Functional molecular marker of wheat TaUFD1-3B gene and application of functional molecular marker
By developing functional molecular markers for the wheat TaUFD1-3B gene and using KASP marker technology to identify genotypes, the problem of predicting wheat flag leaf length and thousand-grain weight was solved, improving breeding and selection efficiency and promoting the development of high-yielding wheat varieties.
Patent Information
- Application Number
- CN202511457217.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-13
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-13
AI Technical Summary
The effects of natural variations in the wheat TaUFD1-3B gene on wheat flag leaf length and thousand-grain weight, as well as related molecular markers, have not been reported, thus affecting the breeding process for high and stable wheat yields.
Functional molecular markers for the wheat TaUFD1-3B gene were developed. Using KASP marker technology, the genotype of the wheat TaUFD1-3B gene was identified by PCR amplification and fluorescence intensity scanning, and flag leaf length and thousand-grain weight were predicted.
It provides effective molecular markers, improves the efficiency of wheat breeding selection, saves costs, and enables rapid screening of superior alleles to construct new high-yielding wheat varieties.
Smart Images

Figure CN120945117A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to functional molecular markers and their applications, specifically to functional molecular markers of the wheat TaUFD1-3B gene and their application in assisted breeding, belonging to the field of crop selection and breeding technology. Background Technology
[0002] Wheat (Triticum aestivum L.) is a key source of approximately 20% of global calorie intake, and increasing its yield is crucial for ensuring global food security. Ubiquitin fusion degradation protein 1 (UFD1), an important component of the CDC48 complex, mediates the degradation of proteins within chlorophyll via the ubiquitination protease pathway. Previous studies have found that the wheat TaUFD1-3A gene interacts with and is co-expressed with the wheat TaHAL3-7A gene, showing potential for regulating wheat pigment content and yield. However, the effects of natural variations in the wheat TaUFD1-3B gene on wheat flag leaf length and thousand-grain weight, as well as related molecular markers, have not yet been reported. Therefore, identifying and applying functional molecular markers of the wheat TaUFD1-3B gene is of great significance for achieving high and stable wheat yields. Summary of the Invention
[0003] This invention provides a functional molecular marker for the wheat TaUFD1-3B gene and its application in identifying wheat yield traits, aiming to provide effective gene resources and molecular markers for crop genetic improvement.
[0004] To achieve the above objectives, the present invention adopts the following technical solution: A functional molecular marker for the wheat TaUFD1-3B gene, located on wheat chromosome 3B, with a genomic sequence as shown in SEQ ID NO: 1 and a CDS sequence as shown in SEQ ID NO: 2. The promoter region contains 19 SNP variations, and the gene region contains 52 SNP variations and 5 InDel variations, exhibiting complete co-segregation. The functional molecular marker is a KASP marker targeting the SNP 40 site variation, where the allelic variation bases at SNP 40 are A / G. This KASP marker can be amplified using one forward primer shown in SEQ ID NO: 3 and two reverse primers shown in SEQ ID NO: 4 and SEQ ID NO: 5. The nucleotide sequence of the molecular marker for the GG genotype is shown in SEQ ID NO: 6, and the nucleotide sequence of the molecular marker for the AA genotype is shown in SEQ ID NO: 7.
[0005] The method for predicting wheat flag leaf length and thousand-grain weight using the aforementioned functional molecular markers of the wheat TaUFD1-3B gene includes the following steps: (1) Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using one forward primer shown in SEQ ID NO:3 and two reverse primers shown in SEQ ID NO:4 and SEQ ID NO:5; (2) Determine the genotype of the wheat TaUFD1-3B gene based on the molecular markers obtained by PCR amplification; (3) Based on the genotype of wheat TaUFD1-3B gene, the flag leaf length and thousand-grain weight of wheat were predicted. Specifically, the GG genotype had a shorter flag leaf length and a heavier thousand-grain weight than the AA genotype.
[0006] The advantages of this invention are: (1) This invention develops a new KASP marker, which is derived from the natural variation analysis of the TaUFD1-3B gene in a natural wheat population. It provides an effective molecular marker for the genetic improvement of wheat yield traits (flag leaf length, thousand-grain weight) and can accelerate the breeding process. (2) By applying the KASP marker developed in this invention, it is possible to determine whether the wheat variety to be tested contains the superior allele of the wheat TaUFD1-3B gene, thereby predicting the flag leaf length and thousand-grain weight of wheat. This not only saves costs but also greatly improves selection efficiency, providing an auxiliary breeding technology for efficiently screening the superior allele of the wheat TaUFD1-3B gene and constructing new high-yield wheat varieties. Attached Figure Description
[0007] Figure 1 This is a diagram showing the SNP variant sites and haplotype typing results of the wheat TaUFD1-3B gene; Figure 2 This is the detection result of the KASP-labeled microplate reader developed in this invention for typing. Figure 3 This is a graph showing the association between haplotypes of the wheat TaUFD1-3B gene and wheat flag leaf length. ** indicates P < 0.01. Figure 4 This is a graph showing the association between haplotypes of the wheat TaUFD1-3B gene and wheat thousand-grain weight. ** indicates P < 0.01. Detailed Implementation
[0008] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.
[0009] I. Obtaining the polymorphic sites and haplotypes of the wheat TaUFD1-3B gene 1. Obtaining the polymorphic sites of the wheat TaUFD1-3B gene Based on the genome resequencing data of 140 genetically diverse hexaploid wheat materials obtained in the previous period, the sequence of the wheat TaUFD1-3B genome (2K promoter region + gene region) was retrieved from the Chinese spring wheat reference genome sequence RefSeq v2.1 (SEQ ID NO: 1), of which the CDS sequence of the wheat TaUFD1-3B gene is shown in SEQ ID NO: 2.
[0010] Comparative analysis showed that the wheat TaUFD1-3B genome contained 71 SNP variations and 5 InDel variations, including 19 SNP variations in the promoter region and 52 SNP variations and 5 InDel variations in the gene region, exhibiting complete co-segregation.
[0011] 2. Obtaining haplotypes of the wheat TaUFD1-3B gene Based on the variation types of the wheat TaUFD1-3B gene, two haplotypes were detected: TaUFD1-3B-Hapl Ⅰ and TaUFD1-3B-Hapl Ⅱ, as shown below. Figure 1 As shown.
[0012] II. Development of molecular markers for the wheat TaUFD1-3B gene Specific primers were designed for the SNP 40 site variation (allelic variation bases are A / G) using the KASP primer design tool (http: / / 202.194.139.32 / snprimer / ).
[0013] The designed specific primers consist of one forward primer (KASP-SNP40-F) and two reverse primers (KASP-SNP40-R1 and KASP-SNP40-R2). The nucleotide sequences of each primer are as follows: KASP-SNP40-F: CAATACTGTCACGGTACATGAAAATA (SEQ ID NO: 3); KASP-SNP40-R1: GAAGGTGACCAAGTTCATGCTCAACCTTAGGAACCGTACTGAC (SEQ ID NO: 4); KASP-SNP40-R2: GAAGGTCGGAGTCAACGGATTCAACCTTAGGAACCGTACTGAT (SEQ ID NO: 5).
[0014] The nucleotide sequence of the molecular marker for the GG genotype is shown in SEQ ID NO: 6, and the nucleotide sequence of the molecular marker for the AA genotype is shown in SEQ ID NO: 7.
[0015] III. Identification of the genotype at SNP 40 of the wheat TaUFD1-3B gene DNA from a total of 239 wheat natural population materials listed in Tables 1-1, 1-2, 1-3, 1-4, 1-5, and 1-6 was amplified by PCR using the primers KASP-SNP40-F, KASP-SNP40-R1, and KASP-SNP40-R2. The specific PCR reaction system and amplification procedure are as follows: (1) The PCR reaction system was 1.622 μL, specifically consisting of: 0.8 μL DNA template (30 ng / μL), 0.8 μL 2×KASPMaster Mix (Laboratory of the Government Chemist, KBS-1050-201), and 0.022 μL KASPAssay Mix. The KASP Assay Mix was prepared as follows: 30 μL of 100 μM KAPS-SNP40-F, 12 μL of 100 μM fluorescently labeled KAPS-SNP40-R1, 12 μL of 100 μM fluorescently labeled KAPS-SNP40-R2, and 46 μL ddH2O were mixed thoroughly. (2) The amplification program is as follows: 95℃ thermal activation for 15 min; 95℃ denaturation for 20 s, 65-55℃ annealing for 60 s, 10 cycles, each cycle decreasing by 1℃; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, 30 cycles; 95℃ denaturation for 5 min; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, 5 cycles.
[0016] The fluorescence intensity of PCR amplification products was detected using a high-throughput scanner, and genotyping was performed using SNPviewer software, as detailed below: If the fluorescence signal of the PCR amplification product of the wheat to be tested is red, then the genotype of the wheat TaUFD1-3B gene at SNP40 is GG, the haplotype is TaUFD1-3B-Hapl I, and the nucleotide sequence of the corresponding PCR amplification product is shown in SEQ ID NO: 6. If the fluorescence signal of the PCR amplification product of the wheat to be tested is blue, then the genotype of the wheat TaUFD1-3B gene at SNP40 is AA, the haplotype is TaUFD1-3B-Hapl II, and the nucleotide sequence of the corresponding PCR amplification product is shown in SEQ ID NO: 7.
[0017] Haplotype results of the TaUFD1-3B gene in 239 natural wheat populations are shown in Tables 1-1, 1-2, 1-3, 1-4, 1-5, and 1-6. KASP marker fluorescence scanning results for some natural wheat populations are shown in... Figure 2 .
[0018] Table 1-1 Haplotype typing results of TaUFD1-3B genotypes in wheat natural populations 1-30
[0019] Table 1-2 Haplotype typing results of TaUFD1-3B genotypes in wheat natural populations 31-72
[0020] Table 1-3 Haplotype typing results of TaUFD1-3B genotypes in wheat natural populations 73-114
[0021] Table 1-4 Haplotype typing results of TaUFD1-3B genotypes in wheat natural populations 115-156
[0022] Table 1-5 Haplotype typing results of TaUFD1-3B genotypes in wheat natural populations 157-198
[0023] Table 1-6 Haplotype typing results of TaUFD1-3B genotypes in wheat natural populations 199-239
[0024] IV. Association Analysis of Wheat TaUFD1-3B Gene Haplotype and Yield Trait The haplotype classification results of the TaUFD1-3B gene in 239 wheat natural population materials (Tables 1-1, 1-2, 1-3, 1-4, 1-5, and 1-6) were correlated with the phenotypic data of wheat flag leaf length and thousand-grain weight in five environments over two years (2021 Yantai Laishan, 2021 Yantai Zhifu, 2021 Shijiazhuang Luancheng, 2023 Yantai Laishan, and 2023 Yantai Zhifu). The best linear unbiased estimator (BLUE) for wheat flag leaf length and thousand-grain weight in the five environments was calculated using the lme4 package in R.
[0025] Statistical analysis was performed on the data using Excel software, and significance analysis was conducted using Student's t-test. The results of the multi-environmental flag leaf length association analysis of the wheat TaUFD1-3B gene are shown in Table 2 and 3. Figure 3 The results of the thousand-grain weight correlation analysis are shown in Table 3 and Figure 4 .
[0026] Table 2. Results of multi-environmental flag leaf length association analysis of wheat TaUFD1-3B genes
[0027] Note: ** indicates P < 0.01.
[0028] Table 3. Results of multi-environmental thousand-grain weight association analysis of wheat TaUFD1-3B gene
[0029] Note: ** indicates P < 0.01.
[0030] Association analysis showed that compared with the TaUFD1-3B-Hapl II type (the genotype of the TaUFD1-3B gene at SNP 40 is AA), the TaUFD1-3B-Hapl I type (the genotype of the TaUFD1-3B gene at SNP 40 is GG) had a significantly lower flag leaf length of 5.29-11.46% (the shorter flag leaf length can reduce organic matter consumption, thereby increasing organic matter accumulation and thus increasing yield), and a significantly higher thousand-grain weight of 4.98-10.04%.
[0031] The above results indicate that the two haplotypes of the wheat TaUFD1-3B gene are significantly associated with flag leaf length and thousand-grain weight. Considering both flag leaf length and thousand-grain weight, wheat of the TaUFD1-3B-Hapl I type has a higher yield per plant. The TaUFD1-3B-Hapl I type is a superior haplotype of the wheat TaUFD1-3B gene and has potential value in the breeding of high-yielding varieties.
[0032] The KASP marker developed in this invention targeting the SNP 40 site of the wheat TaUFD1-3B gene can be used to identify the flag leaf length and thousand-grain weight of wheat, and has certain breeding application potential.
[0033] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.
Claims
1. A functional molecular marker for the wheat TaUFD1-3B gene, characterized in that, The wheat TaUFD1-3B gene is located on wheat chromosome 3B, and its genome sequence is shown in SEQ ID NO:
1. The CDS sequence is shown in SEQ ID NO:
2. There are 19 SNP variations in the promoter region and 52 SNP variations and 5 InDel variations in the gene region, showing complete co-segregation. The functional molecular marker is a KASP marker targeting the SNP 40 site variation, with the allelic variation bases at SNP 40 being A / G. This KASP marker can be amplified by one forward primer shown in SEQ ID NO: 3 and two reverse primers shown in SEQ ID NO: 4 and SEQ ID NO:
5. The nucleotide sequence of the molecular marker for the GG genotype is shown in SEQ ID NO: 6, and the nucleotide sequence of the molecular marker for the AA genotype is shown in SEQ ID NO:
7.
2. A method for predicting wheat flag leaf length and thousand-grain weight using the functional molecular marker of the wheat TaUFD1-3B gene as described in claim 1, characterized in that, Includes the following steps: (1) Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using one forward primer shown in SEQ ID NO:3 and two reverse primers shown in SEQ ID NO:4 and SEQ ID NO:5; (2) Determine the genotype of the wheat TaUFD1-3B gene based on the molecular markers obtained by PCR amplification; (3) Based on the genotype of wheat TaUFD1-3B gene, the flag leaf length and thousand-grain weight of wheat were predicted. Specifically, the GG genotype had a shorter flag leaf length and a heavier thousand-grain weight than the AA genotype.
Citation Information
Patent Citations
Wheat grain weight related gene TaSINA101 molecular marker and application thereof
CN117778616A
Molecular marker of wheat TaCHLI-7A gene and application of molecular marker
CN118086576A
KASP molecular marker for detecting character genes of grain length and thousand grain weight of wheat grains and application of KASP molecular marker
CN119842972A
Wheat quality gene TaSF3B4 and application of molecular marker thereof
CN120099205A
Gene underlying the number of spikelets per spike qtl in wheat on chromosome 7a
IN202027029829A