Recombinant tubercle bacillus strain as well as preparation method and application thereof

Abstract

The invention provides a genetically modified tubercle bacillus strain as well as a preparation method and application thereof, the strain is tubercle bacillus obtained by knocking out virulence-related genes by adopting a genetic engineering method and simultaneously supplementing and enhancing immunogenicity antigen genes, and can be used for preparing attenuated live vaccines. The attenuated live vaccine prepared by using the strain has lower adverse reaction rate and stronger immunogenicity, and can be used for replacing a bacillus calmette guerin vaccine or a booster vaccine. Moreover, the DTH reaction caused by vaccination or infection can be identified through TBST (based on Mycobacterium tuberculosis antigen skin test) by using the vaccine prepared by the strain, and the strain has important application in tuberculosis vaccine production.

Description

Technical Field

[0001] This invention relates to the field of tuberculosis vaccine technology, and in particular to a recombinant tuberculosis strain, its preparation method, and its application. Background Technology

[0002] Tuberculosis (TB) remains a significant global public health challenge. Despite some progress in prevention and control over the past few decades, its spread and impact remain substantial. In 2021, approximately 10 million people worldwide were infected with TB, resulting in about 1.5 million deaths. The status of TB prevention and control varies by region, with low- and middle-income countries facing a greater burden.

[0003] Currently, the prevention and control of tuberculosis mainly relies on early diagnosis and standardized treatment. The introduction of new diagnostic technologies, such as molecular detection and rapid culture methods, has improved the detection rate of tuberculosis. However, the emergence of drug-resistant tuberculosis has made treatment more complex, and the proportion of drug-resistant tuberculosis cases is increasing year by year, posing a serious challenge to public health.

[0004] Vaccination remains an important means of preventing tuberculosis. Although the existing BCG vaccine is effective in preventing severe forms of tuberculosis in children, its effectiveness in protecting against pulmonary tuberculosis in adults is limited, and further development of tuberculosis vaccines with stronger immunoprotective efficacy is still needed.

[0005] Mycobacterium tuberculosis strain H37Ra (H37Ra) is an attenuated strain of human-type Mycobacterium tuberculosis. It has extremely low virulence and is relatively safe for the host, making it suitable for use as a live vaccine. Compared to BCG, strain H37Ra has more complete immunogenicity and contains some antigenic components lost in BCG. Simultaneously, strain H37Ra can effectively activate macrophages and stimulate the body to produce a specific immune response, playing an important role in the prevention and treatment of tuberculosis. However, compared to BCG, live vaccines prepared from strain H37Ra still cause stronger virulence-related adverse reactions.

[0006] Based on current research, the virulence-related adverse reactions of live attenuated tuberculosis vaccines mainly include abnormal reactions at the injection site, such as abscesses and ulcers, and systemic adverse reactions, including disseminated BCG disease and immune reconstitution inflammatory syndrome (IRIS). These virulence-related adverse reactions have a significant impact on tuberculosis prevention and control. Vaccines prepared from some attenuated strains can reduce these adverse reactions, but at the same time, they also reduce protective efficacy. Summary of the Invention

[0007] This invention provides a recombinant tuberculosis strain, its preparation method, and its application. The strain replaces the virulence-related gene with an antigen gene. This strain is used to prepare a live attenuated tuberculosis vaccine, which solves the problem that the existing live attenuated tuberculosis vaccines are too virulent, while the immunogenicity is too weak after knocking out the virulence gene. This invention achieves the preparation of a low-virulence, high-immunogenic live tuberculosis vaccine.

[0008] In a first aspect, the present invention provides a recombinant tuberculosis strain in which the nucleotide sequence shown in SEQ ID NO.1 is replaced with the nucleotide sequence shown in SEQ ID NO.2.

[0009] ESAT-6 and CFP-10 are abundant virulence factors in Mycobacterium tuberculosis, encoded by the adjacent genes esxA and esxB in the RD1 region, respectively. They can co-transcribe to form a tight dimer. This dimer plays a crucial role in disrupting the host's immune response, exerting virulence, participating in the translocation of phagocytosed lysosomes to the host cytoplasm, and activating neutrophils to exert chemotaxis. Replacing the nucleotide sequence shown in SEQ ID NO.7 with the nucleotide sequence shown in SEQ ID NO.8 terminates the expression of the virulence-related ESAT-6 and CFP-10 proteins, instead expressing the antigen gene HA. This HA gene can serve as a selection gene and also as a means to reduce the virulence of the strain while enhancing its immunogenicity.

[0010] Secondly, the present invention provides a method for preparing the above-mentioned recombinant attenuated tuberculosis strain, wherein the nucleotide sequence of Mycobacterium tuberculosis, as shown in SEQ ID NO.7, is replaced by a nucleotide sequence as shown in SEQ ID NO.8 using genetic engineering techniques.

[0011] In embodiments of the present invention, the knockout is accomplished via homologous recombination, using the hygromycin gene to replace the ESAT-6 and CFP-10 genes to achieve knockout, thereby reducing the virulence of the strain while enhancing its immunogenicity. Simultaneously, the Ag85B-HspX gene is inserted to further enhance its immunogenicity.

[0012] Ag85B is one of the most immunogenic proteins in Mycobacterium tuberculosis. In patients with active tuberculosis and BCG-vaccinated individuals, it induces very strong humoral (antibody) and cellular (Th1-type CD4+ and CD8+ T cell) immune responses. It participates in the construction of key cell wall components, essential for bacterial survival and pathogenicity. HspX, as a latent infection-associated antigen, is being explored as a vaccine component targeting latent infection clearance or preventing relapse due to its high expression during the latent period. Insertion of these two genes can enhance vaccine immunogenicity while reducing toxicity.

[0013] In some embodiments of the present invention, the above preparation method is specifically as follows: Knockout method: First, a homologous exchange site (AES) is constructed and then integrated into the Mycobacterium tuberculosis phage genome to obtain a phage midline. The phage midline is introduced into Mycobacterium smegmae to obtain a recombinant phage with the integrated homologous exchange site. After in vitro amplification, a high-titer recombinant phage is obtained and used to transfect Mycobacterium tuberculosis. The transfected Mycobacterium tuberculosis is plated on a solid medium containing hygromycin resistance and cultured at 37°C for 4-5 weeks. Single clones are picked and verified by PCR and other methods.

[0014] Reinstatement Method: First, a recombinant plasmid containing the Ag85B-HspX gene, pMV361, was prepared and transformed into E. coli DH5α competent cells. Single clones were selected for sequencing to verify the successful construction of the seamless cloning method using positive plasmids. Then, an appropriate amount of positive plasmid was added to electroporated competent cells (knockout strains), mixed thoroughly, and after electroporation, complete culture medium was added. After overnight incubation, the cells were centrifuged, the supernatant was discarded, and the bacterial cells were resuspended in the residual liquid culture medium. The bacterial suspension was then spread parallel to two mycobacterial solid culture media (containing the corresponding antibiotics). After incubation at 37°C for 3-4 weeks, single clones were selected and inoculated into complete culture medium (containing the corresponding antibiotics). After incubation at 37°C for 3-4 weeks, the bacterial cells were collected, the genome was extracted, and PCR verification was performed.

[0015] Thirdly, the present invention provides the application of the above-mentioned recombinant tuberculosis strain in the preparation of vaccines.

[0016] The present invention further provides an attenuated vaccine, which is prepared from the above-mentioned recombinant tuberculosis strain, preferably an attenuated live vaccine.

[0017] This invention further provides a method for preparing the above-mentioned attenuated vaccine, the specific steps of which include: (1) Resuscitation and culture of strains: Take one strain, thaw it quickly in a 37°C water bath, inoculate it onto Sutong potato slant medium, and incubate it at 37°C for 3-4 weeks; (2) Harvesting: After the bacteria have matured, collect the bacterial film or bacterial blocks from the surface or inside of the culture medium; (3) Physical treatment: Disperse the bacterial blocks by grinding or dilution to form a uniform bacterial suspension; (4) Dilution and packaging: Dilution and packaging into a 0.5mg / ml bacterial suspension is the live attenuated vaccine.

[0018] Preferably, the viable bacteria concentration in the diluted and dispensed bacterial suspension is 1.0 × 10⁻⁶. 7 CFU / mg.

[0019] Preferably, the vaccine in the above applications is administered via subcutaneous injection or orally.

[0020] Fourthly, the present invention provides the application of the above-mentioned preparation method in the preparation of drugs for the prevention and treatment of tuberculosis; The drug is a vaccine, preferably a live attenuated vaccine.

[0021] The beneficial effects of this invention include: This invention obtains a recombinant tuberculosis strain by knocking out the virulence-related protein encoding genes ESAT-6 and CFP-10 in Mycobacterium tuberculosis, while adding the highly conserved gene Ag85B and the latent infection-related gene HspX HA. The live attenuated vaccine prepared using this strain has lower virulence and stronger immunogenicity compared to BCG vaccine. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0023] Figure 1 This is an electrophoresis result of the gene knockout strain constructed in Example 1 of this invention, verified by two-segment PCR, where Lanes 1-3: PCR verification. H37Ra The ΔRa3913-14 gene knockout bacteria used the primer pair LYZFP / LYZRP; Lanes 5-7: PCR test H37Ra The ΔRa3913-14 gene knockout strain used primer pair RYZFP / RYZRP; the wild-type strain (WT strain) (control group) PCR used primer pair LYZFP / LYZRP (Lane 4) and RYZFP / RYZRP (Lane 8), respectively; M: DNA Marker.

[0024] Figure 2 This is an electrophoresis result of the gene-complement strain constructed in Example 1 of this invention, verified by two-segment PCR. Lanes 1-5: PCR verification of the H37RaΔRa3913-14 strain containing the PMV361-Ra1897-Ra2046 plasmid, using primer pair JDFP / JDRP; Lane 6: PCR verification of the blank H37RaΔRa3913-14 strain, using primer pair JDFP / JDRP; M: Marker.

[0025] Figure 3 This is a graph showing the results of bacterial load analysis in the spleen and lungs of guinea pigs in Example 3 of the present invention.

[0026] Figure 4 This is a graph showing the results of the guinea pig tissue pathology lesion index analysis in Example 3 of the present invention.

[0027] Figure 5 This is a graph showing the results of ELISA detection of serum IgG antibodies in mice in each group in Example 4 of this invention.

[0028] Figure 6 This is a graph showing the results of ELISA detection of serum IgG1 antibodies in mice in each group in Example 4 of this invention.

[0029] Figure 7 This is a graph showing the results of ELISA detection of serum IgG2a antibodies in mice in each group in Example 4 of this invention.

[0030] Figure 8 This is a graph showing the results of detecting the expression level of IFN-γ in each group of mice by antigen stimulation using the ELISpot method in Example 4 of this invention.

[0031] Figure 9 This is a graph showing the results of detecting the expression level of IL-4 in each group of mice stimulated by antigen using the ELISpot method in Example 4 of this invention. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0033] Example 1 Construction of recombinant tuberculosis strain To verify the effect of Ra1897-Ra2046 gene replacement, this application constructed knockout and replacement strains of the ESAT-6 and CFP-10 genes for subsequent experiments.

[0034] Strain construction: First, homologous exchange sites were constructed (the sacB and hyg genes were used for knockout strains, and the Ag85B-HspX antigen gene was used for complement strains). These sites were then integrated into the Mycobacterium tuberculosis phage genome to obtain phage midmids. The phage midmids were introduced into Mycobacterium smegmatis to obtain recombinant phages with integrated homologous exchange sites. High-titer recombinant phages were obtained through in vitro amplification and used to transfect Mycobacterium tuberculosis. The transfected Mycobacterium tuberculosis was plated onto solid medium containing hygromycin resistance and cultured at 37°C for 4-5 weeks. Single clones were then picked.

[0035] Using the upstream and downstream sequences of the left and right sites after knockout and replenishment as the target sequences, knockout verification primers and replenishment verification primers were constructed according to the following sequences to verify the knockout and replenishment effects.

[0036] Knockout verification primers: LYZFP:TCAGGCCGTCGAGTTGACCG (SEQ ID NO.1) LYZRP:ACGAGCTGCCCGTGGAGGACTG (SEQ ID NO.2) RYZFP:ACCTTCCTGCACGACTTCGAGGT (SEQ ID NO.3) RYZRP:AGTGGTTGCGGCCGTAATTGA (SEQ ID NO.4) Replacement of validation primers: JDFP:TGTCAGTACGCGAAGAACCACGC (SEQ ID NO.5) JDRP: TCGAGCAAGACGTTTCCCGTTG (SEQ ID NO.6) Verification of the knockout effect: Primers were designed targeting the sequences upstream and downstream of the knockout gene and between the antigen gene. The following primers were used to verify the gene knockout effect by PCR. The verification results are as follows: Figure 2 As shown.

[0037] Knockout sequence: ATGGCAGAGATGAAGACCGATGCCGCTACCCTCGCGCAGGAGGCAGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACCAGGTGGAGTCGACGGCAGGTTCGTTGCAGGGCCAGTGGCGCGGCGCGGCGGGGACGGCCGCCCAGGCCGCGGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGAATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGATCAGCGAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGATGTTCGCATAG (SEQ IDNO.7) Complementary sequence: like Figure 1 , Figure 2 It can be seen that, except for the control, all primers at each site can amplify the corresponding sequence, indicating that the knockout and restoration of the strain sequence were successfully performed.

[0038] Example 2: Preparation of live attenuated vaccine (1) Resuscitation and culture of strains: Take one strain, thaw it quickly in a 37°C water bath, inoculate it onto Sutong potato slant medium, and incubate it at 37°C for 3-4 weeks.

[0039] (2) Harvesting: After the bacteria have matured, collect the bacterial film or bacterial blocks from the surface or inside of the culture medium.

[0040] (3) Physical treatment: Disperse the bacterial blocks by grinding or dilution to form a uniform bacterial suspension. (4) Dilution and dispensing: Dilution and dispensing to a 0.5 mg / ml bacterial suspension.

[0041] (5) Liquid dispensing or freeze-drying of bacterial suspension (freeze-drying protection solution: sucrose: 10%, monosodium glutamate: 1.5%, potassium dihydrogen phosphate: 0.05 M, gelatin: 1%, lactose: 2%, pH 7.0-7.2).

[0042] Attenuated live vaccines of the knockout group and complement group strains in Example 1 were prepared using the above method. The knockout group was named 37Ra-△EC, and the complement group was named H37Ra-△EC-::AH.

[0043] Example 3: Evaluation of the protective efficacy of the live attenuated vaccine and verification of the identification effect of TBST This embodiment evaluates the identification effect of the attenuated live vaccine prepared in Example 2 using TB-PPD (purified tuberculin protein derivative) and EC (recombinant Mycobacterium tuberculosis fusion protein). The protective efficacy of the vaccine is evaluated through a challenge experiment with the virulent strain H37Rv.

[0044] SPF-grade, healthy female Hartley guinea pigs weighing over 300 g were selected and divided into 5 groups of 6 animals each, with 2 guinea pigs per cage, for a total of 24 guinea pigs. The groups were: a. BCG (Bacillus Calmette-Guérin) group; b. H37Ra-WT (original strain) group; c. H37Ra-△EC (knockout) group; d. H37Ra-△EC- ::H (replacement) group; e. PBS group.

[0045] Guinea pig screening: Screen guinea pigs according to the following steps: (1) Remove the hair from the left back of the guinea pig and disinfect the injection site with an alcohol swab.

[0046] (2) Draw 50 IU / mL of TB-PPD into a 1 mL syringe and inject 0.2 mL intradermally.

[0047] (3) Observe the longitudinal and transverse diameters of the local erythema or induration at 24 h and 48 h after injection. The results at 24 h are used to determine the positive result. The average diameter of the erythema or induration reaction (the sum of the longitudinal and transverse diameters divided by 2) is not less than 5 mm and is considered negative. Guinea pigs with negative skin test results are used for subsequent experiments.

[0048] The selected guinea pigs were subjected to immunization and challenge experiments according to the immunization and challenge procedure in Table 1.

[0049] 1. Four weeks after immunization, the skin test (PPD / EC) was used to evaluate the differential efficacy of the live attenuated vaccine by assessing the size of the erythema and induration.

[0050] 2. Virus challenge experiment: Guinea pigs in both the experimental and control groups were subcutaneously challenged with 5.0 × 10³ CFU Mtb. Two weeks after infection, PPD-TST and rEC-TBST skin tests were performed. The method was as follows: 0.1 ml of 5 µg / ml EC and 50 IU / ml TB-PPD were injected at each point on the left and right back of the guinea pigs, for a total of two points. The size of the local skin redness or induration reaction was observed and recorded at 24 and 48 hours after injection.

[0051] The criteria for PPD-TST and rEC-TBST skin tests are as follows: At 24 h and 48 h after injection, the longitudinal and transverse diameters of the local erythema or induration are observed. A positive result is defined as an average erythema or induration reaction (the sum of the longitudinal and transverse diameters divided by 2) of not less than 5 mm, and a negative result is defined as less than 5 mm. The cumulative diameter of the average erythema or induration reaction for each dilution is calculated based on the 24-hour results. The skin test results are shown in Table 2.

[0052] Four to five weeks after challenge, guinea pigs were dissected. The protective efficacy of the candidate vaccine was evaluated by analyzing the bacterial load in the spleen and lungs and by histopathological lesion index analysis. The results of the bacterial load in the spleen and lungs are as follows: Figure 3 As shown, the histopathological lesion index is as follows: Figure 4 As shown.

[0053] Results analysis: 1. As shown in Table 2, the vaccine prepared from the complement group strains, when used in combination with TBST, can differentiate between vaccination and Mycobacterium tuberculosis infection.

[0054] 2. After immunization, guinea pigs in each strain group had a certain degree of immune protection against Mycobacterium tuberculosis infection. The protective effect of the H37Ra-△EC∷AH (complemented strain) group against Mycobacterium tuberculosis infection was not inferior to that of the BCG group, or was superior to that of the BCG group.

[0055] Example 4 Evaluation of the immunogenicity of live attenuated vaccines SPF-grade female BALB / c mice, weighing 20 - 25 g, 30 in number. From the Guangdong Provincial Center for Medical Laboratory Animals. Animal certificate number: No. 44007200123277, license number: SYXK (Guangdong) 2022 - 0275 The above mice were divided into: a. BCG (Bacillus Calmette-Guérin) group; b. H37Ra-wt (original strain) group; c. H37Ra-△EC (knockout group) group; d. H37Ra-△EC-::AH (complemented group); e. PBS group.

[0056] The immunogenicity evaluation experiment was carried out according to the following steps: (1) Immunization: Take BalB / c mice, disinfect the back with 75% alcohol cotton, and subcutaneously inject 0.1 mL of live bacterial vaccine at the disinfected site. Immunize twice, and collect blood 3 weeks after immunization. (2) Blood collection: Blood was collected by orbital puncture before the primary immunization and before the mice were sacrificed, and the blood was collected. Let it stand at 37°C for 2 h, centrifuge at 4000 rpm for 10 min, separate the serum, and store it in a -20°C refrigerator after aliquoting for later use.

[0057] (3) Detection of blood antibody levels: The ELISA method was used to detect the serum specific antibody titer. Dilute the lysate of each strain to 5 μg / ml with coating buffer as the antigen, add 100 μl per well, and incubate the plate overnight at 4°C. Detect the IgG, IgG1, and IgG2a antibody levels, and the results are as shown in Figure 5 、 Figure 6 、 Figure 7 respectively.

[0058] (4) Detection of cellular immune effect: Sacrifice the mice 4 weeks after the last immunization, aseptically isolate the spleen, isolate spleen cells, and use ELISPOT to detect multiple cytokines (IFN-γ, IL-4, etc.). The results are as shown in Figure 8 、 Figure 9 respectively.

[0059] Result analysis: There were differences in the antibody levels and cytokine levels in mice immunized with the strains. Overall, comparing the expression levels of IgG, IgG1, IgG2a, IFN-γ, and IL-4, the immunogenicity intensities of each strain were as follows: BCG < genetically modified strains of H37Ra ≤ Mycobacterium tuberculosis H37Ra The absolute values ​​of IgG OD in the BCG group, TB-wt group, knockout strain group, replenished strain group, and saline group were 1.160, 2.039, 1.481, 1.905, and 0.327, respectively.

[0060] The absolute values ​​of OD for IgG1 were 0.771, 1.220, 0.836, 1.100, and 0.133, respectively.

[0061] The absolute values ​​of the OD values ​​of IgG2a were 0.318, 0.561, 0.451, 0.677, and 0.102, respectively.

[0062] The absolute values ​​of the number of spots for IFN-γ were 755, 964.5, 820, 1084.5, and 10.5, respectively.

[0063] The absolute values ​​of the number of IL-4 spots were 375, 634, 435.5, 695, and 12.5, respectively.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant tuberculosis strain, characterized in that, The nucleotide sequence of the strain shown in SEQ ID NO.1 was replaced with the nucleotide sequence shown in SEQ ID NO.

2.

2. The method for preparing the recombinant tuberculosis strain according to claim 1, characterized in that, The nucleotide sequence of Mycobacterium tuberculosis, as shown in SEQ ID NO.7, was replaced with the nucleotide sequence of Mycobacterium tuberculosis, as shown in SEQ ID NO.8, using genetic engineering techniques.

3. The use of the recombinant tuberculosis strain according to claim 1 in the preparation of a vaccine.

4. A vaccine, characterized in that, Prepared from the recombinant tuberculosis strain described in claim 1, preferably a live attenuated vaccine.

5. The method for preparing the vaccine according to claim 4, characterized in that, Includes the following steps: (1) Resuscitation and culture of strains: Take one strain, thaw it quickly in a 37°C water bath, inoculate it onto Sutong potato slant medium, and incubate it at 37°C for 3-4 weeks; (2) Harvesting: After the bacteria have matured, collect the bacterial film or bacterial blocks from the surface or inside of the culture medium; (3) Physical treatment: Disperse the bacterial blocks by grinding or dilution to form a uniform bacterial suspension; (4) Dilution and dispensing: Dilute with phosphate buffer and dispense into a 0.5 mg / ml bacterial suspension to obtain the live attenuated vaccine.

6. The preparation method according to claim 5, characterized in that, The viable bacteria concentration in the diluted and dispensed bacterial suspension should be no less than 1.0 × 10⁻⁶. 7 CFU / mg.

7. The use of the preparation method according to any one of claims 5 or 6 in the preparation of drugs for the prevention and treatment of tuberculosis; The drug is a vaccine, preferably a live attenuated vaccine.

8. The application according to claim 7, characterized in that, The vaccine in this application is administered via subcutaneous injection or orally.

Images