Toxoplasma gondii Me49 BFD2 PDX1 strain as well as construction method and application thereof

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses a toxoplasma gondii Me49 BFD2 PDX1 strain as well as a construction method and application thereof, and the toxoplasma gondii Me49 BFD2 PDX1 strain is obtained by knocking out a PDX1 gene in a Me49 BFD2 strain through a gene editing means. The toxoplasma gondii Me49 BFD2 PDX1 strain tachyzoite provided by the invention is used for inhibiting the growth of tumor cells and reducing the volume and the mass of tumors after being inactivated.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a Toxoplasma gondii Me49△BFD2△PDX1 strain and a construction method and application thereof. BACKGROUND

[0002] Glioma is the most common intracranial primary malignant tumor, accounting for about 81% of central nervous system malignant tumors, and its morbidity and mortality rank first among malignant tumors. Although the tumor has formed a comprehensive treatment method mainly based on surgical resection, supplemented by temozolomide chemotherapy, radiotherapy, targeted therapy and electric field therapy, etc., the survival prognosis of glioma patients is still not optimistic.

[0003] In recent years, immunotherapy has greatly changed the treatment pattern of tumors, and immune checkpoint inhibitors have become one of the most clear and widely used immunotherapies, in addition to CAR-T therapy, cytokine therapy, tumor vaccine and oncolytic virus therapy, but these have encountered severe challenges in the treatment of glioma. The main reason is that the presence of the blood-brain barrier in the central nervous system prevents most anti-tumor drugs from entering the brain to achieve therapeutic effect; however, more importantly, brain glioma has immunosuppressive characteristics, produces fewer new mutations and new antigens during progression, belongs to "cold tumor", and has strong heterogeneity of intratumoral genetics, thus resisting non-discriminatory radiotherapy and chemotherapy and drugs, resulting in lower benefit of immunotherapy in brain glioma patients than in other tumors. Therefore, it is of great significance to develop a product that can be used to prepare a drug for treating glioma. SUMMARY

[0004] In order to develop a product that can be used to prepare a drug for treating glioma, the present application provides a Toxoplasma gondii Me49△BFD2△PDX1 strain and a construction method and application thereof. The Toxoplasma gondii Me49△BFD2△PDX1 strain provided by the present application is used to inhibit tumor cell growth and reduce tumor volume and mass after tachyzoite inactivation.

[0005] The present application provides a Toxoplasma gondii Me49△BFD2△PDX1 strain, which is obtained by knocking out the PDX1 gene in the Me49△BFD2 strain through gene editing means.

[0006] The Toxoplasma gondii Me49△BFD2△PDX1 strain provided by the present application is used to inhibit tumor cell growth and reduce tumor volume and mass after tachyzoite inactivation.

[0007] The present application also provides a construction method of the Toxoplasma gondii Me49△BFD2△PDX1 strain, comprising the following steps: constructing a PDX1 knockout plasmid; Amplification of HXGPRT resistance fragment: using pminCAT / HXGPRT+ vector as a template, using the upstream primer shown in SEQ ID NO. 5 and the downstream primer shown in SEQ ID NO. 6 to amplify, and obtaining the HXGPRT resistance fragment; After mixing the PDX1 knockout plasmid with the HXGPRT resistance fragment, incubating, adding the Toxoplasma Me49△BFD2 tachyzoite suspension, mixing, and then performing electroporation, collecting the electroporation product, and co-culturing with HFF cells, the escaped worm strain is screened and purified, inoculated in the HFF cells that are well grown and in good condition, and then passaged to obtain the Me49△BFD2△PDX1 worm strain.

[0008] The application further provides a use of the Toxoplasma Me49△BFD2△PDX1 worm strain in the preparation of a drug for treating glioma.

[0009] Further, the drug is used for reducing the tumor mass and reducing the tumor volume.

[0010] Further, the drug takes the inactivated Toxoplasma Me49△BFD2△PDX1 worm strain tachyzoite as the only effective component.

[0011] In the mammalian body, the Toxoplasma Me49△BFD2△PDX1 worm strain cannot replicate and becomes safe and non-toxic, is easy to control, but can effectively activate the immune cell group in the brain glioma tumor microenvironment, realizes the conversion of the "cold tumor" into the "hot tumor", and thus realizes the anti-brain glioma purpose through the body immune system.

[0012] Compared with the prior art, the application has the beneficial effects that: The Toxoplasma Me49△BFD2△PDX1 worm strain is constructed by the gene editing technology, cannot replicate in the body, becomes non-toxic, and through intratumoral injection, it is found that the Toxoplasma not only can inhibit the growth of tumor cells, but also has the potential to eliminate tumors; in addition, in the orthotopic model, it is found that the Toxoplasma can also significantly inhibit the growth of glioma through intraperitoneal injection. The Toxoplasma Me49△BFD2△PDX1 worm strain exerts the anti-brain glioma effect because the tumor microenvironment is changed, the local immunity develops into the systemic immunity, and the body anti-tumor immune system is activated. BRIEF DESCRIPTION OF DRAWINGS

[0013] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only some embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0014] Figure 1PCR identification results of ME49 ABFD2 APDX1 (referred to as: ME49 DK) strain.

[0015] Figure 2 Safety verification of ME49 DK bradyzoite infection; A, survival curves of mice injected intraperitoneally with 5x10^6 WT ME49 bradyzoites or ME49 DK bradyzoites (n=5 per group); B, body weight change curves of mice injected intraperitoneally with 5x10^6 WT ME49 bradyzoites or ME49 DK bradyzoites (n=5 per group).

[0016] Figure 3 PCR identification of B1 gene.

[0017] Figure 4 Effects of ME49 DK strain infection on liver and kidney of mice.

[0018] Figure 5 Anti-tumor effect of Me49 DK in a mouse model of subcutaneous glioblastoma; A, schematic diagram of treatment schedule and time arrangement of GL261-luc glioblastoma mice inoculated subcutaneously; B, body weight changes of mice injected intraperitoneally with different doses (1x10^6, 2x10^6, 4x10^6, 8x10^6) of ME49 DK and PBS-treated mice (n=5 mice per group); C, representative tumors of mice injected intraperitoneally with different doses (1x10^6, 2x10^6, 4x10^6, 8x10^6) of ME49 DK and PBS-treated mice after 21 days of treatment; D, statistical histogram of representative tumor weights of mice injected intraperitoneally with different doses (1x10^6, 2x10^6, 4x10^6, 8x10^6) of ME49 DK and PBS-treated mice after 21 days of treatment; E, observation of tumor growth at 0, 7, 14 and 21 days of treatment using a small animal fluorescence microscopic imaging system; F, quantitative analysis of GL261-Luc tumor fluorescence values using region of interest (ROI) technology.

[0019] Figure 6 Effects of ME49 DK strain on glioblastoma; A, growth of GL261 glioblastoma in the right lumbar abdomen of mice pre-infected with ME49 DK bradyzoites for 30 days and uninfected blank mice; B, sizes of GL261 glioblastoma and spleen in the right lumbar abdomen of mice treated with PBS, ME49 DK and ME49 DK-UV for 2 weeks, respectively; C, weight histogram of GL261 glioblastoma shown in B.

[0020] Figure 7Evaluation of the peripheral immune environment in mice; in the figure, A is a representative chart of flow cytometry detection of CD3 T cells, CD8+ T cells, macrophages and dendritic cells (DCs) in the spleen after PBS or ME49 DK tachyzoite treatment; B is the percentage of CD3 T cells, CD8+ T cells, macrophages and DCs in the spleen after PBS or ME49 DK tachyzoite treatment detected by flow cytometry.

[0021] Figure 8 Immune memory effect after ME49 DK tachyzoite treatment; in the figure, A is a schematic diagram of the experimental process of re-challenging cured mice with GL261-LUC glioma; B shows the re-implantation site (left waist abdomen) in the control group and Me49DK--CR group and the tumor cure site (right waist abdomen) in the Me49DK--CR group by small animal live imaging monitoring of tumor growth.

[0022] Figure 9 Anti-tumor effect of Me49 DK in intracranial glioma mouse models; in the figure, A is a schematic diagram of the treatment scheme and time schedule of intracranial GL261-luc glioma inoculation mice; B is the survival of intracranial tumor-bearing mice after treatment with ME49 DK tachyzoite (4×10^6 / 100ul) or PBS / 100ul (control) (n=12 per group); C is a representative intracranial tumor growth after PBS or ME49 DK tachyzoite treatment on days 0, 7, 14 and 21 observed by small animal fluorescence microscopic imaging system; D is the quantitative analysis of GL261-Luc tumor fluorescence value using region of interest (ROI) technology; E is a representative image of CD31 and Ki67 staining of tumor-bearing brain tissue after 14 days of ME49 DK tachyzoite or PBS treatment; F is the immunohistochemical analysis of glioma malignant markers CD31 and Ki67, and the corresponding OD value statistical analysis.

[0023] Figure 10 Effect of Toxoplasma ME49 DK strain treatment on the immune environment in tumors; in the figure, A is an example diagram of flow cytometry gating logic of intratumoral immune cells; B is the expression of CD45+ cells, CD3 T cells, CD4+ T cells, CD8+ T cells, macrophages, dendritic cells (DCs), NK cells and natural killer T cells (NKT) in the tumor after PBS treatment or ME49 DK tachyzoite treatment.

[0024] Figure 11Detection of tumor-associated immunosuppression-related cells; in the figure, A is the flow cytometry analysis of the number and proportion of Arg1-expressing macrophages in the tumor after ME49 DK tachyzoite treatment; B is a statistical chart of A; C is the number and proportion of CD86-expressing microglia in the tumor after Me49 DK treatment; D is a statistical chart of the fluorescence expression in figure B. DETAILED DESCRIPTION

[0025] The specific embodiments of the present application are described in detail below, but it should be understood that the scope of protection of the present application is not limited by the specific embodiments. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application. The experimental methods described in the embodiments of the present application are conventional methods, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0026] Example 1: A Toxoplasma gondii Me49△BFD2△PDX1 strain and a method for constructing the same.

[0027] I. Experimental methods 1. Experimental materials Vector: pSAG1::Cas9-U6::SgUPRT vector was preserved by the Parasitic Disease Research Lab of Ningbo University, and pminCAT / HXGPRT+ was given by Professor Long Shaogong of Sun Yat-sen University. HFF cells containing Toxoplasma gondii Me49△BFD2 tachyzoites, Toxoplasma gondii type II ME49 strain were preserved by the Parasitic Disease Research Lab of Ningbo University; Me49△BFD2 and Me49△PDX1 strains were preserved by the Parasitic Disease Research Lab of Ningbo University. The Me49△BFD2 strain and the method for constructing the same are disclosed in the journal with doi number: 10.1038 / s41564-023-01358-2. The Me49△PDX1 strain and the method for constructing the same are disclosed in the journal with doi number: 10.1016 / j.chom.2020.01.002.

[0028] 2. Construction of Toxoplasma gondii Me49△BFD2△PDX1 strain (1) Construction of PDX1 knockout plasmid PDX1-SgRNA was designed based on PDX1 gene sequence (Gene ID: TGME49_297080) as shown in SEQ ID NO. 1. The SgRNA of PDX1 was replaced with the SgRNA of UPRT in the original template plasmid by amplification with the upstream primer SgPDX1 as shown in SEQ ID NO. 2 and the downstream primer gRNA-R as shown in SEQ ID NO. 3 using the pSAG1::Cas9-U6::SgUPRT plasmid as a template and collecting the PCR amplification product. The PCR reaction system and procedure are shown in Table 1 and Table 2.

[0029] SEQ ID NO. 1: GTCGTCAACTTCGCTGCCGG.

[0030] SEQ ID NO. 2: 5'-GTCGTCAACTTCGCTGCCGGGTTTTAGAGCTAGAAATAGC-3'.

[0031] SEQ ID NO. 3: 5'-AACTTGACATCCCCATTTAC-3'.

[0032] The PCR amplification product was digested with DpnI enzyme overnight and circularized with KLD enzyme. 10 μL of the circularization product was immediately mixed with 50 μL of thawed DH5α chemically competent cells, and then spread on LB agar plates containing ampicillin (Amp+). After 30 min of upright incubation, the plates were inverted and incubated at 37°C overnight. When 2 mm single colonies were formed, 8 colonies were randomly picked and inoculated into Amp+ LB liquid medium, and incubated at 37°C, 220 rpm for 6 h. 1 μL of the bacterial solution was used as a template for colony PCR screening. The PCR reaction system and procedure are shown in Table 3 and Table 4. The upstream primer sequence is shown in SEQ ID NO. 1, and the downstream primer JD-gRNA-R sequence is shown in SEQ ID NO. 4. The target band of 420 bp was determined as positive. The positive bacterial solution was sent to a company for sequencing. After confirming that the sequence and reading frame were correct, high-purity plasmid was extracted, labeled as PDX1-sgRNA plasmid, and stored at -20°C in the dark after aliquoting, which was used for subsequent transfection and CRISPR editing experiments.

[0033] SEQ ID NO. 4: 5'-CGGACAGGTATCCGGTAAG-3'.

[0034] (2) Amplification of HXGPRT resistant fragment PCR amplification was performed using pminCAT / HXGPRT+ vector as template, PDX1-HR1 primer shown in SEQ ID NO. 5 and PDX1-HR2 primer shown in SEQ ID NO. 6. The reaction system and procedure were shown in Table 5 and Table 6. The product was collected to get HXGPRT resistant fragment, which can also be called PDX1-HXGPRT1 / 2 homologous fragment.

[0035] SEQ ID NO. 5: ATACACCCTGTGCGGTGTCTGCGTACGCGCCAGAGGTCGCTTACTCGAGGGTCGACGGT.

[0036] SEQ ID NO. 6: CTCTCGGAGTGACTCAAACGATGGAAGACGAGAGGGCTGACCGAATTGGAGCTCCACC.

[0037] (3) Construction and screening of PDX1 deletion strain (Toxoplasma Me49 ABFD2 APDX1 strain) Collection and purification of Toxoplasma Me49 ABFD2 tachyzoites: The HFF cells containing Toxoplasma ME49ABFD2 tachyzoites in T25 cell culture flask were scraped with cell scraper and mixed with escaped tachyzoites in culture medium (DMEM medium containing 100 μg / mL penicillin, 100 μg / mL streptomycin, 10 mM HEPES solution and 10% fetal bovine serum). The mixed liquid was sucked into a 1 mL syringe and injected into a 15 mL centrifuge tube, which was centrifuged at 2700 rpm for 10 min. The supernatant after centrifugation was sucked into a 1 mL syringe and filtered into a new 15 mL centrifuge tube using a 3 μm filter. After centrifugation at 800 rpm for 10 min, the supernatant was discarded, 5 mL of 37℃ preheated Cytomix Buffer was added for resuspension and centrifugation, the supernatant was discarded after centrifugation, and the tachyzoite pellet was resuspended with 300 μL of Cytomix Buffer to obtain Toxoplasma ME49ABFD2 tachyzoite suspension.

[0038] Electroporation of T. gondii tachyzoites: 35 μΐ of purified PDX1-sgRNA plasmid was gently mixed with 30 μΐ of PDX1-HXGPRT1 / 2 homology fragment (HXGPRT resistance fragment) gel recovery product, and the mixture was incubated in a 60 °C constant temperature water bath for 30 min to inactivate potential DNase and exogenous microbial contamination. Then 224 μΐ of purified extracted T. gondii Me49 ABFD2 tachyzoite suspension was added to the sterilized mixture, and gently blown to mix slowly, and then transferred to a 4 mm thick electroporation cuvette for electroporation. The above operation should be handled carefully, and the electroporation parameters were set as follows: voltage 1700 V, pulse length 176 us, 2 times of electric shock, pulse interval 100 ms. Finally, the electroporation product was transferred to a T25 culture bottle of HFF cells which were well grown and in good condition, and gently shaken, and placed in a incubator with the conditions of 37 °C, 5 % CO2 for culture.

[0039] Drug screening: about 24 h after electroporation, the early bug spots were monitored to determine whether a large number of bug spots appeared after electroporation, indicating that the tachyzoite had completed the first round of lysis cycle. At this time, the selective medium was replaced, which was DMEM medium containing 25 μg / mL xanthine and 50 μg / mL mycophenolic acid, and the serum concentration was 2 %. Then continue to culture under the same incubator conditions, and observe daily. Under the MPA / XA double drug selection pressure, the tachyzoite carrying PDX1-HGPRT knock-in cassette and successfully integrated can bypass the purine salvage pathway inhibition and continue to proliferate, while the wild type tachyzoite is gradually eliminated. Extract and purify the escaped tachyzoite under drug screening, and pass it in HFF cells which are well grown and in good condition. After 3 times of continuous passage, the Me49 ABFD2 APDX1 tachyzoite strain was obtained, which was abbreviated as ME49 DK strain.

[0040] Screening and identification of monoclonal strains: After 3 rounds of screening with mycophenolic acid / xanthine (MPA / XA) continuous drug, the mixed strains were filtered through a 3 μm filter membrane and centrifuged for purification. After accurate counting with a blood cell counting plate, the strains were diluted with pre-warmed 2% FBS DMEM to a final concentration of 10, 5, 2 and 1 tachyzoites / 100 μL, respectively, and inoculated uniformly into 96-well plates at 100 μL / well. Within 10 days after inoculation, the plates were kept at 37°C, 5% CO2 and avoided any movement until single independent patches were observed. Wells containing only one patch were picked, and the tachyzoites were collected and the DNA was extracted as a template. Three pairs of specific primers were designed according to the PDX1 genomic sequence, as shown in Table 7, in which PCR1 and PCR3 detected the correct integration of the 5' and 3' homologous arms, respectively, and PCR2 corresponded to the wild-type site. The reaction system and amplification program are shown in Tables 8 and 9, respectively. The Me49ABFD2 parent strain was used as a negative control, and only when both PCR1 and PCR3 showed the expected bands and PCR2 showed no band, the monoclonal strain was determined to be positive. The positive clone was transferred to a 25 cm2 culture flask for expansion, and when the tachyzoites were 90% lysed, the Me49ABFD2APDX1 strain tachyzoites were collected and stored in liquid nitrogen for use.

[0041] II. Experimental results 1. Identification of Me49ABFD2APDX1 strain To obtain a stable PDX1 gene knockout Toxoplasma, the constructed pSAG1::Cas9-U6::SgPDX1 plasmid was co-transfected with the HXGPRT resistance fragment into Me49ABFD2 tachyzoites. After 3 rounds of drug pressure screening with 50 μg / mL MPA and 25 μg / mL XA and monoclonal selection, the DNA was extracted and PCR level identification was performed using a three-segment PCR strategy: PCR2 (PDX1 endogenous site specific primers) was used to detect the wild-type allele; PCR1 and PCR3 (located outside the 5' and 3' homologous arms, respectively) were used to detect whether the HXGPRT fragment was successfully integrated.

[0042] The results are shown in Figure 1As shown, all the candidate deletion strains had no band in PCR2, indicating that the intermediate sequence of PDX1 was completely replaced by the HXGPRT fragment; while the background strain Me49ABFD2 clearly presented a 600 bp band in PCR2. At the same time, the deletion strains appeared 250-300 bp specific bands in PCR1 and PCR3, while the background strain did not detect any product. In combination with the results of three PCR, it can be confirmed that the PDX1 site has been precisely knocked out, and the Me49ABFD2APDX1 double deletion strain has been successfully obtained, which can be used for subsequent functional studies.

[0043] Example 2: Safety test of Toxoplasma gondii Me49APDX1A strain.

[0044] I. Experimental methods 1. Experimental materials Experimental animals and cells: 6-8 week-old SPF female C57 / 6N mice were purchased from Beijing VitoLihua Experimental Animal Technology Co., Ltd. To reduce the stress response of mice, they were adaptively fed for one week before the experiment. Vero cells were preserved by Ningbo University Parasite Research Room. Wild-type ME49 strain was preserved by Ningbo University Parasite Research Room.

[0045] 2. Resuscitation and culture of cells and strains The African green monkey kidney cells Vero were taken out from liquid nitrogen, and then quickly shaken to thaw in a constant temperature water bath at 37°C. After thawing, it was transferred to a sterile clean bench for operation, and the thawed cell suspension was added to a 15 mL centrifuge tube containing 5 mL high-sugar DMEM medium. Then centrifuged at 800 rpm for 5 min, the supernatant was discarded in the clean bench, and 1 mL of high-sugar DMEM complete medium containing 10% FBS and 1% double antibody was added. After resuspension by gently blowing with a pipette gun, it was transferred to a T25 cell culture bottle, and then 4 mL of 10% FBS complete medium was added and blown evenly. Then put it in a 37°C, 5% CO2 cell culture box for culture.

[0046] The wild-type ME49 strain and ME49 DK strain were taken out from liquid nitrogen, and then quickly shaken to thaw in a constant temperature water bath at 37°C to obtain the above two strain suspensions. After thawing, it was transferred to a sterile clean bench for operation, and the thawed strain suspension was added to a 15 mL centrifuge tube containing 5 mL high-sugar DMEM medium. Then centrifuged at 3000 rpm for 10 min, the supernatant was discarded in the clean bench, and 1 mL of high-sugar DMEM complete medium containing 1% FBS and 1% double antibody was added. After resuspension by gently blowing with a pipette gun, it was transferred to a T25 cell culture bottle of Vero cells in exponential growth, and then 4 mL of 1% FBS complete medium was added and blown evenly. Then put it in a 37°C, 5% CO2 cell culture box for culture.

[0047] 3. Cell and tachyzoite passaging When Vero cells grow to 90% density, remove the cells from the incubator. Discard the culture medium in a sterile clean bench, wash twice with PBS, then add 1 mL trypsin. Then place in the cell incubator for 2 min of digestion. When the cell gap is observed under the microscope, the shape is round, and most of the cells are detached when the bottle wall is tapped, add 2 mL of 10% FBS complete medium to stop digestion. Use a pipette to repeatedly blow the bottle wall to completely detach the cells, then transfer them to a 15 mL centrifuge tube. After centrifugation at 800 rpm for 5 minutes, discard the supernatant and resuspend the precipitate with 1 mL of 10% FBS complete medium. Passage at a ratio of 1:2 to a new T25 cell culture bottle. Add an appropriate amount of medium to 5 mL, mix evenly by shaking horizontally, and then place in a 37°C, 5% CO2 incubator. Observe the state of adhesion and proliferation after 24 hours.

[0048] When the T25 cell culture bottle is about 80% of the Toxoplasma tachyzoite escaping from the Vero cells, use a pipette to repeatedly blow to suspend the worms, then use a 1 mL syringe needle to aspirate the worm suspension and transfer it to a 15 mL centrifuge tube. After centrifugation at 800 rpm for 5 min, all the supernatant is again aspirated with a 1 mL syringe needle, filtered and purified through a 3.0 μm filter, and the purified tachyzoite precipitate is obtained after centrifugation at 3000 rpm for 10 min. After resuspending the purified tachyzoite precipitate with 1 mL of 1% FBS complete medium, plant it according to the experimental requirements into a new T25 cell culture bottle of Vero cells in the exponential growth phase.

[0049] When the cells are in the exponential growth phase and the density is about 90%, remove them from the incubator. Operate in a sterile clean bench. Discard the culture medium, wash twice with PBS, then add trypsin to the cell culture incubator for 2 min of digestion. Observe the digestion under the microscope, add 2 mL of complete medium to stop after digestion is complete. After gently blowing, collect all the cell suspension into a 15 mL centrifuge tube. 800 rpm, 5 min. After discarding the supernatant, resuspend the precipitate with 1 mL of cell freezing solution, then transfer it to a freezing tube, and after gradient cooling, place it in a -80°C refrigerator overnight, and transfer it to liquid nitrogen for long-term storage the next day.

[0050] When the T25 cell culture bottle is about 80% of the Toxoplasma tachyzoite escaping from the Vero cells, use a pipette to repeatedly blow to suspend the worms, then use a 1 mL syringe needle to aspirate the worm suspension and transfer it to a 15 mL centrifuge tube. 3000 rpm, centrifugation for 10 min, discard the supernatant and resuspend the precipitate with 1 mL of cell freezing solution, then transfer it to a freezing tube, and after gradient cooling, place it in a -80°C refrigerator overnight, and transfer it to liquid nitrogen for long-term storage the next day.

[0051] 4. Safety verification of Toxoplasma Me49△BFD2△PDX1 tachyzoite (1) Infection of mice with the strain C57 / 6N mice were infected with the purified wild type ME49 strain and the Me49 ABFD2 APDX1 strain by intraperitoneal injection, i.e. 5 x 10 6 The mice were observed daily and the time of death was recorded.

[0052] (2) Extraction of total RNA from tissues After the mice were sacrificed by decapitation, the brain tissue was removed under sterile conditions, cut into pieces with an ophthalmic scissors, and then ground into a homogenate using a tissue homogenizer. The total RNA was extracted according to the conventional extraction method. The extracted RNA was synthesized into cDNA by reverse transcription.

[0053] (3) Extraction of strain DNA The mouse ascites was obtained by injecting 5 mL of physiological saline into the abdominal cavity of the mouse and repeatedly washing 3 times. The precipitate was resuspended with a genomic DNA extraction reagent (DNAiso Reagent) and shaken up and down for 10 min. Then, it was centrifuged at 5000 rpm for 5 min, the supernatant was discarded, anhydrous ethanol was added for further reaction for 3 min, and the process was continuously shaken. After the reaction was completed, it was centrifuged at 5000 rpm for 5 min, the supernatant was discarded, 75% ethanol was added for reaction for 3 min, and the process was repeated twice. Subsequently, after the alcohol was completely evaporated, TE buffer was added and vortexed until the precipitate was completely dissolved, and finally it was water-bathed at 80°C for 20 min. The concentration and A260 / A280 ratio of the DNA were measured by the Nano drop method, and the concentration was reliable when the ratio was between 1.8 and 2.0. After the detection, it was stored in a freezer at -80°C.

[0054] (4) Identification by semi-nested PCR B1 Genes Primers were designed based on the specific genes of Toxoplasma B1 The primers included B1-F1 as shown in SEQ ID NO. 7, B1-F2 as shown in SEQ ID NO. 8, and B1-R1 as shown in SEQ ID NO. 9.

[0055] SEQ ID NO. 7: 5'-GAACTGCATCCGTTCATGAG-3'; SEQ ID NO. 8: 5'-TGCATAGGTTGCAGTCACTG-3'; SEQ ID NO. 9: 5'-TCTTTAAAGCGTTCGTGGTC-3'.

[0056] The presence of Toxoplasma DNA in mice was detected by semi-nested PCR. The reaction was performed in two rounds. In the first round, B1-F1 and B1-R1 were used as outer primers, the reaction system is shown in Table 10, and the reaction conditions are shown in Table 11. In the second round, B1-F2 and B1-R1 were used as inner primers, the reaction system is shown in Table 12, and the reaction conditions are shown in Table 11.

[0057] After the second round of reaction, the PCR products were electrophoresed in 1.5% TAE (Tris-acetate-EDTA) agarose gel and stained with ethidium bromide solution (1 μg / ml). The theoretical size of the PCR amplification product was 131 bp. B1

[0058] (5) PCR identification Pdx1 and Bfd1 gene According to the genomic sequence, the Pdx1 -inner-F primer shown in SEQ ID NO. 10 and the Pdx1 -inner-R primer shown in SEQ ID NO. 11 were designed; according to the genomic sequence, the Pdx1 -F primer shown in SEQ ID NO. 12 and the Bfd1 -R shown in SEQ ID NO. 13 were designed. Bfd1 Bfd1

[0059] SEQ ID NO. 10: 5'-CGCCTTCATTTGCTTCTTC-3'; SEQ ID NO. 11: 5'-GACCGATGCGACACTTGG-3'; SEQ ID NO. 12: 5'-TCCCACAACGCAAGAGTTG-3'; SEQ ID NO. 13: 5'-TCAACCGGTTCGCTTGCT-3'.

[0060] WT ME49 strain was used as a control. After centrifugal purification of the strain in a T25 culture flask, the strain DNA was extracted as a template by a conventional method, mixed according to the reaction system in Table 13, and amplified according to the reaction conditions in Table 14.

[0061] After the reaction, the PCR products were electrophoresed in 1.5% TAE (Tris-acetate-EDTA) agarose gel and stained with ethidium bromide solution (1 μg / ml). The theoretical size of the PCR amplification product was 131 bp.​​​Bfd1 The theoretical size of the 1035 bp, Pdx1 The theoretical size of the 600 bp. PCR identification of double-knock worm strains needs to meet the following two conditions: the detection of B1 gene band, but no detection of Pdx1 and Bfd1 gene band of the worm strain is a positive double-knock non-toxic worm strain.

[0062] (6) Mouse virulence evaluation Fifteen 6-8 week old SPF female C57 / 6N mice were raised in a pathogen-free animal room one week in advance to avoid experimental errors caused by the stress response of animals. After one week, the mice were randomly divided into two groups, 5 in the control group (without any treatment), and 20 in the experimental group (for Toxoplasma infection). Ten of the experimental group were used for wild-type ME49 strain infection, and ten of the experimental group were used for ME49 DK strain infection. Wild-type ME49 strain and ME49 DK strain were recovered and cultured in Vero cells. Before intraperitoneal treatment, the tachyzoites were filtered and purified using a 3.0 μm filter and washed with PBS. The survival rate and number of wild-type ME49 and ME49 DK tachyzoites were determined using the trypan blue exclusion test and blood cell counter method, respectively. The concentration was adjusted to 5×10^6 per 100 μL. The above concentration of the strain was inoculated into each group (experimental group) of mice at a dose of 100 μL per mouse. During the experiment, the mice were observed daily, and the body weight and death time were recorded. On the 7th day of infection, if the experimental group mice were still alive, the brain tissue was aseptically collected, mechanically cut into pieces, and RNA was extracted using the TRIzol method for diagnostic PCR identification of the presence of ME49 DK strain. After 30 days of infection, the surviving mice were sacrificed, and their brain tissue was aseptically collected to extract RNA for diagnostic PCR identification of the presence of ME49 DK strain.

[0063] (7) Immunohistochemical analysis On the 14th day of treatment, liver and kidney tissues from each group were collected and immersed in 4% paraformaldehyde overnight. The fixed brain tissue was washed with tap water for 20 min, then dehydrated in a dehydration machine with gradient alcohol and immersed in wax. After paraffin embedding, 4-micron-thick sections were prepared. The pathological changes of liver and kidney tissues were evaluated under a microscope. The evaluation was based on the structure of the section, inflammation, and damage, with a score range of 0 to 3. The score range of crypt damage was 0 to 4. Then, the product of the grade of each section and the percentage of involvement was scored separately.

[0064] II. Experimental results 1. Safety verification of Toxoplasma gondii Me49△BFD2△PDX1 strain To verify the safety of the ME49 DK tachyzoite, the purified wild type ME49 tachyzoite and the ME49 DK tachyzoite were used to infect C57 mice through the abdominal cavity, and 5x10^6 wild type ME49 tachyzoites or ME49 DK tachyzoites were inoculated, respectively. The state of the mice was observed and the body weight was recorded every day, and the death time was recorded. The experimental results show that the mice infected with wild type ME49 tachyzoites all died on the 6th day after infection, while the mice infected with ME49 DK tachyzoites were long-term survival (Fig. A). It is found through observation that the control group of mice has messy and dull hair, and often curls, and the body weight shows a downward trend every day. The mice infected with ME49 DK tachyzoites have no obvious behavior abnormalities, and the body weight shows a normal upward trend, and the body weight of the two groups of mice has a significant difference on the fifth day after infection (P<0.001) (Fig. B). Figure 2 Figure 2

[0065] To further verify that the tachyzoite stage proliferation ability of the ME49 DK strain is significantly inhibited in vivo. The present application randomly divides 3 mice from each group 12h and 24h after the mice are infected with wild type ME49 or Me49 DK tachyzoites in the abdominal cavity, and the experimental results of the diagnostic PCR show that all the mice are detected to contain Toxoplasma-specific B1 gene in the ascites. The gene band of the Me49 DK infection group begins to fade at 24h. And at the third day after infection, the gene band of the Me49 DK infection group disappears in 3 mice randomly detected from each group. It is indicated that the Me49 DK tachyzoite has been completely removed in vivo at this stage (Fig. C). Figure 3

[0066] The present application carries out diagnostic PCR detection on the brain of the Me49 DK infection group of mice which still survive on the 7th day after infection and the 30th day of chronic infection. After 3 mice randomly divided from the Me49 DK infection group are sacrificed, the brain tissue is taken out, and the B1 gene amplified in the ascites of the control group is used as a control. The experimental results show that the Toxoplasma-specific gene expression is not detected in the brain of the mice (Fig. D). Figure 3 This highlights that the Me49 DK strain has good biosafety, and performs excellently in maintaining the bradyzoite structure, stable function and reproduction.

[0067] 2. Toxoplasma gondii ME49 DK strain does not affect the normal tissue structure and function of mouse abdominal organs ​​​Ten C57BL / 6N male mice (8 weeks old) were selected and randomly divided into control group (n=5, intraperitoneal injection of 200 μL phosphate buffered saline) and experimental group (n=5, injection of the same volume of suspension containing 5x10^6 Me49 DK tachyzoites), liver and kidney tissues were taken on the 3rd day after infection for H&E staining pathological evaluation. Representative histopathological sections of liver and kidney of mice treated with phosphate buffer (PBS) or 5x10^6 ME49 DK tachyzoites for 1 week. After H&E staining. Observe at 200x magnification. (PBS group: liver: microscopic examination showed extensive moderate hepatocyte edema, manifested as cell swelling and loose cytoplasmic staining (blue arrow), injury score = 2. Kidney: microscopic examination showed mild edema of renal tubules at the junction of cortex and medulla, epithelial cell swelling and loose cytoplasmic staining (blue arrow), injury score = 1. Me49 DK group: kidney: microscopic examination showed rare mild edema of renal tubules at the junction of cortex and medulla, epithelial cell swelling and loose cytoplasmic staining (green arrow), injury score = 1. Liver: rare focal necrosis of hepatocytes within liver lobules was observed under the microscope, accompanied by focal inflammatory cell infiltration (green arrow), injury score = 1).

[0068] Pathological analysis as shown in Figure 4 : The experimental group had only a few inflammatory infiltrates in the liver (score 1), and the kidney occasionally had mild tubular edema (score 1), with no significant difference from the control group. This indicates that treatment with ME49 DK tachyzoites does not affect the normal tissue structure and function of the mouse abdominal organs.

[0069] Example 3: Toxoplasma gondii Me49 ABFD2 APDX1 in vivo against brain glioma cell growth.

[0070] I. Experimental methods 1. Experimental materials SPF grade 6-week-old female C57 / 6N mice were selected and raised in a pathogen-free animal room. The mice were adaptively fed for 1 week before tumor construction to avoid the influence of stress response on the experiment.

[0071] The GL 261 mouse glioblastoma cell line and its luciferase-expressing GL 261-Luc derivative cell line were used to construct a glioblastoma animal model, and Vero cells were used for Toxoplasma tachyzoite breeding. All cells were cultured in DMEM containing 10% fetal bovine serum, 1% penicillin / streptomycin, 4.5 g / L D-Glucose, L-Glutamine, 110 mg / L Sodium Pyruvate. Me49 ABFD2 APDX1 tachyzoites were used for glioblastoma treatment and grew in DMEM containing 2% fetal bovine serum and the same conditions as above. All cell lines and strains were incubated at 37°C with 5% CO2.

[0072] 2. Model construction (1) Construction of glioblastoma subcutaneous tumor model Tumor cell single cell suspension was injected into the mouse waist abdomen subcutaneously or inoculated into the right striatal area of the mouse using a stereotactic instrument to produce a mouse GBM model. 2x10 6 GL261-luc cells were implanted subcutaneously in each mouse. Each mouse was injected with 5x10^5 GL261-luc cells into the designated position intracranially. When performing intracranial tumor implantation surgery, the animals were given appropriate anesthesia (with sterile normal saline as solvent, Xueshuang II (10 mg / kg) combined with Cetamin 50 (20 mg / kg) at a ratio of 1:1, intraperitoneal injection at a volume of 100ul / 20g, after the operation, the mice were randomly assigned to experimental and control groups, within the limits allowed by the ethics committee, the present invention strictly follows the '3R' principle. During the experiment, the mice were observed twice a day, and the body weight was monitored every other day. Once the humane endpoint was reached, including a 20% weight loss induced by tumor, a tumor size of about 1.5 cm, or changes in behavior and mental state (such as social isolation, hunched posture, immobility, unsteady gait), euthanasia was immediately performed.

[0073] (2) Construction of ultraviolet inactivated Toxoplasma gondii ME49 DK strain When Toxoplasma gondii ME49 DK tachyzoites cultured in Vero cells escaped in large numbers, they were collected and purified by centrifugation. After washing with PBS once, they were evenly spread on a sterile culture dish. Then, the culture dish was placed in a sterile operating table and the parasites were irradiated with a UV lamp (30 mJ / cm² for 2 h) until they were completely inactivated. The morphology and viability of the parasites were observed under a microscope, and the inactivated parasites were inoculated into Vero cells to observe whether they proliferated in culture to verify the inactivation effect. The prepared completely inactivated strain was aliquoted and stored in a -80°C freezer for subsequent anti-tumor therapy, and the entire process must be strictly sterile.

[0074] 3. Evaluation of treatment dose and safety performance of Toxoplasma gondii ME49 DK strain Titration experiment: The optimal dose of tachyzoites was determined by observing the treatment effect on subcutaneous tumors. That is, starting on the 7th day after GL261 cells were implanted subcutaneously in the right side of the mouse, PBS 100ul or Me49 DK tachyzoites (1x10^6, 2x10^6, 4x10^6, 8x10^6) / 100ul were injected intraperitoneally, once every other day, 3 times a week, for a total of 6 times. After the end of the treatment period (21st day), the mice were sacrificed, the tumor size was compared, and the weight was recorded.

[0075] 4. Evaluation of the therapeutic effect on mouse subcutaneous tumors (1) Subcutaneous tumor treatment process: On day 0, GL261-Luc tumor cells were injected into the right flank of the mouse; on day 7 after inoculation, when the tumor diameter reached 0.5 cm, the model was considered to be successfully constructed and was randomly grouped; Toxoplasma ME49 DK strain treatment regimen: taking the tumor cell inoculation of the mouse as day 0, intraperitoneal injection treatment was performed on days 8, 10, 12, 15, 17, and 19 (4x10^6 / 100ul); the blank control group of tumor mice was only injected with normal saline (100ul / each) intraperitoneally; on days 7, 14, 21, and 28, the tumor progression was observed by small animal live fluorescence imaging; the survival time of each group of mice was counted and survival curve analysis was performed.

[0076] (2) Small animal live fluorescence imaging A mouse glioma model was established using the GL261-Luc cell line. On days 7, 14, 21, and 28 after tumor implantation, the tumor size was monitored by bioluminescence imaging using a PerkinElmer IVIS Lumina XRMS instrument. Briefly, D-luciferin potassium salt was diluted in normal saline at a concentration of 15 mg / ml, and each mouse was injected intraperitoneally at a dose of 10ul / g. Bioluminescence imaging was performed 15 min later. The region of interest technique (ROI) was used to quantitatively analyze the tumor fluorescence value, and the size of the ROI value was positively correlated with the number of tumor cells and the degree of malignancy. During the imaging process, the mouse was continuously anesthetized with 2% isoflurane. The state of the mouse was monitored daily, and the body weight was evaluated every other day. The survival time of the mouse was recorded at the time of the humane endpoint, and the systemic treatment efficacy of Me49 DK was further judged by the survival rate.

[0077] 5. Investigation of the anti-tumor treatment mechanism of Toxoplasma ME49 DK strain (1) Pre-infection experiment To evaluate the intervention of the strain infection on the efficacy, 10 C57 mice were randomly divided into 2 groups, and the experimental group mice were given intraperitoneal injection of 4x10^6 speed plants / 100ul, once a week for 3 times. The control group was not treated, and 30 days after the third attack, GL261 cells were implanted subcutaneously in the right side of all mice. Starting from day 7, the size of the subcutaneous tumor was measured every 2 days using a digital caliper, and the tumor volume was calculated using the formula (V=0.52xlengthxwidth).

[0078] (2) Evaluation of the activity of the strain on tumor efficacy Day 0: Subcutaneous tumor cell implantation. Day 7: 15 tumor-bearing mice were randomly assigned to three groups. PBS (100 ul / mouse), Me49 DK bradyzoites (4 x 10^6 / 100 ul), and UV-irradiated Me49 DK bradyzoites (4 x 10^6 / 100 ul) were used for treatment, respectively. Treatment was performed every other day for 6 times. At the end of the treatment cycle (day 21), mice were sacrificed, and tumor size was compared and weighed.

[0079] 6. Evaluation of peripheral immune conditions (1) Elisa: On day 14 / 21 after tumor implantation, the ascites was extracted after 2-3 times of repeated flushing of the abdominal cavity with 5 ml PBS. The supernatant was collected after centrifugation at 3000 rpm for 10 min. The expression levels of peripheral pro-inflammatory cytokines (IFN-γ and IL-12) in the ascites of mice were determined according to the instructions of the Elisa kit.

[0080] (2) Flow cytometry: The present application analyzes the immune cell infiltration in the peripheral spleen by flow cytometry. After the spleen tissue is separated from the abdominal cavity of the mouse, the tissue is rapidly ground on the filter screen of a 70 μm nylon filter with a 5 ml syringe tip, and pre-cooled PBS is continuously flushed to prepare a single cell suspension of the spleen. After centrifugation of the single cell suspension at 2200 rpm for 7 min, red blood cell lysis solution is used for resuspension and lysis for 5 min. After centrifugation again, the supernatant is discarded. The obtained cells are resuspended and diluted with PBS, and each group is divided at a concentration of 1 x 10*6. After blocking and staining in turn, the expression levels of immune cells such as CD 3 + T, CD 8 + T, macrophages and DCs are analyzed using Beckman CytoFLEX S and FlowJo software.

[0081] 7. Evaluation of immune memory effect of tumor-bearing mice after cure To evaluate whether the mice produce immune memory, we use mice that have no tumor occurrence 30 days after subcutaneous GL261-Luc glioblastoma regression as the experimental group, and mice of the same batch, age and gender as the control group. GL261-Luc glioblastoma cells are implanted in the left lumbar abdomen of all mice. On day 7 after implantation of tumor cells, the tumor fluorescence value (ROI) is quantitatively analyzed using a small animal fluorescence microscopic imaging system.

[0082] 8. Evaluation of the therapeutic effect of the mouse orthotopic tumor (1) Treatment protocol for in situ tumors in mice: On day 0, GL261-Luc tumor cells were injected into the right lumbar region of mice; on day 7 after inoculation, when the tumor diameter reached 0.5 cm, the model was considered to be successfully constructed and the mice were randomly grouped; Treatment protocol for Toxoplasma gondii ME49 DK strain: On day 0, mice were implanted with tumor cells and intraperitoneal injections were performed on days 8, 10, 12, 15, 17, and 19 (4×10^6 / 100ul); The tumor-bearing mice in the blank control group were only injected with physiological saline in the peritoneum (100ul / mouse); On days 7, 14, 21, and 28, the tumor progression was observed by small animal in vivo fluorescence imaging; The survival time of each group of mice was counted and survival curve analysis was performed.

[0083] (2) Immunohistochemical analysis using conventional methods 9. Assessment of the immune environment in glioblastoma in situ (1) Flow cytometry Glioblastoma tissue was isolated from mouse brain tissue, mechanically minced to a paste-like consistency, and then digested at 37°C for 1 hour with a digestive solution (10 mM HEPES, 1 mg / ml−1 collagenase IV, 50 μg / ml−1 DNase I, 0.05% BSA, DMEM). The resulting suspension was filtered through a 70 µm nylon filter to obtain a single-cell suspension of tumor tissue. The single-cell suspension was centrifuged at 2200 rpm for 7 min, resuspended in 30% Percoll, and slowly added to 70% Percoll. After density centrifugation at 2200 rpm for 20 min (6 ascending speed, 0 descending speed), the intermediate mist layer, i.e., lymphocytes from the tumor tissue, was collected. After the obtained cells were grouped, blocked, and stained, the levels of immune cells expressing CD45+, CD3+, CD4+, CD8+, NK1.1, CD11B+, CD11c+, F4 / 80+, and Arg1+ were analyzed using Beckman CytoFLEX S and FlowJo software.

[0084] (2) Immunofluorescence: The tumor-bearing brain tissue of each group was collected on day 14, with the start of treatment as day 0, for immunofluorescence analysis.

[0085] 10. Survival assessment of tumor-bearing mice after treatment Once the mouse tumor model was successfully established (day 7 post-implantation), the mice were observed daily, weighed every other day, and underwent in vivo fluorescence imaging weekly to monitor tumor progression. Considering animal welfare, mice were euthanized when the long diameter of the subcutaneous tumor exceeded approximately 1.5 cm, and the mice were declared dead. Mice with intracranial glioblastoma implanted exhibiting behavioral and mental changes (such as social isolation, arched back posture, immobility, and unsteady gait) were immediately euthanized, and the time of death was recorded.

[0086] 11. Peripheral immune cell depletion process Day 0 was defined as the implantation of tumor cells in mice. The peripheral CD4 T cell depletion protocol involved an initial depletion of 200 μg of in vivo anti-mouse CD4 via intraperitoneal injection on day 6, followed by maintenance depletion with 100 μg supplementation on days 9 and 12. The peripheral CD8 T cell depletion protocol involved an initial depletion of 200 μg of in vivo anti-mouse CD8 via intraperitoneal injection on day 6, followed by maintenance depletion with 100 μg supplementation on days 9 and 12. The peripheral macrophage depletion protocol involved peripheral macrophage depletion via intraperitoneal injection of Clodronate Liposomes at a concentration of 10 μL / g on day 6, with an equal volume of injected PBS Liposomes serving as a negative control to exclude interference from the liposomes themselves. On days 9 and 12, mice were injected with a concentration of 10 μL / g to maintain cell depletion. Flow cytometry was performed on peripheral blood of mice 24 hours after all depletion agents were injected to detect cell depletion effects. The ME49 DK strain was administered as an antitumor treatment according to the treatment protocol described above. Tumor progression was observed using in vivo fluorescence imaging in small animals after the treatment ended on day 21. Survival time for each group of mice was recorded and survival curves were analyzed.

[0087] II. Experimental Results 1. The ME49 DK strain of Toxoplasma gondii completely controls the growth of subcutaneous glioblastoma. according to Figure 5 The timeline shown in Figure A evaluated the anti-tumor effects of mice by intraperitoneal injection of different doses of ME49 DK tachyzoites (1×10^6, 2×10^6, 4×10^6, 8×10^6), with PBS injection serving as a control. The results indicated that increasing the dose to 8×10^6 tachyzoites did not significantly affect the body weight or survival status of the mice. Figure 5 (B). Dose-response analysis showed that after 14 days of treatment, the growth of subcutaneous glioblastoma was significantly inhibited in a dose-dependent manner. The tumor size in the 4×10^6 tachyzoite group was significantly inhibited compared with the PBS control group (p<0.001), and was superior to the 8×10^6 high-dose group (p=0.017). Therefore, 4×10^6 was determined to be the optimal treatment dose. Figure 5 B and Figure 5(C). This invention uses the optimal therapeutic dose for anti-tumor treatment. During the treatment, to monitor tumor growth, this invention uses a small animal fluorescence microscopy system with region of interest (ROI) technology to quantitatively analyze tumor fluorescence values. A larger ROI value indicates a greater number of tumor cells and a higher degree of malignancy. Experimental results show that after one week of treatment, the tumor was significantly inhibited, and the subcutaneous glioblastoma in the experimental group mice achieved complete remission on day 28 after implantation. Figure 5 E and Figure 5 (F).

[0088] 2. Effects of Toxoplasma gondii ME49 DK strain on glioblastoma This invention established a pre-infection model: C57BL / 6 mice were intraperitoneally inoculated with 4×10^6 tachyzoites for 30 days, followed by transplantation of GL 261-Luc glioma cells (n=6 / group) into the left flank and abdomen. The results showed ( Figure 6 (A) Although the immune response induced by pre-infection does not affect tumor cell colonization, subcutaneous glioblastoma in mice pre-infected with Me49 DK tachyzoites progresses more slowly and has a smaller tumor volume, with a significant difference in tumor volume compared to the control group at day 19.

[0089] This invention included an ultraviolet (UV) inactivation group (30 mJ / cm² irradiation for 2 h) as a positive control (i.e., UV-inactivated Toxoplasma gondii ME49 DK strain), and PBS treatment as a negative control. Results showed that the UV-inactivated ME49 DK strain did not significantly differ from the PBS control group in tumor control (p=0.62). Figure 6 B and Figure 6 (C). This indicates that sustained stimulation of the host's immune system by the ME49 DK live strain is a necessary condition for achieving anti-glioma therapeutic effects.

[0090] 3. The ME49 DK strain of Toxoplasma gondii activates peripheral antigen-presenting cells to stimulate a strong CD8+ T cell anti-tumor immune response. Spleens from mice treated for one week were used to investigate changes in peripheral immunity. Flow cytometry analysis showed a significant increase in the percentage of immune cells such as CD3 T cells, CD8+ T cells, macrophages, and dendritic cells (DCs) in the peripheral immune system. Figure 7 This indicates that intraperitoneal injection of ME49 DK can stimulate a strong CD8+ T cell anti-tumor immune response by activating peripheral antigen-presenting cells.

[0091] 4. All cured mice rejected the re-implantation of tumor cells. To investigate the generation of adaptive immune responses and immune memory, according to Figure 8As shown in A, on day 30 after tumor healing in mice, GL 261-Luc cells were re-transplanted into the contralateral abdominal region of the healed mice. Fluorescence imaging on day 7 post-transplantation indicated that all mice rejected the re-implanted tumor cells. Figure 8 (B). These results further confirm the safety and efficacy of ME49DK, and its excellent anti-tumor effect gives us hope for its potential as a new generation of anti-cold tumor biologics.

[0092] 5. Treatment with the ME49 DK strain of Toxoplasma gondii significantly controlled the progression of in situ tumors and significantly prolonged the survival of mice. according to Figure 9 The anti-tumor treatment was performed using the procedure shown in Figure A, and tumor progression was detected using in vivo imaging in small animals. Experimental results are as follows: Figure 9 B~ Figure 9 As shown in Figure F, intraperitoneal treatment with ME49 DK significantly prolonged the survival of tumor-bearing mice, increasing the median survival from 32 days to 40.5 days. In vivo imaging revealed significant inhibition of tumor growth two weeks after treatment. Furthermore, in the second week of treatment, immunohistochemical analyses were performed to examine tumor malignancy indicators such as Ki67 and CD31. The results suggest that ME49 DK treatment significantly reduced angiogenesis and tumor proliferation activity within glioblastomas.

[0093] 6. Treatment with the ME49 DK strain of Toxoplasma gondii activated the infiltration of immune cells within tumors. To further investigate the reasons for the growth inhibition of glioblastoma in situ, flow cytometry was used to detect the percentages of immune cells such as CD45+ cells, CD3 T cells, CD4+ T cells, CD8+ T cells, NK cells, natural killer T (NKT) cells, macrophages, and dendritic cells (DCs) in brain tumors. The experimental results suggest that ME49 DK treatment significantly increased the proportion of these immune cells in tumor tissue. Figure 10 This indicates that ME49 DK activates the tumor microenvironment, which was originally in a state of immunosuppression due to lymphocyte depletion.

[0094] 7. Treatment with the ME49 DK strain of Toxoplasma gondii increased the proportion of microglia and resulted in a greater conversion to the M1 pro-inflammatory phenotype. The expression level of tumor-associated macrophages in glioblastoma was observed using flow cytometry. Results are as follows: Figure 11As shown: after ME49 DK treatment, the proportion of TAMs in tumor tissue was significantly reduced (21.3% to 8.7%), and the expression of its immunosuppressive marker Arg1 was also down-regulated; meanwhile, double immunofluorescence staining of IBA1 and CD86 was performed on the tumor tissue of mice after 2 weeks of treatment, and the results showed that: within the tumor tissue, the fluorescence expression of microglial cells increased significantly, and the expression of M1 polarization marker CD86 also increased synchronously.

[0095] In summary, the Me49△BFD2△PDX1 was successfully constructed for the first time, and the animal safety was confirmed through mouse experiments. At the same time, we also constructed subcutaneous and orthotopic glioma models, and confirmed that the Me49△BFD2△PDX1 strain has good immunotherapy effect on inhibiting the growth of glioma by intraperitoneal injection of Me49△BFD2△PDX1 strain to treat the model. Further, flow cytometry and immunohistochemical analysis confirmed that it activated the anti-tumor immune effector mechanism.

[0096] Although preferred embodiments of the application have been described, those skilled in the art will be able to make additional changes and modifications to these embodiments once they have the basic inventive concept.

[0097] Obviously, those skilled in the art can make various modifications and changes to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and changes of the present application belong to the scope of the claims of the present application and their equivalent technologies, the present application also intends to include these modifications and changes.

Claims

1. A Toxoplasma gondii Me49 ABFD2 APDX1 strain, characterized in that, The Toxoplasma Me49△BFD2△PDX1 strain is obtained by knocking out the PDX1 gene in the Me49△BFD2 strain through gene editing means.

2. A method for constructing the T. cruzi Me49 ABFD2 APDX1 strain of claim 1, characterized by, The method comprises the following steps: constructing a PDX1 knockout plasmid; amplifying an HXGPRT resistance fragment: using the pminCAT / HXGPRT+ vector as a template, and using the upstream primer shown in SEQ ID NO. 5 and the downstream primer shown in SEQ ID NO. 6 to amplify, to obtain the HXGPRT resistance fragment; incubating the PDX1 knockout plasmid and the HXGPRT resistance fragment, adding a Toxoplasma Me49△BFD2 tachyzoite suspension, mixing, and then performing electroporation, collecting the electroporation product, and co-culturing with HFF cells to screen and purify the escaped strain, inoculating in HFF cells that are well grown and in good condition to passaging, and obtaining the Me49△BFD2△PDX1 strain.

3. The method for construction of the T. cruzi Me49 ABFD2 APDX1 strain according to claim 2, characterized by that, The step of constructing the PDX1 knockout plasmid is: designing the PDX1-SgRNA shown in SEQ ID NO. 1, using the pSAG1::Cas9-U6::SgUPRT plasmid as a template, using the upstream primer SgPDX1 shown in SEQ ID NO. 2 and the downstream primer gRNA-R shown in SEQ ID NO. 3 to amplify and collect the PCR amplification product, completing circularization with KLD enzyme to collect the circularization product, and extracting the plasmid after resistance screening to obtain the PDX1 knockout plasmid.

4. The method for construction of the T. cruzi Me49 ABFD2 APDX1 strain according to claim 2, characterized by that, The volume ratio of the PDX1 knockout plasmid to the HXGPRT resistance fragment is 6-7:

6.

5. The method for construction of the T. cruzi Me49 ABFD2 APDX1 strain according to claim 2, characterized by that, The incubation temperature of the mixture of the PDX1 knockout plasmid and the HXGPRT resistance fragment is 60°C, and the incubation time is 30 min.

6. The method for construction of the T. cruzi Me49 ABFD2 APDX1 strain according to claim 2, characterized in that, The step of preparing the Toxoplasma Me49△BFD2 tachyzoite suspension is: mixing HFF cells containing Toxoplasma ME49ΔBFD2 tachyzoites with escaped tachyzoites in culture medium, centrifuging to collect the supernatant, centrifuging again to collect the precipitate, resuspending the precipitate with a buffer to obtain the Toxoplasma ME49ΔBFD2 tachyzoite suspension.

7. The method for construction of the T. cruzi Me49 ABFD2 APDX1 strain according to claim 2, characterized by that, The electroporation parameters are set as: voltage 1700 V, pulse length 176 us, 2 times of electric shock, and pulse interval 100 ms.

8. Use of the Toxoplasma Me49△BFD2△PDX1 strain of claim 1 in the preparation of a drug for treating glioma.

9. Use of the Toxoplasma Me49 ABFD2 APDX1 strain according to claim 8 for the preparation of a medicament for the treatment of glioma, characterized in that, The drug is used to reduce tumor mass and reduce tumor volume.

10. Use of the T. cruzi Me49 ABFD2 APDX1 strain according to claim 8 for the preparation of a medicament for the treatment of glioma, characterized in that, The drug takes inactivated Toxoplasma Me49△BFD2△PDX1 tachyzoite as the only effective component.

Images