrophoretic band), strain #8, with the highest expression level, was selected as the engineered strain and named JLU-COL3A1. Figure 2 ).

[0036] (6) Identification and activity characterization of COL3A1 The target band was excised from the electrophoresis gel and destained. It was then reduced-alkylated with dithiothreitol and iodoacetamide, followed by enzymatic digestion with trypsin, chymotrypsin, Arg-C protease, and proteinase K to generate small peptide fragments. The mass and relative abundance of these fragments were analyzed by LC-MS / MS. Raw files generated from LC-MS / MS data were used for database searching and analysis using PEAKS software. The results showed that the peptide coverage was greater than 95%, and representative peptide mass spectrometry analysis results are shown below. Figure 3 As shown.

[0037] The molecular weight of the non-denaturing electrophoresis bands is approximately 360 kDa, about three times the molecular weight of a single COL3A1 chain, proving that the obtained COL3A1 protein is a trimer, as shown in the results. Figure 4 As shown.

[0038] According to the industry standard "Recombinant Collagen" (YY / T1849-2022), scratch assays were performed using Hacat cells to characterize its activity. 0.1 mg / L of COL3A1 significantly enhanced the migration rate of Hacat cells. The promoting effect of COL3A1 on cell migration was most significant at a concentration of 2.5 mg / L, as shown in the results below. Figure 5 As shown.

[0039] (7) High-density fermentation Seed culture: Select INVE-P4H single clones and culture them in 30 mL YPD medium for 20 h at 30℃ and 200 rpm. Inoculate 5 mL of activated bacterial solution into 500 mL YPD medium and continue culturing at 30℃ and 200 rpm for 20 h, until OD reaches [value missing]. 600 The value is approximately 10.

[0040] Fermenter cultivation and induction: 200 mL of yeast seed culture was inoculated into 8 L of initial fermentation medium and incubated at 30°C. During cultivation, the tank pressure and stirring speed were adjusted to maintain dissolved oxygen levels above 30%, a constant temperature of 30°C, and a constant pH of 3. Samples were taken every 12 hours to measure OD. 600 Value and wet weight.

[0041] After approximately 22 hours of fermentation, the OD of the fermentation broth... 600 The dissolved oxygen level was approximately 120, indicating that the glycerol in the tank had been completely depleted. The yeast was then starved for another hour before methanol was added for induction.

[0042] Initiate the induction process by adding methanol (containing 4 mL / L PTM1) at a rate of 0.1 mL / min. Adjust the tank pressure and stirring speed to maintain the dissolved oxygen level above 20%. Adjust the methanol addition rate based on the dissolved oxygen (DO) curve to ensure the DO curve maintains a non-increasing trend.

[0043] Samples were taken every 12 hours after induction to measure OD. 600 The sample was collected and its wet weight was recorded. The sample was then centrifuged (10,000 rpm, 10 min), and the supernatant was used for electrophoresis detection.

[0044] After 72 hours of induction, induction was stopped, and the OD of the yeast fermentation broth was measured. 600 The final value was approximately 180, and the wet weight of the cells was approximately 300 g / L. After centrifugation at 6000 rpm for 10 min, the fermentation supernatant was collected, and the fermentation products were analyzed by SDS-PAGE electrophoresis. The results are as follows: Figure 6 As shown.

[0045] (8) Purification of high-density fermentation products A certain amount of supernatant from the high-density fermentation broth of JLU-COL3A1 obtained after 72 h of induction was purified by ion exchange column chromatography. The fermentation product was eluted with different concentrations of citrate buffer to obtain relatively pure COL3A1 protein. Figure 7 ). Example 2

[0046] Dissolve all ingredients in water according to the following weight ratios and stir thoroughly to make a colorless, odorless, and transparent moisturizing cream.

[0047] Example 1: The recombinant human type III collagen prepared in Example 1 of this invention contains 0.1% xanthan gum, 0.1% mineral ester, 0.1% cetearyl alcohol, 0.5% carbomer, 1% walnut seed oil, 0.05% hydrogenated polydecene, 0.2% triethanolamine, 0.2% methylparaben, 1% propylparaben, and 0.6% p-hydroxyacetophenone. How to use: After cleansing in the morning and evening, apply directly to the face or hands until fully absorbed. Example 3

[0048] Dissolve all ingredients in water according to the following weight ratios and stir thoroughly to obtain a colorless and transparent moisturizing mask dressing base.

[0049] Example 1: The recombinant human type III collagen prepared in Example 1 of this invention contains 0.1%; 5% glycerol; 0.01% 1,3-propanediol; 0.05% hydroxyethyl urea; 0.02% inulin; 0.01% panthenol; 0.01% phenoxyethanol; 0.05% hyaluronic acid; and 0.6% p-hydroxyacetophenone. How to use S1. Apply the mask containing the base liquid of Example 1 to the face and gently press to position it; S2. Gently peel off the outer lining and adjust it to fit snugly against your skin; S3. After applying for 10-15 minutes, remove the mask. You can massage it in to help it absorb or wash it off with water, depending on the situation.

[0050] Instrument test results: After 28 days of use of the experimental product, the skin redness score significantly improved by 51.6% (P<0.001). Subjective assessment (expert assessment) results: After 28 days of use of the test product, the skin acne count (subjective assessment) decreased significantly by 67.56% (P<0.001). Product safety evaluation results: Human trials showed no adverse skin reactions in the 30 participants.

[0051] As can be seen from the subject images, the skin was significantly improved when using the method described in this invention.

[0052] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A Pichia pastoris engineered strain expressing full-length human type III collagen, characterized in that, The Pichia pastoris engineered strain was obtained by cloning the human type III collagen gene sequence after enzyme digestion into an expression vector to obtain a recombinant expression vector, and then transforming it into Pichia pastoris to obtain the Pichia pastoris engineered strain. The engineered Pichia pastoris strain was deposited at the China General Microbiological Culture Collection Center on November 6, 2024, with accession number CGMCC NO.32510.

2. The Pichia pastoris engineered strain expressing full-length human type III collagen according to claim 1, characterized in that, The recombinant expression vector is pPICZ-INVE-COL3A1, and the specific construction method includes the following steps: The human type III collagen gene sequence after enzyme digestion was cloned into the pUC57 vector to obtain the pUC57-COL3A1 recombinant vector; The sequence encoding the INVE signal peptide was synthesized into the pPICZ B vector to obtain the vector pPICZ-INVE; The pPICZ-INVE and pUC57-COL3A1 plasmids were double-digested, and the digestion products were then recovered by gel extraction and ligated to obtain the recombinant expression vector pPICZ-INVE-COL3A1.

3. The Pichia pastoris engineered strain expressing full-length human type III collagen according to claim 2, characterized in that, The nucleotide sequence of the human type III collagen gene after enzyme digestion is shown in SEQ ID NO.

2.

4. The Pichia pastoris engineered strain expressing full-length human type III collagen according to claim 2, characterized in that, The nucleotide sequence encoding the INVE signal peptide is shown in SEQ ID NO.

3.

5. The Pichia pastoris engineered strain expressing full-length human type III collagen according to claim 1, characterized in that, The amino acid sequence of the recombinant human type III collagen expressed by the Pichia pastoris engineered strain is shown in SEQ ID NO.

1.

6. The Pichia pastoris engineered strain expressing full-length human type III collagen according to claim 5, characterized in that, The recombinant human type III collagen expressed by the Pichia pastoris engineered strain has a trimer structure.

7. The Pichia pastoris engineered strain expressing full-length human type III collagen according to claim 5, characterized in that, The recombinant human type III collagen expressed by the engineered Pichia pastoris strain has the N-propeptide removed from the natural full sequence and includes an N-terminal peptide, a triple helix functional region, and a C-propeptide sequentially from the amino terminus, covering the full-length mature peptide of human type III collagen.

8. The application of the Pichia pastoris engineered strain expressing full-length human type III collagen as described in any one of claims 1-7 in the fermentation production of recombinant human type III collagen.

Images