Sucrose synthase gene and application thereof

Abstract

The invention discloses a sucrose synthase gene Pnsu1 which is derived from pseudo-ginseng, and the nucleotide sequence of the sucrose synthase gene Pnsu1 is as shown in SEQ ID NO: 1; the sucrose synthase gene Pnsu1 is applied to promotion of biosynthesis of notoginsenoside, the sucrose synthase gene Pnsu1 is overexpressed in panax notoginseng cells, so that the panax notoginseng cells overexpressed with the sucrose synthase gene Pnsu1 remarkably increase the content of panax notoginseng saponins compared with normal panax notoginseng cells, a new way is provided for synthesis and accumulation of a large amount of ginsenoside, and the application of the sucrose synthase gene Pnsu1 in the field of biosynthesis of notoginsenoside is broad. And a technical method and a new strategy are provided for a ginsenoside synthesis network.

Description

TECHNICAL FIELD

[0001] The present application relates to a sucrose synthase gene derived from Panax notoginseng and its application in promoting the biosynthesis of notoginsenosides, and belongs to the technical field of biological medicine preparation. BACKGROUND

[0002] The main active ingredients of medicinal materials of Panax genus (Araliaceae) Panax ) are triterpenoid saponins, including ginsenosides and ophiopogonin, etc. These medicinal ingredients have various pharmacological effects such as preventing and treating cardiovascular and cerebrovascular diseases, resisting fatigue, resisting oxidation, enhancing immunity, and protecting liver, etc. According to the different structures of aglycone, the triterpenoid saponins of Panax genus medicinal plants can be divided into two categories: dammarane type saponins and zingiberane type saponins. Since the demand for triterpenoid saponins is wide, how to efficiently obtain such compounds has become the focus of attention. At present, the preparation of ginsenosides is mainly through chemical extraction, but the separation process is complex, the preparation time is long, the preparation amount is small, and the solvent demand is large. In addition, the cultivation of Panax genus plants takes a long time, and the chemical extraction process has problems such as low efficiency and environmental pollution, so the price of ginsenosides is high, and its application in the medical and health industries is limited. The transgenic method is another effective method to improve the yield of ginsenosides in tissue and cell culture.

[0003] In the biosynthesis process of plant secondary metabolites, glycosylation modification can affect the biological activity, water solubility and stability of the receptor molecule, and plays an important role in the formation of the structure and pharmacological activity diversity of plant secondary metabolites. Studies have shown that glycosylation modification is a key step to endow ginsenosides with structural and functional diversity. Glycosylation reaction is catalyzed by glycosyltransferases (GTs) to transfer the sugar group from the activated donor molecule to the receptor molecule to generate a variety of glycosides.

[0004] Sucrose synthase is a key enzyme for catalyzing the reversible reaction of sucrose metabolism in plants, which decomposes sucrose into UDP-glucose and fructose to provide precursor substances for the synthesis of biological macromolecules such as starch and cellulose. The enzyme has multiple subtypes, and the gene family members show functional conservation in plant evolution. Their activity is regulated by phosphorylation modification, and is closely related to the development of sink organs and response to abiotic stress; ​SUS in different plants has different functions, overexpression of SUS in potato can significantly increase the dry weight of potato tubers, starch content and total yield of plants. SUS also participates in the biosynthesis of cellulose, overexpression of SUS gene in poplar increases the content of secondary cell wall cellulose and wood density. SUS also participates in the stress response of plants, antisense expression of CsSUS3 gene in cucumber, the plant is more sensitive to flooding conditions, and the growth slows down, and there are more yellow necrotic spots on the leaves, indicating that CsSUS3 is involved in resisting hypoxic stress. However, the relationship between sucrose synthase and ginsenoside synthesis and yield has not been reported. SUMMARY

[0005] The application provides a sucrose synthase gene from Panax notoginseng Pnsus1 , the nucleotide sequence of which is shown as SEQ ID NO: 1, the gene Pnsus1 is introduced into Panax notoginseng cells for overexpression, and the total ginsenoside content in the Panax notoginseng cells is improved.

[0006] The application achieves the purpose by the following technical scheme: 1. Total RNA is extracted from Panax notoginseng, and cDNA is synthesized by reverse transcription, and a gene Pnsus1 is obtained by PCR amplification with the synthesized first strand of cDNA as a template; 2. An overexpression vector pCAMBIA2300s - Pnsus1 is constructed, Agrobacterium is transformed, and positive monoclonal is screened by PCR; 3. The pCAMBIA2300s - Pnsus1 is introduced into Panax notoginseng cells for expression by using the Agrobacterium-mediated genetic transformation method, and positive transgenic cell lines are screened by antibiotic screening and qRT-PCR; 4. Ginsenosides in the transgenic and non-transgenic cell lines of Panax notoginseng are extracted, and the total ginsenoside content difference between the transgenic and non-transgenic cell lines is analyzed and compared.

[0007] The application first obtains a sucrose synthase gene in Panax notoginseng of the genus Panax Pnsus1 , and the expression level of the sucrose synthase gene Pnsus1 in Panax notoginseng cells is improved by using gene overexpression, so that the purpose of improving the ginsenoside content of Panax notoginseng is achieved. The application solves the blank problem of discovery and application of sucrose synthase in the genus Panax, and provides a new way for large-scale synthesis and accumulation of ginsenosides; and provides a technical method and a new strategy for the ginsenoside synthesis network. BRIEF DESCRIPTION OF DRAWINGS

[0008] Figure 1 is a PCR amplification electrophoretogram of the gene Pnsus1 , wherein M represents DNA marker DL2502; Figure 2is a gene Pnsus1 The schematic diagram of PCR detection results of connecting PMD18-T vector to DH5a bacterial liquid, wherein M: DNA marker DL2502; 1-8: single clone bacterial liquid; -: negative control; +: Pnsus1 Gene PCR amplification product Figure 3 is Pnsus1 The schematic diagram of PCR detection results of connecting pCAMBIA2300s vector to DH5a bacterial liquid, wherein M: DNA marker DL2502; 1-8: single clone bacterial liquid; -: negative control; +: Pnsus1 Gene PCR amplification product Figure 4 is pCAMBIA2300s- Pnsus1 The schematic diagram of PCR detection results of connecting plasmid to LBA4404 bacterial liquid, wherein M: DNA marker DL2502; 1-10: single clone bacterial liquid; -: negative control; +: Pnsus1 Gene PCR amplification product Figure 5 is the electrophoretogram of PCR detection of transgenic ginseng callus cells, wherein M: Marker DL2502; 1-4: overexpression Pnsus1 Ginseng cell lines Figure 6 is the detection results of real-time fluorescent quantitative PCR detection of relative expression amount of overexpression Pnsus1 Gene in transgenic ginseng cells, wherein WT: non-transgenic ginseng cell line; T1-T4: overexpression Pnsus1 Ginseng cell lines Figure 7 is the total saponin content chart of overexpression Pnsus1 Ginseng cell lines, wherein WT: non-transgenic ginseng cell line; T1-T4: overexpression Pnsus1 Ginseng cell lines. DETAILED DESCRIPTION

[0009] The application will be further described in detail by the following examples, but the protection scope of the application is not limited to the content described, and the methods in the examples are all conventional methods unless otherwise specified, and the reagents used are all conventional commercially available reagents or reagents prepared according to conventional methods unless otherwise specified.

[0010] Example 1: Sucrose synthase gene Pnsus1 Obtaining 1. Screening of ginseng transcriptome data Pnsus1 Gene partial sequence The partial sequence of the ginseng sucrose synthase gene was screened from the ginseng transcriptome database, and the sequence was used as a candidate gene fragment for subsequent amplification of the ginseng sucrose synthase CDS.

[0011] 2, Extraction of total RNA of ginseng The total RNA of ginseng was extracted by a modified guanidine isothiocyanate method, and the specific operation was as follows: the ginseng rhizome was cut into thin slices and frozen in liquid nitrogen for a moment, then ground into powder under liquid nitrogen, and the appropriate volume of TRIzol and mercaptoethanol was added according to the amount of powder to make the tissue powder homogenized in the lysis buffer immediately, and the RNA of ginseng was extracted by standing, and then the RNA was recovered by the conventional operation steps of chloroform extraction and isopropanol precipitation, and stored at -80℃ after being divided and stored in the refrigerator for subsequent experiments. The whole extraction process should be carried out in a closed and sterile environment. The recovered RNA was evaluated by agarose gel electrophoresis to assess the integrity of the RNA; after electrophoresis, the total RNA showed three obvious main bands on the gel, which were 5SrRNA, 18SrRNA and 28SrRNA. If the bands on the gel are not obvious or have a large range of dispersion, it means that the RNA has been degraded and cannot be used. The total RNA of ginseng that meets the requirements is added to the sample pool of ultramicro spectrophotometer to detect the concentration and purity of the extracted RNA.

[0012] 3, Synthesis of cDNA first strand The RNA with good quality was used to reverse the full-length cDNA efficiently by using the HiScript-TS 5' / 3' RACE Kit of Vazyme company with RNA as template, and the 3' end was amplified rapidly with cDNA as template. According to the instruction, the 3' gene specific primer (Gene Specific Primer) was designed: Pnsus1 -3': ACGTTTTGGGTTATCCCGACACTGGTGG. The 3' RACE amplification was prepared according to the following method: RNA 10 ng, 3' CDS Primer 2 μL, dNTP Mix 2 μL, RNase-free ddH2O to 14 µL, gently mixed with pipette, centrifuged for a moment, placed on ice, and placed in 72℃ water bath for 3 min for pre-denaturation, then immediately placed in ice bath for 2 min, then added the following reagents: 5×FS Buffer 4 μL, 10×Enzyme Mix 2 μL, mixed, centrifuged for a moment, placed on ice, 42℃ water bath extension for 90 min, finally, placed in 70℃ water bath for 15 min, 10 μL product was added to 50 μL Dilution Buffer for dilution, and the obtained product was 3' RACE-Ready cDNA.

[0013] 4, Rapid amplification of cDNA ends Pnsus1 Gene In the PCR tube, the following reagents were added: 3' RACE-Ready cDNA 2.5 μL, 3' GSP (10 μM) 1 μL, 10x Universal Primer Mix (UPM) 5 μL, 2x PCR Mix 25 μL, ddH2O 16.5 μL, mix well, centrifuge for a moment, 98℃, 1 min; 98℃, 10 s; 68℃, 15 s; 72℃, 3 min; 25 cycles; 72℃, 5 min; the results are shown in Figure 1 , a gene fragment with a length of 2000-2500 bp was amplified, named Pnsus1 , and the sequence is shown in SEQ ID NO: 1.

[0014] Example 2: Pnsus1 Construction of gene overexpression vector 1, Pnsus1 Obtaining of gene CDS sequence After electrophoresis of the PCR product DNA in Example 1, the gel containing the target DNA fragment was quickly cut under ultraviolet light and then the gene fragment was recovered using SanPrep column DNA gel recovery kit (Shanghai Biomed). The obtained Pnsus1 Gene was ligated with pMD18-T vector, and the ligation system was as follows: pMD18-T vector 1.0 μL, target DNA fragment 4.0 μL, Solution I 5.0 μL, the above system was added in a 200 μL Eppendorf tube, mixed gently, centrifuged for a moment, placed in a 16℃ ultra-low temperature water tank for ligation for 16 h, after ligation, the Eppendorf tube was taken out and placed on ice; the vector in the above ligation reaction liquid was transformed into E. coli competent cells (DH5α) by heat shock method, in the super-clean bench, the LB liquid medium containing Amp resistance was divided into sterile centrifuge tubes, 1 mL per tube, a sterile toothpick was used to carefully pick single colonies, ensuring that the toothpick did not touch two single colonies at the same time, the toothpick with single colonies was placed in a sterile centrifuge tube, and the bacteria were mixed into the culture medium by stirring, the centrifuge tube was cultured at 37℃, 200 rpm; after the bacteria solution became turbid, single colony solution was obtained; using the bacteria solution as a template, primers Pnsus1 - Kpn I-F (TACGAATTCGAGCTCGGTACCATGGCTGAACCTGTTCTTACCC) and Pnsus1 - PstI-R (GCCAAGCTTGCATGCCTGCAGCTACTGATCCACAGCAAGTGGAAC) was amplified using the following PCR reaction system and amplification conditions: 1 μL bacterial culture, 10 μL 2×TaqPCR StarMix, 0.4 μL F primer, 0.4 μL R primer, and 8.2 μL Nuclease-free water were mixed and centrifuged briefly at 94℃ for 5 min; 94℃ for 30 s, 61℃ for 30 s, and 72℃ for 1 min 30 s, for 32 cycles; 72℃ for 10 min; positive single clones were then screened.

[0015] The results of bacterial culture PCR are shown below. Figure 2 The amplified target fragment is between 2000 bp and 2500 bp in size, which can be preliminarily identified as... Pnsus1 The gene was ligated into the pMD18-T vector and successfully transformed into E. coli. Positive single clones were selected for sequencing. Pnsus1 The gene sequence sequencing results are shown in SEQ ID NO:1.

[0016] 2. Extraction and double enzyme digestion of plasmid DNA The positive clones obtained in step 1 were cultured for 15 hours to obtain a large number of bacterial cells for plasmid extraction. The plasmids were extracted using the SanPrep column plasmid extraction kit, and the bacterial cells were collected, lysed, and the plasmids were purified. The specific operation steps are as follows: ① Centrifuge a total of 6 mL of bacterial culture in 4 separate centrifuges and collect the culture in 2 mL centrifuge tubes. Centrifuge at high speed to ensure that the bacterial cells are deposited at the bottom of the tube and that there is no culture medium residue. ② Add 300 μL of Buffer P1 to the centrifuge tube and seal it tightly. After vigorous shaking in a vortex mixer, resuspend the bacteria. Ensure that there are no bacteria adhering to the centrifuge tube wall and no flocculent matter inside the tube. ③ After adding 50 μL of Buffer P2 to the centrifuge tube, immediately shake it gently and let it stand at room temperature for 2-4 minutes to allow the bacteria to lyse. Make sure to add 500 μL of Buffer P3 within 5 minutes, shake it gently to fully neutralize and terminate the lysis, let it stand for 2 minutes, and centrifuge at 13500g for 20 minutes at room temperature. ④ By centrifuging at low speed, the plasmids in the supernatant are retained in the adsorption column; since the adsorption capacity of the adsorption column is limited, in order to obtain a higher concentration of plasmids, the supernatant of the above multiple tubes is centrifuged multiple times on the column to enrich the plasmids on the same adsorption column. ⑤ Add 500 μL of protein removal buffer f DW1, centrifuge at 9000g for 30 seconds, then discard the waste liquid to remove residual protein on the adsorption column; (6) Add 500 μL Wash Solution, centrifuge under the same condition, and discard the waste solution. This step is repeated twice. (7) To remove the residual elution buffer, centrifuge the empty column and dry it. (8) Take 60 μL Elution Buffer heated to 60℃, and inject the liquid into the center of the adsorption membrane in the adsorption column. Then, transfer the adsorption column into a new centrifuge tube, and centrifuge at 10,000 g for 2 min to obtain the plasmid solution (pMD18-T- Pnsus1 ). pMD18-T- Pnsus1 The double enzyme digestion reaction system of pMD18-T- Kpn and pCAMBIA2300s is as follows: plasmid DNA or pCAMBIA2300s 5 μg, buffer 5.0 μL, Pst I 2.5 μL, I 2.5 μL, and nuclease-free water 35 μL. Add the above system into a 200 μL Eppendorf tube, mix gently, centrifuge, and react in a 37℃ water bath for about 3.5 h. After the enzyme digestion reaction is completed, take an appropriate amount of the digestion product for electrophoresis analysis, and use a SanPrep column DNA gel recovery kit (Shanghai Biomed) to recover the target fragment.

[0017] 3, Gene Pnsus1 and pCAMBIA2300s According to the instructions of T4 DNA Ligase, add the following system into a 200 μL Eppendorf tube: insert DNA fragment 6.0 μL, digested pCAMBIA2300s DNA 2.0 μL, T4 DNA Ligase 1.0 μL, and 10×T4 DNA Ligase Buffer 1.0 μL. Mix gently, centrifuge, and connect in a 16℃ low-temperature water tank for 16 h.

[0018] 4, pCAMBIA2300s- Pnsus1 into DH5α E. coli The ligation product was transformed into DH5a E. coli competent cells by heat shock method, and after 1 hour and 30 minutes of shaking culture, the bacterial solution was centrifuged, part of the supernatant was discarded, and the appropriate amount of bacterial solution was resuspended to resuspend the bacterial cells, which were coated on LB solid plate (containing 50 mg / L Kana) and incubated at 37°C for 12 hours. A single colony was picked up in an EP tube containing 1 mL of LB liquid medium (containing 50 mg / L Kana) and shaken at 37°C and 200 r / min overnight. The positive single colony was identified by PCR, and the reaction system and amplification conditions were the same as step 1. The results are shown in Figure 3 , and the samples all had a single bright band at 2500 bp, indicating that the recombinant vector had been transformed into E. coli, and it could be determined that the pCAMBIA2300s- Pnsus1 overexpression vector was successfully constructed.

[0019] Example 3: Agrobacterium tumefaciens-mediated genetic transformation of Panax notoginseng 1. The pCAMBIA2300s- Pnsus1 overexpression vector was transformed into Agrobacterium LBA4404 competent cells by liquid nitrogen freezing and thawing method, and after 4 hours of shaking culture, the bacterial solution was centrifuged, part of the supernatant was discarded, and the appropriate amount of bacterial solution was resuspended to resuspend the bacterial cells, which were coated on LB solid plate (containing 50 mg / L Kana and 20 mg / L Rif) and incubated at 28°C for 36 hours. A single colony was picked up in an EP tube containing 1 mL of LB liquid medium (containing 50 mg / L Kana and 20 mg / L Rif) and shaken at 28°C and 200 r / min overnight. The positive single colony was identified by PCR. The results are shown in Figure 4 As can be seen from the figure, the amplified band is about 2500 bp, which is consistent with the expectation, indicating that Pnsus1 the gene has been successfully transformed into Agrobacterium.

[0020] 2. Pre-culture of Panax notoginseng cells (1) Collect Panax notoginseng stems and leaves, and use Panax notoginseng callus culture medium (MS medium + 2,4-D 4 mg / L + KT 1 mg / L, 6-BA 0.5 mg / L medium pH 5.6) for solid culture at 25±1°C in the dark for 28 days to obtain Panax notoginseng callus. The obtained Panax notoginseng callus was subcultured on MS solid medium containing 2,4-D 4 mg / L, KT 2 mg / L, and 6-BA 0.5 mg / L for 15 days to obtain Panax notoginseng subculture cells; (2) Select Panax notoginseng callus cells with good growth state and transfer them to Panax notoginseng callus pre-culture medium (add acetosyringone to 40 mg / L in Panax notoginseng callus culture medium) to cover the entire surface of the medium, and place it in the dark at 25°C for 3 days. 3. Infection and co-culture of Panax notoginseng callus cells The pCAMBIA2300s- obtained in step 1 Pnsus1 LBA4404 Agrobacterium tumefaciens bacterial suspension was streaked onto LB agar plates containing 50 mg / L kanamycin and 25 mg / L rifampin using an inoculation loop (this step can be performed simultaneously with the pre-culture of Panax notoginseng callus cells). The plates were incubated upside down at 28°C for 2-3 days. Well-grown bacterial colonies were then transferred using an inoculation loop to MGL liquid medium containing 40 mg / L acetylsyringone and cultured at 28°C with shaking until the bacterial growth reached OD. 600 It is 0.6-0.8. Using pCAMBIA2300s- Pnsus1 The Agrobacterium LBA4404 plasmid was used to infect Panax notoginseng callus cells pre-cultured for 3 days in step 2. The cells were then co-cultured at 25°C in the dark for 3 days to allow the target gene to transfer into the Panax notoginseng callus cells. The co-culture medium for the Panax notoginseng callus cells was the same as the pre-culture medium. Subsequent screening (detailed steps are described in the sterilization and screening cultures below) will be conducted to identify cells overexpressing the gene. Pnsus1 The gene-positive Panax notoginseng cell lines were used, while the Panax notoginseng callus cell lines were infected with Agrobacterium tumefaciens carrying the empty pCAMBIA1300s vector as blank controls.

[0021] 4. Sterilization culture After co-culturing, the Panax notoginseng callus tissue was carefully transferred to sterile culture medium (cephalosporin was added to the Panax notoginseng callus tissue culture medium). The cephalosporin concentrations in the sterile culture medium were 50 mg / L, 100 mg / L, and 200 mg / L, respectively. The tissues were placed on the sterile culture medium in order of decreasing concentration for 3 days until no Agrobacterium growth was observed on the surface of the culture medium.

[0022] 5. Screening, culture, and subculture After 9 days of sterile culture, the Panax notoginseng callus cells were transferred to selection medium (neomycin was added to the Panax notoginseng callus culture medium to a final concentration of 50 mg / L). Subculture was performed approximately every 35 days, and after 4-5 subcultures, overexpressing cells were obtained. Pnsus1 Gene-derived Panax notoginseng cell lines.

[0023] Example 4: Transgenic Panax notoginseng cells Pnsus1 Determination of gene expression levels 1. Detection of genomic DNA levels in transgenic Panax notoginseng cell lines Genomic DNA was extracted from transgenic Panax notoginseng cell lines using a modified CTAB method. Kanamycin was then applied to the T-DNA in the pCAMBIA2300s vector. npt II. Design upstream and downstream primers based on the resistance gene sequence. npt-F(5'-CTCTGATGCCGCCGTGTT-3') and npt -R(5'-CCCTGATGCTCTTCGTCCA-3'), using the extracted Panax notoginseng genomic DNA as a template for PCR detection, and screening for positive transgenic Panax notoginseng cells.

[0024] See results Figure 5 In the figure, a specific band of about 430 bp was amplified in each of the four Panax notoginseng transgenic cell lines, which is consistent with the expected size. This indicates that the exogenous DNA has been introduced into the four Panax notoginseng transgenic cell lines and integrated into the genomic DNA for stable inheritance. It has been preliminarily determined that positive transgenic Panax notoginseng cell lines have been obtained.

[0025] 2. Detection of transgenic Panax notoginseng cells by real-time quantitative PCR Total RNA was extracted from positive transgenic Panax notoginseng cell lines and non-transgenic Panax notoginseng cell lines and reverse transcribed into cDNA. The specific operation steps were the same as in Example 1. The cDNA synthesized by reverse transcription was diluted 5-fold. Using the diluted cDNA as a template, based on the 18S rRNA gene (accession number D85171.1) and Panax notoginseng... Pnsus1 Primers designed for real-time PCR based on gene sequence: 18S-F: 5'-AGCAAGCCTACGCTCTGGATAC -3', 18S-R: 5'-TGACTATGAAATACGAATGCCCC -3'; Pnsus1 -F: CCGATGAGGCTGCTGTGAT; Pnsus1 -R: GGATAGACGGACGCAAGGAC. The cDNA synthesized by reverse transcription was diluted 5-fold, i.e., 20µL of cDNA was diluted to 100µL; using the diluted cDNA as a template, quantitative PCR was performed using the primers described above, following the GoTaq® qPCRMaster Mix instructions. Each gene for each sample was tested three times. Using 2... -∆∆Ct The method is used for data processing and gene detection. Pnsus1 The expression situation; Test results are shown Figure 6 Compared with the control group (WT), it overexpressed Pnsus1 Genes in Panax notoginseng cells Pnsus1 Gene expression levels were significantly increased in these four cell lines.

[0026] Example 5: Detection of total saponin content in transgenic Panax notoginseng cells 1. Preparation of the standard curve of total saponins from Panax notoginseng (1) Take 10 mg of total saponin standard of Panax notoginseng, add appropriate amount of methanol for dissolution, and dilute to 10 mL in a volumetric flask to obtain a total saponin standard solution of Panax notoginseng with a concentration of 1 mg / mL; (2) Accurately take 150 mL of the above standard solution into a 20 mL clean test tube, evaporate the methanol solvent at 55°C, then add 200 mL of freshly prepared 5% anisole-acetic acid solution and 800 mL of perchloric acid to the test tube, plug the test tube with a test tube plug, vortex mix, and then place the test tube in a 60°C water bath for 15 min, shake thoroughly every 5 min to promote complete reaction. Immediately after the reaction is completed, place the test tube in ice to cool, then add 5 mL of glacial acetic acid to the reaction solution, mix thoroughly, and stand at room temperature for 10 min; (3) Accurately take 200 mL of freshly prepared 5% anisole-acetic acid solution, 800 mL of perchloric acid, and 5 mL of glacial acetic acid into a 20 mL test tube, plug the test tube with a test tube plug, vortex mix, and stand at room temperature for 10 min, which is the blank control (at the same time as step (2)); (4) Using the mixture in step (3) as the blank control, use a UV spectrophotometer to scan the mixture in step (2) at full wavelength (200-700 nm) to determine the maximum absorption wavelength of total saponin of Panax notoginseng.

[0027] (5) Accurately take 20 mL, 40 mL, 60 mL, 80 mL, 100 mL, and 120 mL of total saponin standard solution of Panax notoginseng into 20 mL clean test tubes, evaporate the solvent at 55°C, then perform the same operation as in step (2), and then use a UV spectrophotometer to measure the absorbance of each reaction solution at the maximum absorption wavelength of total saponin of Panax notoginseng; (6) Using the absorbance of each reaction solution in step (5) as the horizontal coordinate (x) and the concentration of total saponin of Panax notoginseng (mg / L) as the vertical coordinate (y), the linear regression equation is y=15.385x-0.2527, R 2 =0.9988.

[0028] 2. Extraction and determination of total saponin content of transgenic Panax notoginseng cells (1) Collect overexpression Pnsus1 of the gene Panax notoginseng cells and ordinary Panax notoginseng cells, and place them in a 55°C oven until constant weight, grind them into powder, and pass them through a 100 mesh sieve; (2) Take 0.5 g of ordinary and overexpression Pnsus1 of the gene Panax notoginseng cell powder, respectively, and place them in centrifuge tubes containing 50 mL of methanol solution for overnight soaking; (3) Ultrasonic treatment for 1.5-2.0h under the condition of 60W, ultrasonic for 4s, and interval for 2s; centrifugal treatment for 30min at 4000rpm under the condition of normal temperature, and collection of supernatant, i.e. total saponin solution of Panax notoginseng, and storage in a refrigerator at 4℃ for standby; (4) Accurate suction of 150mL total saponin solution of each Panax notoginseng cell strain prepared above into a test tube with a stopper (3 parallel samples for each sample), and color reaction identical to step (2) in preparation of total saponin standard curve, measurement of absorbance of each reaction solution at 550nm after standing for 10min at room temperature, and calculation of total saponin content in overexpressed Pnsus1 gene and normal Panax notoginseng cell strain according to the linear regression equation obtained above.

[0029] Results are shown in Table 1. Figure 7 Compared with WT, the total saponin content in the Panax notoginseng cell strain overexpressing Pnsus1 gene is obviously improved, indicating that the sucrose synthase gene from Panax notoginseng has obvious promoting effect on synthesis of saponin in Panax notoginseng. Pnsus1 ​

Claims

1. A sucrose synthase gene derived from Panax notoginseng, the nucleotide sequence of which is shown as SEQ ID NO:

1. Pnsus1 1. A sucrose synthase gene derived from Panax notoginseng, the nucleotide sequence of which is shown as SEQ ID NO:

1.

2. The sucrose synthase gene of claim 1 Pnsus1 Use of the application in promoting the biosynthesis of notoginsenosides, characterized in that: The sucrose synthase gene is overexpressed in panax notoginseng cells Pnsus1 to improve the total ginsenoside content in panax notoginseng cells.

Images