Pinus massoniana pinocembrin methyltransferase gene, product and application
By cloning the pine bark methyltransferase gene and constructing a recombinant expression vector and engineered bacteria, the problems of complex and high cost in the production of bark methyl ether were solved, achieving rapid and efficient synthesis of bark methyl ether and enhancing the disease resistance of pine trees.
Patent Information
- Application Number
- CN202511250633.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-03
- Publication Date
- 2026-02-17
AI Technical Summary
In the existing technology, the methyltransferase of pinoresin from Masson pine and its biosynthetic gene have not been isolated and identified, resulting in a complex, cumbersome and costly process for producing pinoresin monomethyl ether.
The nucleotide and amino acid sequences of the pine syringin methyltransferase gene were cloned and determined. Amplification primer pairs were designed, and recombinant expression vectors and genetically engineered bacteria were constructed. These tools were used to rapidly synthesize syringin monomethyl ether.
This study enabled the simple and rapid utilization of the pine bark-pine methyltransferase gene, reduced production costs, increased the yield of bark-pine monomethyl ether, and enhanced the resistance of pine trees to pine wilt disease.
Smart Images

Figure CN121538231A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular biology, specifically to the pine bark methyltransferase gene, products, and uses of Masson pine. Background Technology
[0002] Masson pine (Pinus massoniana Lamb.) is an important afforestation tree species in subtropical regions of my country, characterized by drought resistance, rapid growth, and wide adaptability, possessing significant ecological and economic value. However, the invasion of pine wilt nematodes has led to the large-scale death of Masson pine forests, causing direct economic losses exceeding hundreds of billions of yuan and seriously threatening the sustainable development of forestry in my country. Plants constantly face attacks from pathogens (such as bacteria, fungi, and nematodes) in the natural environment. To cope with these invasions, plants have evolved multi-layered defense systems. Among these, phytotoxicants accumulate rapidly at the site of local infection, directly inhibiting pathogen growth and becoming a key component of plant immunity. Phytotoxicants exhibit rich diversity, typically including secondary metabolites such as phenols, flavonoids, terpenes, and alkaloids. They are synthesized through different types of metabolic pathways and directly participate in plant defense responses. Stilbene compounds are a large class of phenolic compounds, including stilbene and its derivatives, among which stilbenein and stilbenein monomethyl ether are mainly found in pine trees. Accumulation of pinoxaden monomethyl ether exhibits a high responsiveness to pine wood nematode infection, playing a crucial role in pine trees' defense against the nematode. However, the biosynthetic gene for pinoxaden methyltransferase in Masson pine has not yet been isolated and identified.
[0003] Patent CN119985779A discloses a method for constructing a characteristic spectrum of Pinus tabuliformis compound granules, the characteristic spectrum itself, and its applications. This patent utilizes the characteristic spectrum to study the material basis and properties of Pinus massoniana monomethyl ether, further investigating the product and laying the groundwork for future research. However, this patent only studies the spectral composition of the compound; it does not further investigate the Pinus massoniana pinoxadenine methyltransferase gene or the method for producing pinoxadenine monomethyl ether. Summary of the Invention
[0004] To address the gap in existing technologies regarding pinoresin methyltransferase and its biosynthetic gene in Pinus massoniana, and the problems of complex, cumbersome, lengthy, and costly processes in producing pinoresin monomethyl ether, this invention provides the pinoresin methyltransferase gene, product, and applications from Pinus massoniana.
[0005] The present invention is implemented using the following technical solutions: In a first aspect, the present invention provides a Pinus massoniana pinyin methyltransferase gene, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0006] This invention is the first to clone the pinyin pinyin methyltransferase gene from Pinus massoniana and determine its nucleotide and amino acid sequences, filling the gap in the prior art regarding the unknown pinyin pinyin methyltransferase and its biosynthetic gene in Pinus massoniana, and providing theoretical and basic support for related research on Pinus massoniana.
[0007] Secondly, the present invention provides a pair of primers for amplifying the *Pinus massoniana* pinoresin methyltransferase gene, wherein the primer pair is as follows: The forward primer is shown in SEQ ID NO.3: 5'-ATGCACATCCAAGCTGTGAACAA-3'; The reverse primer is shown in SEQ ID NO.4: 5'-TTAGGACTTGATTGCTTCAATAAC-3'.
[0008] The amplification primer pair provided by this invention can rapidly and accurately amplify the Pinus massoniana genus pine pine methyltransferase gene with good specificity and high efficiency.
[0009] Thirdly, the present invention provides a Pinus massoniana pinyin methyltransferase encoded by the above-mentioned gene, the amino acid sequence of which is shown in SEQ ID NO.2.
[0010] Fourthly, the present invention provides a recombinant expression vector containing a gene containing pinoresin methyltransferase from Pinus massoniana.
[0011] Furthermore, the recombinant expression vector includes an expression vector or a cloning vector.
[0012] By recombining the pine syringin methyltransferase gene into an expression vector or cloning vector to construct a biological module, the pine syringin methyltransferase gene can be easily and rapidly utilized to obtain the target gene or target protein in large quantities.
[0013] Furthermore, the expression vector includes pET-32a, and the cloning vector includes pMD20-T.
[0014] Fifthly, the present invention provides a genetically engineered bacterium containing the pine bark methyltransferase gene of Pinus massoniana.
[0015] By placing the pine bark methyltransferase gene in host cells, the target gene and target protease can be obtained rapidly and in large quantities. The biological module composed of engineered bacteria avoids the cumbersome operation of PCR amplification from the pine genome when using the target gene.
[0016] Furthermore, the host cells of the genetically engineered bacteria include Escherichia coli DH5α or Escherichia coli BL21.
[0017] In a sixth aspect, the present invention provides the application of the aforementioned pine pine methyltransferase gene, or pine pine methyltransferase, or recombinant expression vector, or genetically engineered bacteria in the production of pine pine monomethyl ether.
[0018] In this invention, the pine pine methyltransferase can catalyze the synthesis of pine pine monomethyl ether using pine pine as a substrate. Pine pine monomethyl ether is of great significance for the protection of pine trees against pine wilt disease. It is understood that the target product, pine pine monomethyl ether, can be prepared using the pine pine methyltransferase with pine pine as a substrate.
[0019] The recombinant vector and engineered bacteria provided by this invention can be directly cultured, amplified and expressed to obtain Pinus massoniana pinyin methyltransferase. The large amount of active Pinus massoniana pinyin methyltransferase obtained can be used to produce pinyin monomethyl ether.
[0020] Furthermore, the pine pine methyltransferase is used to catalyze pine pine methyltransferase to produce the pine pine monomethyl ether.
[0021] The present invention has the following beneficial effects: (1) This invention cloned the pinyin pinyin methyltransferase gene from Pinus massoniana for the first time and determined its nucleotide sequence and amino acid sequence, filling the gap in the prior art of the unknown pinyin pinyin methyltransferase and its biosynthetic gene in Pinus massoniana, and providing theoretical and basic support for related research on Pinus massoniana.
[0022] (2) This invention obtains a recombinant vector and engineered bacteria by recombination of the pine syringin methyltransferase gene, and successfully purifies the pine syringin methyltransferase. In the in vitro enzyme activity experiment, the enzyme can catalyze the synthesis of syringin monomethyl ether from syringin, which is of great significance for pine trees to resist pine wilt disease. Attached Figure Description
[0023] Figure 1 This is a PCR gel electrophoresis image of the pine syringin methyltransferase gene from Pinus massoniana.
[0024] Figure 2 Image for SDS-PAGE analysis of pine bark methyltransferase protein induced and purified; from left to right, note: lane 1: protein after induction; lane 2: lysed precipitate; lane 3: lysed supernatant; lane 4: protein eluted with 5% imidazole; lane 5: marker; lane 6: protein eluted with 30% imidazole; lane 7: protein eluted with 30% imidazole in the second tube; lane 8: protein eluted with 100% imidazole.
[0025] Figure 3 A bar chart for UPLC-MS detection of pine ether monomethyl ether. Detailed Implementation
[0026] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.
[0027] Example 1: Cloning the Pinus massoniana pinicola methyltransferase gene, constructing a cloning vector and transforming it into prokaryotic cells. 1. RNA was extracted from the stem tissue of *Pinus massoniana*: cDNA was synthesized using reverse transcription with the PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara, code: 6210A). The following primers were used as a template for amplification: The forward primer is shown in SEQ ID NO.3: 5'-ATGCACATCCAAGCTGTGAACAA-3' (SEQ ID NO.3); The reverse primer is shown in SEQ ID NO.4: 5'-TTAGGACTTGATTGCTTCAATAAC-3' (SEQ ID NO.4).
[0028] 2. PCR amplification: PCR amplification was performed using Phanta Max Super-Fidelity DNA polymerase from Vazyme.
[0029] The PCR conditions were: 95℃ for 3 min; 95℃ for 15 s; 55℃ for 15 s; 72℃ for 1.5 min; 35 cycles; extension at 72℃ for 5 min.
[0030] 3. Agarose gel electrophoresis detection: PCR products were detected by 1% agarose gel electrophoresis, and the results are as follows. Figure 1 As shown, where, Figure 1 M is DNA marker DL2000, and the fragment size of the target gene, the pine pine methyltransferase gene, is approximately 1137 bp, which is in line with expectations.
[0031] 4. Gene fragment recovery: The target gene fragment was recovered using an agarose gel electrophoresis recovery kit. The target fragment was then TA cloned, ligated into the pMD20-T vector, and then transformed into Escherichia coli DH5α clone strain.
[0032] The transformation conditions were as follows: 5 μL of ligation product was added to 50 μL of competent cells, gently mixed, and incubated on ice for 25 min. The cells were then subjected to heat shock in a 42°C water bath for 45 s, followed by an immediate ice bath and incubation for 2 min. 500 μL of antibiotic-free LB medium was added, mixed, and the cells were incubated at 37°C and 200 rpm for 1 h. The bacterial culture was centrifuged at 3000 rpm for 1 min, 400 μL of supernatant was discarded, the bacterial culture was resuspended, and spread onto solid LB plates containing antibiotics (Amp). The cells were then incubated upside down at 37°C for 12-16 h.
[0033] 5. Clone Screening: Positive clones were screened using colony PCR. The screening method was as follows: a single colony was randomly picked from the transformation plate and placed in liquid culture medium in a 1.5 ml centrifuge tube for incubation. Each tube was numbered, and 1 μL of each tube was used as a template for PCR detection. The remaining culture was stored at 4℃. Positive colonies were stored on plates or in glycerol tubes for later use.
[0034] The pine pine syringin methyltransferase gene was successfully cloned through sequencing. Its nucleotide sequence is shown in SEQ ID NO. 1, containing 1137 bases and encoding 378 amino acids, the amino acid sequence of which is shown in SEQ ID NO. 2. Simultaneously, the pine pine syringin methyltransferase gene was inserted into the pET-32a recombinant vector, and the recombinant vector was successfully transformed into positive engineered prokaryotic Escherichia coli DH5α.
[0035] Example 2: Construction of expression vector for pine methyltransferase gene and transformation into prokaryotic cells 1. The target fragment cloned in Example 1 was transformed into the pET32a linearized vector by homologous recombination.
[0036] The ligation reaction conditions were as follows: After mixing the reaction system, incubate at 37°C for 30 min, then at 20°C for 1 h. Add 5 μL of the reaction solution to 50 μL of E. coli DH5α competent cells, mix well, and incubate on ice for 30 min. Gently remove the cells, heat shock at 42°C for 60 s, immediately incubate on ice for 2 min, add 500 μL of LB medium, and incubate at 37°C for 1 h. Spread 100 μL of the bacterial culture onto LB plates containing Kan resistance and incubate overnight.
[0037] Positive colonies selected from antibiotic (Kan) screening were used to extract plasmids. The prokaryotic expression vector was transformed into *Escherichia coli* strain BL21 and cultured at 37°C and 200 rpm until OD500 was reached. 600 The concentration was 0.6. A final concentration of 0.1 mM IPTG was added to the culture medium in the test tubes, and then the tubes were incubated at 15℃ and 37℃ respectively to induce expression, resulting in a large amount of bacterial culture expressing Pinus massoniana pinicola methyltransferase.
[0038] Example 3: Prokaryotic expression, protein purification, and protein detection of Pinus massoniana pinicola methyltransferase Select single colonies containing recombinant plasmids from Example 2 and incubate them in 3 mL of LB liquid medium (ampicillin resistant) at 37°C overnight, then preserve them at -20°C.
[0039] Select single colonies containing the recombinant plasmid and add them to 3 mL of LB liquid medium (ampicillin resistant), then incubate at 37°C with shaking until OD reaches 1.5. 600 Approximately 0.6 μL of bacterial culture was used as a control group. The remaining bacterial culture was incubated with IPTG inducer (final concentration 1 mM) at 37°C with shaking for 3 h. 0.15 mL of each bacterial culture was centrifuged at 12000 × g for 2 min. The bacterial pellet was resuspended in 40 μL of 1 × loading buffer for lysis, and analyzed by SDS-PAGE. Results are as follows: Figure 2 As shown, lane 1: post-induction; lane 2: lysed pellet; lane 3: lysed supernatant; lane 4: 5% imidazole eluted protein; lane 5: marker; lane 6: 30% imidazole eluted protein; lane 7: 30% imidazole second tube eluted protein; lane 8: 100% imidazole eluted protein.
[0040] Take 100 μL of the bacterial culture stored at -20℃ and inoculate it into 100 mL of LB liquid medium (ampicillin resistant) and culture overnight with shaking; take 100 mL of the bacterial culture and inoculate it into 2000 mL of LB liquid medium, and culture at 37℃ until OD reaches the target value. 600 Approximately 0.6, lower the culture temperature to 30℃; add IPTG inducer to a final concentration of 0.5mM, and continue to culture at 30℃ with shaking for 3 h; collect the bacterial cells by centrifugation at 8000rpm for 3 min, resuspend in 50mL of pre-cooled NTA-0 buffer, and incubate on ice for 30 min.
[0041] The bacterial cells were disrupted by ultrasonication with the following parameters: power 200W, operation time 3s, pause time 4s, and 99 cycles. The cells were centrifuged at 16000rpm at 4℃ for 50min, and the supernatant and precipitate were collected. A small amount of the supernatant and precipitate were taken for SDS-PAGE analysis, and the remaining supernatant and precipitate were stored at 4℃ for later use.
[0042] The supernatant protein solution was filtered through a 0.22µm filter and set aside. A Ni-NTA column was prepared. The supernatant protein solution was loaded onto the column at a flow rate of 1 ml / min. The column was washed with NTA-0 buffer (pH 8.0) until the eluent was free of protein (G250 detection solution did not change color). Elution was performed with 20 mM, 60 mM, 200 mM, and 500 mM imidazole, and the eluent was collected in fractions until the G250 detection solution did not change color. The column material was washed with 3 column volumes of deionized water, and the column was sealed with 20% ethanol. The collected eluent was analyzed by SDS-PAGE electrophoresis, and the pine pine methyltransferase was detected by Western spectroscopy. The results are as follows: Figure 2As shown, the target protein is 40.86 kD, the tag is 15 kD, and the fusion protein is approximately 55.86 kD.
[0043] Example 4: Biochemical function of pinoresin methyltransferase from Masson pine Using pine bark extract as a substrate, the enzymatic reaction system was as follows: Tris-HCl, 100 mM, pH 7.5; SAM, 10 μmM; pinosylvin, 10 μmM; 5 μg of purified pine bark extract methyltransferase was added and the reaction was carried out at 30℃ for 1 h. This was the experimental group, and three experimental groups were set up. The control group did not contain the purified pine bark extract methyltransferase.
[0044] After the reaction was completed, 5 mL of methanol was added, and the mixture was extracted by sonication for 1 h. 2 mL of the supernatant was transferred to a 2 mL centrifuge tube, centrifuged at 12000 r / min for 5 min, and filtered through a 0.22 μm organic filter membrane for UPLC-MS analysis.
[0045] Detection method: UPLC-MS conditions: Column: Waters HSS T3 (2.1×100mm, 1.8μm); Mobile phase: 0.01% formic acid aqueous solution: acetonitrile; Injection volume: 1μL; Column temperature: 35℃; Ion source: ESI source; Scan mode: negative ion mode; Ion source temperature: 120℃; Capillary voltage: 2.5kV; Detection mode: multiple reaction monitoring. Desolvation gas: 900L / h.
[0046] Experimental results: No pine resin monomethyl ether was detected in the control group, while the pine resin monomethyl ether content in the experimental groups was 145.0 μg / kg, 200.3 μg / kg, and 136.2 μg / kg, respectively. Figure 3 ).
Claims
1. A Pinus massoniana argentatin methyltransferase gene, characterized in that, The nucleotide sequence of the gene is shown as SEQ ID NO.
1.
2. The primer pair for amplification of the gene of methytransferase of taxifolin of Pinus massoniana according to claim 1, characterized in that, The amplification primer pair is as follows: The forward primer is shown as SEQ ID NO. 3: 5'- ATGCACATCCAAGCTGTGAACAA -3'; The reverse primer is shown as SEQ ID NO. 4: 5'- TTAGGACTTGATTGCTTCAATAAC -3'.
3. The gene encoded Pinus massoniana argyrophaein methyltransferase of claim 1, characterized in that, The amino acid sequence of the Pinus massoniana taxifolin methyltransferase is shown as SEQ ID NO.
2.
4. A recombinant expression vector containing the gene of the Pinus massoniana taxifolin methyltransferase according to claim 1.
5. A recombinant expression vector as claimed in claim 4, wherein, The recombinant expression vector includes an expression vector or a cloning vector.
6. A recombinant expression vector as claimed in claim 5, wherein, The expression vector includes pET-32a, and the cloning vector includes pMD20-T.
7. A genetically engineered bacterium containing the Pinus massoniana taxifolin methyltransferase gene according to claim 1.
8. The genetically engineered bacterium as described in claim 7, characterized in that, The genetically engineered bacterium further includes a host cell, and the host cell includes Escherichia coli DH5α or Escherichia coli BL21.
9. Use of the Pinus massoniana taxifolin methyltransferase gene according to claim 1, the Pinus massoniana taxifolin methyltransferase according to claim 3, the recombinant expression vector according to claim 4, or the genetically engineered bacterium according to claim 7 in the production of taxifolins monomethyl ether.
10. A method of producing pinocembrin monomethyl ether, characterized by, The Pinus massoniana taxifolin methyltransferase according to claim 3 is used to catalyze taxifolin to produce the taxifolins monomethyl ether.
Citation Information
Patent Citations
Construction method of specific chromatogram of pinus tabulaeformis knot formula granules, specific chromatogram and application of specific chromatogram
CN119985779A