Method for constructing high-yield engineering bacteria of oritavancin precursor cloireomycin

Abstract

The invention discloses a method for constructing high-yield engineering bacteria of an oritavancin precursor cloireomycin. A high-yield chassis strain capable of being used for efficiently synthesizing glycopeptide antibiotics is constructed by knocking out an NRPS gene responsible for ristomycin biosynthesis in TNS106, inserting an integration site and then inserting a pJLL10 plasmid with a double-copy bbr gene. A bacterial artificial chromosome (BAC) plasmid containing a glycopeptide antibiotic biosynthetic gene cluster is introduced into the high-yield chassis strain to obtain the glycopeptide antibiotic high-yield engineering strain. The shake flask fermentation yield of the cloirusin high-producing strain obtained by the method disclosed by the invention can reach 1440mg / L, and the cloirusin high-producing strain is the strain with the highest shake flask fermentation yield in a public report.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for efficiently constructing engineered bacteria that produce high yields of glycopeptide antibiotics; more particularly, it relates to a method for constructing engineered bacteria that produce high yields of chloroeremomycin (a glycopeptide antibiotic), a precursor of orivantoxin. Background Technology

[0002] Chlororienticin A, also known as chloroorienticin A, A82846B, or LY264826, is an important glycopeptide antibiotic discovered by Eli Lilly and Company in 1987. It exhibits activity against methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci. The chlororienticin gene cluster is 72 kb long and includes 39 genes (VanWageningen et al. Chem Biol, 1998, 5(3):155-162). Currently, chlororienticin is used as a starting material in the production of the novel anti-infective drug Oritavancin. Orivancin is a new generation of semi-synthetic glycopeptide antibiotic against Gram-positive bacteria, which was recently approved by the U.S. Food and Drug Administration (FDA) for the treatment of acute bacterial skin and skin structure infections (ABSSSI) (Corey et al, N Engl J Med, 2014, 370(23):2180-2190; Brade et al, Infect Dis Ther. 2016, 5:1-15.). Amycolatopsis ori entalis is the original producing strain of chloriprencin, while Kibdelosporangium aridum SIPI-3927 is another naturally occurring strain that can produce it, but the fermentation units of the natural strain are lower (Zhao et al, Microb Cell Fact. 2024, 23(1):186; Tian et al, AMB Express, 2020, 10(1):52). The rational construction of engineered strains using synthetic biology technology to improve the fermentation level of chloririmycin has important application value for the industrialization of Orivancin.

[0003] There are various strategies for improving antibiotic fermentation levels using genetic engineering technology, including knocking out competing pathways, enhancing the expression of rate-limiting genes, increasing the expression of key substrate synthase genes, knocking out negative regulatory genes, or overexpressing positive regulatory genes. In Chinese patent CN202011412528.1, the positive regulatory gene strR for the biosynthesis of the orivanthin precursor Chloroeremomycin was introduced into the chlorimeridae bacterium ACCC40175, which produces chlorimeridae, resulting in strain CGMCC NO.21140, increasing chlorimeridae yield to 140 mg / L. In Chinese patent CN202410008031.5, strain CGMCC NO.29179 was obtained by knocking out a potential competitive metabolic pathway and enhancing the expression of the rate-limiting enzyme gene chlorimeridae glycosyltransferase evaE in the high-yield engineered bacterium CGMCC NO.29179. Combined with fermentation process optimization, this increased chlorimeridae yield to 428 mg / L. In Chinese patent CN201710366646.5, the vancomycin biosynthesis-related gene *vca* from strain CGMCC NO.3053 was knocked out, and the vancomycin biosynthesis-related gene *eva* from strain *A. orientalis* NRRL18098 was introduced to obtain strain CGMCC NO.3053, which achieved a chloriramycin yield of 860 mg / L after 260 h of fermentation. Tian et al. increased the shake-flask fermentation yield of chloriramycin to 1200 mg / L by artificially inserting the integration site *attB* into *Streptomyces desertis* SIPI-3927 and overexpressing the halogenase and glycosyltransferase genes of the chloriramycin gene cluster (Tian, ​​et al, AMBExpress, 2020, 10:52). In these examples, genetic engineering was performed on native strains. Many glycopeptide antibiotics are produced by rare actinomycetes, and the above genetic engineering strategies lack feasibility due to the slow growth of native strains or the absence of operable genetic systems.

[0004] Heterologous expression is also a rapid and efficient strategy for constructing engineered glycopeptide antibiotics. This strategy is particularly suitable for cases where the native strain grows slowly or cannot be genetically manipulated. High-yielding actinomycete strains producing specific antibiotics are selected, and high-yielding chassis strains are constructed by deleting their endogenous competitive pathways and manipulating regulatory genes. Inserting complete exogenous gene clusters into the bacterial integration site (attB) of the high-yielding chassis strain allows for the rapid and efficient construction of high-yielding antibiotic engineered strains, offering the advantage of plug-and-play functionality. For example, Xu et al. constructed the glycopeptide antibiotic synthetic biology platform GPAHex using Streptomyces as a chassis and successfully applied it to improve and discover the yield of a series of glycopeptide antibiotics; among them, the fermentation titer of corbomycin increased 19-fold compared to the parent strain, reaching 65.4 mg / L (Xu et al, Nature Communications, 2022, 11(1):5232).

[0005] The rare actinomycete *Amycetes* TNS106 can produce the glycopeptide antibiotic ristoctomycin. Our laboratory previously increased the shake-flask fermentation yield of ristoctomycin to 4.01 g / L in TNS106 by overexpressing the StrR family regulatory factor Bbr gene using pJLK96 (Liu et al, Appl Environ Microbiol, 2021, 87(19):e0106621). This indicates that there is still room for improvement in antibiotic yield among the aforementioned schemes using genetic engineering to enhance the fermentation level of glycopeptide antibiotics. Furthermore, possibly due to distant phylogenetic relationships, some glycopeptide antibiotic gene clusters derived from rare actinomycetes cannot be successfully expressed on the *Streptomyces* platform. Currently, there is a lack of rapid and efficient methods for constructing high-yield engineered strains of glycopeptide antibiotics, especially a lack of high-yield chassis strains suitable for efficiently constructing engineered glycopeptide antibiotic strains, and a lack of engineered strains that produce high-yield chlorhexidine. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing a high-yield engineered bacterium producing chloroeremomycin precursor. In this invention, the NRPS gene responsible for ristocetine biosynthesis in TNS106 is knocked out, and two artificially synthesized integration sites are inserted. and The pJLL10 plasmid, containing two copies of the bbr gene, was then inserted to construct the high-yield chassis strain JL5 (strain accession number: CGMCC No. 34227), which can be used for efficient synthesis of glycopeptide antibiotics. The bacterial artificial chromosome (BAC) plasmid pChloroeremomycin, containing the chloriramycin biosynthesis gene cluster, was introduced into strain JL5 to obtain strain JL6 (strain accession number: CGMCC No. 34228), which achieved a chloriramycin shake-flask fermentation yield of 1440 mg / L, the highest reported yield in shake-flask fermentation.

[0007] The method of this invention also provides an efficient method for constructing high-yield engineered bacteria for glycopeptide antibiotics, and a high-yield chassis strain JL5, which avoids the inherent disadvantages of traditional mutagenesis breeding techniques, such as long breeding cycles and high manpower and material costs.

[0008] Specifically, the objective of this invention is achieved through the following technical solutions:

[0009] In a first aspect, the present invention provides a method for constructing a chassis strain of a high-yield glycopeptide antibiotic strain, the method comprising the following steps:

[0010] S1. Knock out the NRPS gene responsible for ritoxadixyl in wild-type *Amylopectinobacterium* TNS106 and insert it into the integration site. and To obtain strains for heterologous expression of genes or gene clusters;

[0011] S2. Introduce a plasmid carrying the bbr gene to obtain the chassis strain; the plasmid promotes the expression of the glycopeptide antibiotic biosynthesis gene cluster by changing the expression intensity of Bbr.

[0012] As one embodiment of the present invention, the NRPS gene responsible for ristocetine biosynthesis includes the orf4-11 (QXV59348-QXV59342) gene and the orf35-38 (QXV59319-QXV59316) gene in the ristocetine gene cluster.

[0013] As one embodiment of the present invention, step S1 includes:

[0014] S1-1, Construct a system for knocking out the orf4-8 gene and add an integration site. as well as Gene substitution plasmid with sequence; the gene substitution plasmid was introduced into *Amylopectinobacterium* TNS106 via co-transfer between *Escherichia coli* and *Actinomyces* to obtain strain 1;

[0015] S1-2. The recombinant plasmid used to knock out the orf35-38 gene was introduced into strain 1 to obtain strain 2.

[0016] S1-3. The gene knockout plasmid used to knock out the orf9-11 gene is introduced into strain 2 to obtain the strain used for heterologous expression of the gene or gene cluster.

[0017] As one embodiment of the present invention, step S1 includes:

[0018] S1-1': Construct a structure for knocking out the orf4-11 gene and adding an integration site. as well as Gene substitution plasmid with sequence; the gene substitution plasmid was introduced into *Amylopectinobacterium* TNS106 via co-transfer between *Escherichia coli* and *Actinomyces*; strain 3 was obtained;

[0019] S1-2', The recombinant plasmid used to knock out the orf35-38 gene is introduced into strain 3 to obtain the strain used for heterologous expression of the gene or gene cluster.

[0020] As one embodiment of the present invention, the construction of the gene replacement plasmid, recombinant plasmid or gene knockout plasmid is carried out using the Escherichia coli-Streptomyces shuttle plasmid pYH7 as a vector.

[0021] As one embodiment of the present invention, after the gene replacement plasmid, recombinant plasmid or gene knockout plasmid is introduced into the strain, the method further includes the steps of screening for potential double-crossover mutant strains using resistance plates and extracting genomic DNA from the potential mutant strains for PCR verification sequencing.

[0022] As one embodiment of the present invention, the integration site The sequence is shown in SEQ ID NO.11.

[0023] As one embodiment of the present invention, the integration site The sequence is shown in SEQ ID NO.12.

[0024] As one embodiment of the present invention, in step S2, the plasmid carrying the bbr gene is obtained by digesting the pJLK96 plasmid DNA with KpnI and NdeI enzymes, and replacing the kanamycin resistance gene neo in pJLK96 with the hygromycin resistance gene hyg.

[0025] Secondly, the present invention provides a chassis strain obtained by the aforementioned method for constructing a high-yield glycopeptide antibiotic strain.

[0026] Thirdly, the present invention provides a chassis strain for constructing a high-yield glycopeptide antibiotic strain, wherein the chassis strain is Amycolatopsis sp. JL5CGMCC No.34227.

[0027] Fourthly, the present invention provides a method for constructing a high-yield glycopeptide antibiotic strain, wherein a bacterial artificial chromosome (BAC) plasmid containing a glycopeptide antibiotic biosynthesis gene cluster is introduced into the aforementioned chassis strain.

[0028] As one embodiment of the present invention, the construction of the bacterial artificial chromosome (BAC) plasmid includes: obtaining a glycopeptide antibiotic biosynthesis gene cluster by yeast transformation and recombinant cloning; cloning the glycopeptide antibiotic biosynthesis gene cluster into the pCGW plasmid (Xu et al, Nature Communications, 2022, 11(1): 5232) by in vivo homologous recombination in yeast, thereby obtaining the bacterial artificial chromosome (BAC) plasmid.

[0029] As one embodiment of the present invention, the bacterial artificial chromosome (BAC) plasmid is a BAC plasmid containing the chloriramic acid gene cluster. In some specific embodiments, the nucleotide sequence of the BAC plasmid containing the chloriramic acid gene cluster is shown as SEQ ID NO.1-SEQ ID NO.10 sequentially linked.

[0030] Fifthly, the present invention provides a high-yield strain of glycopeptide antibiotics obtained by the aforementioned method.

[0031] In a sixth aspect, the present invention provides a high-yield strain of chloririmol, wherein the strain is Amycolatopsis sp. JL6CGMCC No.34228.

[0032] The *Amycolatopsis* JL5 provided in this invention, classified as *Amycolatopsis* sp., was deposited on April 16, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 34227.

[0033] The fungus Amycolatopsis JL16, classified as Amycolatopsis sp., was deposited on April 16, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 34228.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) Obtain a chassis strain that can be used to efficiently construct high-yield engineered bacteria for glycopeptide antibiotics; and based on this, establish a method for efficiently constructing high-yield engineered bacteria for glycopeptide antibiotics. Taking the construction of high-yield engineered bacteria for chloririmycin as an example, this invention provides a method for efficiently constructing high-yield engineered bacteria for glycopeptide antibiotics. Simply by introducing a BAC plasmid containing a glycopeptide antibiotic gene cluster into the chassis strain JL5, a high-yield engineered strain for the corresponding glycopeptide antibiotic can be obtained; the construction method of the high-yield engineered strain of this invention is fast and efficient.

[0036] (2) Compared with existing patents and literature, this invention has constructed an engineered strain capable of heterologously expressing high-yield chloriramic acid. The yield of chloriramic acid produced by shake-flask fermentation is the highest reported to date, reaching 1440 mg / L on day 8 of fermentation. Furthermore, this invention does not require optimization of the culture medium, resulting in low fermentation material costs and excellent industrial development potential. Attached Figure Description

[0037] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0038] Figure 1 : Schematic diagram of the construction of heterologous expression host strain JL4;

[0039] Figure 2 Construction of the gene expression regulatory plasmid pJLL10;

[0040] Figure 3 : Schematic diagram of direct cloning of the Chloroeremomycin biosynthetic gene cluster;

[0041] Figure 4 Schematic diagram of BAC plasmid pChloroeremomycin and bbr expression plasmid pJLL10 in the chromosome of engineered bacterium JL6;

[0042] Figure 5 HPLC chromatogram of engineered strain JL6 on day 8 of shake-flask fermentation; where the asterisk represents the chloririmycin peak, Std is the standard, and strains JL4 and JL5 are controls;

[0043] Figure 6 Changes in fermentation yield of JL6 over time;

[0044] Figure 7 : Chloririmycin standard sample curve;

[0045] Figure 8 High-resolution mass spectra of chloririmycin standard and JL6; where A is the high-resolution mass spectrum of chloririmycin standard; and B is the high-resolution mass spectrum of JL6 sample. Detailed Implementation

[0046] The purpose of this invention is to obtain a substrate bacterium for rapidly constructing high-yield glycopeptide antibiotic strains, to provide a method for constructing high-yield glycopeptide antibiotic strains, and to provide an engineered strain that produces high levels of chlorhexidine.

[0047] The overall protocol is as follows: Take the wild-type *Amylopectinobacterium* strain TNS106, which produces ristomycin, knock out the NRPS gene in its ristomycin gene cluster, and insert two integration sites. and The chassis strain JL4 was obtained and can be used for heterologous expression of genes or gene clusters.

[0048] Construct the pJLL10 plasmid carrying two copies of the bbr gene, and transform pJLL10 into JL4 to obtain the high-yield chassis strain JL5, which can be used for efficient synthesis of glycopeptide antibiotics (see appendix). Figure 1 (CGMCC No. 34227).

[0049] The bacterial artificial chromosome (BAC) plasmid pChloroeremomycin containing the chloriramycin biosynthesis gene cluster was introduced into strain JL5 to obtain strain JL6, which produces high levels of chloriramycin (accession number: CGMCC No. 34228).

[0050] The specific plan is as follows:

[0051] 1. Construction of heterologous expression of the chassis bacterium JL4

[0052] (1) Using the Escherichia coli-Streptomyces shuttle plasmid pYH7 as a vector, orf4-8 (i.e., asrR, pdh, tri, rpsA and rpsB) in the ristocetinic gene cluster of strain TNS106 were constructed to knock out the bacteria, and typical integration sites were added. as well as The gene substitution plasmid pJLL7 was used. Specifically, using the total genomic DNA of *Amylopectinobacterium* TNS106 as a template, fragments of approximately 2000 bp upstream and downstream of the *orf4-8* genes were amplified by PCR, and a gene fragment of approximately 2000 bp was added between the upstream and downstream fragments. Site (CCTTGACCAGGTTTTTGACGAAAGT GATCCAGATGATCCAGCTCCACACC, SEQ ID NO. 11) and The sequence of the locus (GGAGTA CGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGCG, SEQ ID NO.12) was cloned into the shuttle vector pYH7 to obtain the recombinant plasmid pJLL7, which was verified to be correct by restriction endonuclease digestion and gene sequencing.

[0053] (2) A gene knockout plasmid pJLL8 was constructed to knock out orf35-38 (i.e., dpgABCD) in the ristocetinic gene cluster. Specifically, using total genomic DNA from *Amylopectinobacterium* TNS106 as a template, fragments of approximately 2000 bp upstream and downstream of the orf35-38 gene were amplified by PCR and then cloned into the shuttle vector pYH7 to obtain the recombinant plasmid pJLL8. The plasmid was verified to be correct by restriction endonuclease digestion and gene sequencing.

[0054] (3) Construct the gene knockout plasmid pJLL9 for knocking out orf9-11 (i.e., rpsCD and mbtH) in the ristocetin gene cluster. Specifically, using the total genomic DNA of Amylopectinobacter TNS106 as a template, fragments of approximately 2000 bp upstream and downstream of the orf3-11 gene were amplified by PCR, and then cloned into the shuttle vector pYH7 to obtain the recombinant plasmid pJLL9. The plasmid was verified to be correct by restriction endonuclease digestion and gene sequencing.

[0055] (4) Using *Amycium pseudoherbaceum* TNS106 as the starting strain, a heterologous expression chassis strain JL4 was constructed. The gene substitution plasmid pJLL7 was introduced into *Amycium pseudoherbaceum* TNS106 via co-transfer between *Escherichia coli* and *Actinomyces*. After screening for potential double-crossover mutants using resistance plates, genomic DNA of the potential double-crossover mutants was extracted, and the correct strain was confirmed by PCR sequencing as JL12.

[0056] Gene knockout plasmid pJLL8 was introduced into strain JL12. Potential double-crossover mutants were obtained through antibiotic resistance plate screening. Genomic DNA was extracted from these potential mutants, and PCR sequencing confirmed that the correct strain was JL13. Gene knockout plasmid pJLL9 was introduced into strain JL13. Potential double-crossover mutants were obtained through antibiotic resistance plate screening. Genomic DNA was extracted from these potential mutants, and PCR sequencing confirmed that the correct strain was JL4.

[0057] 2. Construction of a high-quality chassis strain JL5 for producing high-glycopeptide antibiotics.

[0058] (1) Constructing the integrative plasmid pJLL10 carrying two copies of the bbr gene: digested with KpnI and NdeI enzymes. The kanamycin resistance gene was removed from the integrative plasmid pJLK96, the vector fragment was recovered by gel electrophoresis and ligated with the hygromycin resistance gene to obtain the pJLL10 plasmid.

[0059] (2) The pJLL10 plasmid was introduced into the JL4 strain via conjugation transfer to obtain strain JL5 (accession number: CGMCCNo.34227).

[0060] 3. A method for efficiently constructing high-yield engineered bacteria for glycopeptide antibiotics

[0061] By introducing a BAC plasmid containing a gene cluster of glycopeptide antibiotics (such as chloriramic acid) into strain JL5, a high-yield engineered strain producing high levels of glycopeptide antibiotics can be obtained. Introducing a BAC plasmid containing a chloriramic acid gene cluster into JL5 yields the high-yield engineered strain JL6. Figure 4 ), strain preservation number: CGMCC No.34228.

[0062] 4. This invention provides a fermentation production method for high-yield chloriramic acid.

[0063] (1) Seed liquid preparation

[0064] The shake-flask fermentation employed a two-stage seed culture. JL6 was activated by cultivation on solid plates and then inoculated into 250 mL well-dipped flasks containing 50 mL of TSBY medium. Culture conditions: shaker at 30°C, 220 rpm, for 48 hours.

[0065] (2) Production Fermentation

[0066] The prepared seed culture was inoculated at a rate of 4% into a 250mL well-drained flask containing 50mL of SAM medium. Fermentation conditions: 30℃ on a shaker at 240rpm. 1mL samples were taken at fermentation times of 1d, 2d, 3d, 4d, 5d, 6d, 7d, 8d, and 9d.

[0067] (3) Detection of fermentation results: High performance liquid chromatography (HPLC, Agilent 1260), reversed phase column ZORB AX300SB-C18 (5μm, 4.6×250mm), detection at 220nm UV absorption, mobile phase A was aqueous phase (with 0.5‰ formic acid added), and mobile phase B was methanol (with 0.5‰ formic acid added); analytical conditions 0-23min 5% B-25%, flow rate 0.6mL / min; chloririmycin peak retention time was about 17min; and it was basically consistent with the peak time of the purchased chloririmycin standard (Hubei Weishi Chemical Reagent Co., Ltd.).

[0068] The JL4 strain can be successfully constructed through a two-step knockout process. The ristocetin orf4-orf11 gene can be knocked out in one step via homologous recombination using the pYH7 plasmid.

[0069] Besides plasmid pJLL10, other plasmids containing the bbr gene can achieve the same effect as heterologous expression of pJLL10 plasmid by altering the expression intensity of Bbr, thus increasing the yield of chloririmycin.

[0070] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention. Unless otherwise specified, the experimental techniques and methods used in the following embodiments are conventional techniques and methods. Unless otherwise specified, the materials and reagents used in this example can be obtained through legitimate commercial channels.

[0071] Culture medium and its uses:

[0072] MS medium: used for solid culture of bacterial strains;

[0073] 25g of soybean meal powder, 20g of mannitol, and tap water were added to a final volume of 1L. The solution was prepared at pH 7.2-7.4 and sterilized at 121℃ for 20 minutes. The 25g of soybean meal powder was first soaked in 1L of tap water and sterilized at 121℃ for 20 minutes. The extract was then filtered and collected to prepare the culture medium.

[0074] TSBY medium: used for liquid culture of bacterial strains;

[0075] Dissolve 103g sucrose, 5g yeast extract, and 30g TSB in deionized water and bring the volume to 1L. Adjust the pH to 7.2-7.4 and sterilize at 115℃ for 30 minutes.

[0076] SAM medium: used for fermentation in the production of bacterial strains;

[0077] Dissolve 15g soybean peptone, 15g glucose, 5g NaCl, and 25mL glycerol in deionized water and bring the volume to 1L. Adjust the pH to 7.2-7.4, then add 1g CaCO3 and sterilize at 115℃ for 30min.

[0078] Example 1: Construction of heterologous expression host strain JL4

[0079] JL4 was constructed using homologous recombination technology; the technical route is detailed below. Figure 1As shown, *Amylopectinobacterium* TNS106 was modified into JL4 through three rounds of homologous recombination. Specifically, pJLL7 was used to knock out five genes (including two NRPS genes, rpsAB) in the asrR (QXV59348)-rpsB (QXV59345) gene cluster of ristocetine biosynthesis and introduce two attB sites. Then, pJLL8 was used to knock out dpgABCD (QXV59319-QXV59316) in the remaining gene cluster. Finally, pJLL9 was used to knock out the NRPS gene (rpsCD) and three mbtH genes (QXV59344-QXV59342) in the remaining gene cluster (horizontal arrows indicate genes in the gene cluster). The specific construction steps are as follows:

[0080] (1) Using the primers in Table 1, the genomic DNA of *Amycium nigra* TNS106 was first used as a template to amplify two homologous arm fragments of approximately 2000 bp in length upstream and downstream of the orf4-8 (i.e., asrR, pdh, tri, rpsA, and rpsB) genes by PCR, and a typical integration site was added between the two homologous arm fragments. (CCT TGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACC SEQ ID NO.11) and The sequence (GGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCAC CCGCACCGCG SEQ ID NO.12) was obtained. Simultaneously, the pYH7 vector was digested with restriction endonucleases EcoRV and NdeI to obtain a linearized vector. Then, using a one-step homologous recombination cloning method, the linearized vector was recombinated with a homologous arm fragment to obtain the recombinant plasmid pJLL7. The correctness was verified by restriction endonuclease digestion and gene sequencing.

[0081] (2) The vector pJLL7 was transferred into Escherichia coli ET12567 by electroporation to obtain strain ET12567 / pJLL7. Using ET12567 / pJLL7 as the donor, ET12567 / pUB307 as the helper, and *Amylopectinus* TNS106 as the recipient, pJLL7 was transferred into TNS106 via triparental conjugation. Precautions for the conjugation transfer experiment include: a) using mycelia collected from *Amylopectinus* TNS106 cultured for 48 hours for conjugation transfer; b) *Amylopectinus* TNS106 mycelia can be resuspended in 20% glycerol and dispensed into 1.5 mL aliquots. In EP tubes, store at -80℃ for later use. Before the conjugation transfer experiment, thaw and wash the mycelium two to three times with sterile water to remove glycerol. Resuspend the mycelium in 2×YT medium and incubate at 30℃ for 0.5 to 1 hour before use for conjugation transfer. c) Conjugation transfer plates made with MS solid medium supplemented with MgCl2 or MgSO4 (final concentration 20mM) can obtain conjugates. d) When using freshly collected mycelium for conjugation transfer, the conjugation transfer plates are incubated for an average of 8 to 9 hours before being covered with trimethoprim and kanamycin. When using frozen mycelium for conjugation transfer, the average incubation time of the conjugation transfer plates before covering with trimethoprim and kanamycin is 10 to 13 hours. e) Cover the conjugation transfer plates with trimethoprim and kanamycin to a final concentration of 50 μg / mL.

[0082] (3) The conjugation transfer plates were cultured at 30℃ for 4–6 days until the conjugation transferons grew. These were then selected and transferred to MS solid plates containing apopramine. The correctness of the conjugation was verified by antibiotic testing to obtain single-exchange strains. These single-exchange strains were then placed in antibiotic-free TSBY liquid medium and cultured for two rounds at 30℃ and 220 rpm. The bacterial suspension was then diluted and plated onto antibiotic-free MS plates to obtain single clones. Single clones were randomly selected and simultaneously inoculated onto both antibiotic-free MS plates and MS plates containing apopramine. Potential double-exchange mutants that did not grow on antibiotic-resistant plates but grew normally on antibiotic-free plates were screened. Finally, genomic DNA was extracted from the potential double-exchange mutants, and the target band was amplified by PCR using primers Δorf4-8_F / R. The size of the amplified band was analyzed, and sequencing was performed to verify the correct knockout of orf4-8, thus obtaining strain JL12.

[0083] (4) Construct the gene knockout plasmid pJLL8 for knocking out orf35-38 in the ristocetine gene cluster. According to steps (2) and (3) above, using the genomic DNA of *Amycosis fungoides* TNS106 as a template, the two homologous arm fragments of about 2000 bp in length upstream and downstream of the orf35-38 (i.e., dpgABCD) gene were amplified by PCR. At the same time, the pYH7 vector was digested with restriction endonucleases EcoRV and NdeI to obtain a linearized vector. Then, the linearized vector was recombinated with the two homologous arm fragments using the homologous recombination one-step cloning method to obtain the recombinant plasmid pJLL8.

[0084] Using the helper strain ET12567 / pUB307, pJLL8 was transferred into strain JL12 via triparental conjugation to obtain a single-exchange strain. After relaxation culture and homologous double exchange through resistance screening, PCR amplification of the target band was performed using primers Δorf35-38_F / R. The size of the amplified band and sequencing verification were used to obtain strain JL13 with orf35-38 correctly knocked out.

[0085] (5) Construct the gene knockout plasmid pJLL9 for knocking out orf9-11 in the ristocetine gene cluster. According to the steps (2) and (3) above, the genomic DNA of *Amycosis fungoides* TNS106 was used as a template to amplify two homologous arm fragments of about 2000 bp upstream and downstream of the orf4-11 (i.e., asrR and mbtH) gene by PCR. At the same time, the pYH7 vector was digested with restriction endonucleases EcoRV and NdeI to obtain a linearized vector. Then, the linearized vector was recombinated with the two homologous arm fragments using the homologous recombination one-step cloning method to obtain the recombinant plasmid pJLL9.

[0086] Using the helper strain ET12567 / pUB307, ET12567 / pJLL9 was transferred into the JL3 strain via conventional triparental conjugation. After homologous double crossover resistance screening, PCR amplification of the target band was performed using primers Δorf9-10_F / R. The size of the amplified band and sequencing verification were then performed to obtain the strain JL4 with orf9-11 correctly knocked out.

[0087] Table 1. Primers used in Example 1

[0088]

[0089]

[0090] Table 2. Strains used in Example 1

[0091]

[0092] [1]: Liu K, Hu

[0093] Table 3. Plasmids used in Example 1

[0094]

[0095] [2]: Sun Y, Hong H, Sarnboskyy M, Mironenko T, Leadlay PF, et al. Organizatio n of the biosynthetic gene cluster in Streptomyces sp DSM4137 for the novel neurop rotectant polyketide meridamycin[J]. Microbiology, 2006, 152: 3507-3515.

[0096] [3]: Flett F, Mersinias V, Smith CP. High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes[J]. FEMS Microbiology Letters, 1997, 155(2): 223-229.

[0097] Example 2: Construction and conjugation transfer of pJLL10 plasmid

[0098] Construction of the gene expression regulatory plasmid pJLL10 as follows Figure 2 As shown, the pJLK96 plasmid DNA was digested with KpnI and NdeI enzymes, and the kanamycin resistance gene neo was replaced with the hygromycin resistance gene hyg to obtain the plasmid pJLL10.

[0099] Specifically, the kanamycin resistance gene of the pJLK96 plasmid was removed by digestion with KpnI and NdeI enzymes. The vector fragment was purified and recovered by gel electrophoresis and ligated with the hygromycin resistance Hyg amplified by PCR to obtain the bbr expression plasmid pJLL10 containing the hygromycin resistance gene. PCR detection and verification were performed using primers pJLL10_F and R.

[0100] The pJLL10 plasmid was electroporated into Escherichia coli ET12567 to obtain strain ET12567 / pJLL10. pJLL10 was then transferred into strain JL4 via triparental conjugation to obtain chassis strain JL5.

[0101] Table 4. Plasmids used in Example 2

[0102]

[0103] Table 5. Primers used in Example 2

[0104] Primers sequence pJLL10_F GCCGTTCAGCTTCGGTAGTTCG(SEQ ID NO.31) pJLL10_R GAAGGTCGTTGCAATGGCGTTG(SEQ ID NO.32) 10_F CCCCAGAGGAACTGCGCC(SEQ ID NO.33) 10_R CCCTGTTACTTCTCGACCGTATTGATTCG(SEQ ID NO.34)

[0105] Example 3: Direct cloning of the chloririmycin gene cluster and conjugation transfer of BAC plasmid

[0106] (1) The chloririmycin biosynthesis gene cluster was directly cloned from chromosome A. orientalis NRRL 18098 using the yeast transformation-associated recombination (TAR) method, such as... Figure 3 As shown.

[0107] (2) According to the TAR cloning system (reference PMID:31128791), A. orientalis NRRL 18098 genomic DNA (2-4 μg) digested with AflII and XbaI and pChloro-capture-ho ok plasmid DNA digested with PmeI were mixed and transformed into Saccharomyces cerevisiae VL6-48N protoplast cells. The chlorremomycin biosynthesis gene cluster (SEQ ID NO.2 to SEQ ID NO.8 linked in sequence) was cloned into pCGW plasmid (Xu et al, Nature Communications, 2022, 11(1):5232) using in vivo homologous recombination to obtain pChloroeremomycin plasmid.

[0108] (3) The BAC plasmid pChloroeremomycin of the chlorremomycin gene cluster was transformed into Escherichia coli ET12567 to obtain strain ET12567 / pChloroeremomycin. Using the helper strain ET12567 / pUB307, pChloroeremomycin was transformed into JL5 bacteria through triparental conjugation transfer to obtain heterologous expression strain JL6. PCR amplification of the target band was performed using primers pChloroeremomycin_F / R, and the size of the amplified band and sequencing were used to verify JL6.

[0109] Figure 4 This diagram illustrates the BAC plasmid pChloroeremomycin and the bbr expression plasmid pJLL10 in the chromosome of the engineered bacterium JL6; the top shows the BAC plasmid pChloroeremomycin integrated into the JL6 genome, and the bottom shows the pJLL10 plasmid integrated into the JL6 genome.

[0110] Table 6. Primers used in Example 3

[0111]

[0112] Example 4: Shake-flask small-scale fermentation of four strains

[0113] (1) Seed culture preparation: Two-stage seed culture was used for shake-flask fermentation. JL4, JL5 and JL6 were activated by MS solid plate culture (about 48h), and single colonies were picked and inoculated into 250mL grooved bottles containing 50mL TSBY medium. Culture conditions: 30℃, 220rpm, 48h.

[0114] (2) Fermentation production: The prepared seed culture was inoculated at a rate of 4% into a 250mL well-drained bottle containing 50mL of SAM medium. Fermentation conditions: 30℃ on a shaker, 220rpm, for 1d, 2d, 3d, 4d, 5d, 6d, 7d, 8d, and 9d respectively.

[0115] Example 5: Detection of fermentation broth (HPLC) and high-resolution mass spectrometry (MS) of JL4, JL5, and JL6

[0116] (1) HPLC detection: 1 mL of fermentation samples (JL4, JL5, and JL6) at fermentation times of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, and 9 days, respectively, were centrifuged at 12,000 rpm for 10 min to obtain the supernatant. After filtering the sample through a 0.22 μm filter membrane, 10 μL was injected for high-performance liquid chromatography (HPLC, Agile t 1260). A ZORBAX300SB-C18 reversed-phase column (5 μm, 4.6 × 250 mm) was used, with detection at 220 nm UV absorption. The mobile phase A was aqueous (with 0.5‰ formic acid added), and phase B was methanol (with 0.5‰ formic acid added). The analytical conditions were 0-23 min 5% B-25% B, with a flow rate of 0.6 mL / min. The retention time of the compound chloririmycin was approximately 17 min. Figure 5 The peak time was basically consistent with that of the purchased chloririmycin standard (Hubei Weishi Chemical Reagent Co., Ltd.).

[0117] (2) High-resolution mass spectrometry detection: The molecular weight of chloririmycin standard and JL6 fermentation product was accurately determined using a (6545LC / Q-TOF, Agilent 1290) liquid chromatography-mass spectrometry system with an injection volume of 1 μL.

[0118] Chloririmycin standard curve as shown Figure 7 High-resolution mass spectrometry of chloririmycin standard is shown in [reference needed]. Figure 8 A, Theoretical value of chlortetracycline [M+2H] 2+ m / z = 796.2624, observed value of chloririmol standard [M+2H] 2+ m / z = 796.2698; high-resolution mass spectra of JL6 sample are shown below. Figure 8 B, Theoretical value of chlortetracycline [M+2H] 2+ m / z = 796.2624, JL6 sample observation value [M+2H] 2+ m / z = 796.2696. The change in JL6 fermentation yield over time is shown in the figure. Figure 6 ,Depend on Figure 6 It can be seen that JL6 had the highest fermentation yield on day 8, reaching 1440 mg / L.

[0119] In summary, this invention knocks out the NRPS gene responsible for ristocetin biosynthesis in *Amycolatopsis sp.* TNS106 using genetic engineering techniques, and inserts a chemically synthesized integration site at the gene knockout location. and Sequences were obtained to acquire the heterologous expression host strain JL4; a shuttle plasmid pJLL10 containing the StrR family regulatory gene bbr from the balhimycin gene cluster was constructed and introduced into JL4, allowing pJLL10 to integrate / insert into the strain. The high-yielding chamomile strain JL5 was obtained through site selection (CGMCC No. 34227). The BAC plasmid pChloroeremomycin, containing the chlorremomycin biosynthesis gene cluster, was introduced into chamomile strain JL5, allowing pChloroeremomycin to integrate / insert into JL5. The high-yield engineered strain JL6 of chloriramycin was obtained through site selection (CGMCC No. 34228). Engineered strain JL6 achieved a chloriramycin yield of 1440 mg / L on day 8 of fermentation, significantly increasing the overall yield of chloriramycin.

[0120] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for constructing a chassis strain for high-yielding glycopeptide antibiotics, characterized in that, The method includes the following steps: S1. Knock out the NRPS gene responsible for ritoxadixyl biosynthesis in wild-type *Amylopectinobacterium* TNS106 and insert it into the integration site. and To obtain strains for heterologous expression of genes or gene clusters; S2. Introduce a plasmid carrying the bbr gene to obtain the chassis strain; the plasmid promotes the expression of the glycopeptide antibiotic biosynthesis gene cluster by changing the expression intensity of Bbr.

2. The method for constructing a chassis strain of a high-yield glycopeptide antibiotic strain according to claim 1, characterized in that, The NRPS gene responsible for ristocetine biosynthesis includes the orf4-11 and orf35-38 genes in the ristocetine gene cluster.

3. The method for constructing a chassis strain of a high-yield glycopeptide antibiotic strain according to claim 2, characterized in that, Step S1 includes: S1-1, Construct a system for knocking out the orf4-8 gene and add an integration site. as well as Gene substitution plasmid with sequence; the gene substitution plasmid was introduced into *Amylopectinobacterium* TNS106 via co-transfer between *Escherichia coli* and *Actinomyces* to obtain strain 1; S1-2. The recombinant plasmid used to knock out the orf35-38 gene was introduced into strain 1 to obtain strain 2. S1-3. The gene knockout plasmid used to knock out the orf9-11 gene is introduced into strain 2 to obtain the strain used for heterologous expression of the gene or gene cluster.

4. The method for constructing a chassis strain of a high-yield glycopeptide antibiotic strain according to claim 2, characterized in that, Step S1 includes: S1-1': Construct a structure for knocking out the orf4-11 gene and adding an integration site. as well as Gene substitution plasmid with sequence; the gene substitution plasmid was introduced into *Amylopectinobacterium* TNS106 via co-transfer between *Escherichia coli* and *Actinomyces*; strain 3 was obtained; S1-2', The recombinant plasmid used to knock out the orf35-38 gene is introduced into strain 3 to obtain the strain used for heterologous expression of the gene or gene cluster.

5. The method for constructing a chassis strain of a high-yield glycopeptide antibiotic strain according to claim 3 or 4, characterized in that, Includes at least one of the following technical features: A. The construction of the gene replacement plasmid, recombinant plasmid or gene knockout plasmid is carried out using the Escherichia coli-Streptomyces shuttle plasmid pYH7 as a vector. B. After the gene replacement plasmid, recombinant plasmid or gene knockout plasmid is introduced into the strain, the procedure also includes the steps of screening potential double-crossover mutant strains using resistance plates and extracting genomic DNA from the potential mutant strains for PCR verification and sequencing. C. Integration site The sequence is shown in SEQ ID NO.11; D. Integration site The sequence is shown in SEQ ID NO.

12.

6. The method for constructing a chassis strain of a high-yield glycopeptide antibiotic strain according to claim 1, characterized in that, In step S2, the plasmid carrying the bbr gene is obtained by digesting the pJLK96 plasmid DNA with KpnI and NdeI enzymes, and replacing the kanamycin resistance gene neo in pJLK96 with the hygromycin resistance gene hyg.

7. A chassis strain for constructing a high-yield glycopeptide antibiotic strain, obtained by the method of any one of claims 1-6.

8. A chassis strain for constructing a high-yield glycopeptide antibiotic strain, wherein the chassis strain is Amycolatopsis sp. JL5CGMCC No.34227.

9. A method for constructing a high-yield glycopeptide antibiotic strain, characterized in that, Introduce a bacterial artificial chromosome BAC plasmid containing a glycopeptide antibiotic biosynthesis gene cluster into the chassis strain as described in claim 7 or 8.

10. The method for constructing a high-yield glycopeptide antibiotic strain according to claim 9, characterized in that, The construction of the bacterial artificial chromosome BAC plasmid includes: obtaining a glycopeptide antibiotic biosynthesis gene cluster by yeast transformation and recombinant cloning; cloning the glycopeptide antibiotic biosynthesis gene cluster into the pCGW plasmid by in vivo homologous recombination in yeast, thereby obtaining the bacterial artificial chromosome BAC plasmid.

11. The method for constructing a high-yield glycopeptide antibiotic strain according to claim 9, characterized in that, The bacterial artificial chromosome BAC plasmid is a BAC plasmid containing the chloririmycin gene cluster.

12. A high-yield glycopeptide antibiotic strain obtained by the method of any one of claims 9-11.

13. A high-yield strain of chloriricum, wherein the strain is Amycolatopsis sp. JL6CGMCCNo.34228.

Images