Slow obstructive pulmonary disease susceptibility gene combined detection micro-fluidic chip and evaluation scheme

Abstract

The invention provides a chronic obstructive pulmonary disease susceptibility gene combination detection micro-fluidic chip and an evaluation scheme, and the disease risk level is prompted for screened positive people, so that the risk people can find clinical means for detection or intervention before the disease is attacked. According to the scheme provided by the invention, effective screening of risk genes can be ensured, the micro-fluidic chip is adopted as a detection carrier, the screening mode is flexible, the manual requirement is low, and development of common medical units is facilitated.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, and in particular to a microfluidic chip for detecting a chronic obstructive pulmonary disease (COPD) susceptible gene combination and an evaluation scheme. BACKGROUND

[0002] Chronic obstructive pulmonary disease (COPD) is a chronic respiratory disease characterized by persistent airflow limitation, and genetic and environmental factors are involved in its development process. Early identification of high-risk groups of COPD and intervention is an important part of COPD prevention and control.

[0003] At present, the high-risk population is screened by a combination of screening questionnaires and lung function tests. Although lung function test is the gold standard for the diagnosis of COPD, it is strongly dependent on equipment, has low popularization rate in the primary level, and cannot identify the early development process of COPD, and is also affected by other lung diseases. The screening effect of the questionnaire screening method commonly used in the primary level is poor due to the low awareness rate of COPD knowledge and weak health consciousness of the primary population.

[0004] Based on the above background, it is of great biological and clinical significance to find COPD susceptible genes and SNPs that can be used for COPD susceptible population screening and risk assessment. SUMMARY

[0005] To solve the above problems, the present application provides a microfluidic chip for detecting a chronic obstructive pulmonary disease (COPD) susceptible gene combination and an evaluation scheme, which is used for screening and risk assessment of COPD susceptible genes, including a microfluidic chip (IMAP) for genetic polymorphism detection and a PRS (polygenic risk assessment model) for evaluating the risk of COPD. Population studies have confirmed 23 gene loci associated with COPD susceptibility, and a risk assessment model is constructed for screening and risk prompting. For the positive population screened, the disease risk level is prompted, so that the risk population can seek clinical detection or intervention before the disease occurs.

[0006] To achieve the above purpose, the specific technical scheme provided by the present application is as follows:

[0007] The application provides a reagent for detecting a SNP site genotype in a sample in the preparation of a product for screening and / or risk assessment of a susceptible population of chronic obstructive pulmonary disease, wherein the SNP site is a combination of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, and rs2910164.

[0008] As an optional embodiment, the SNP site is a combination of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, rs2910164, and rs2568494.

[0009] As an optional embodiment, the SNP site is a combination of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, rs2910164, and rs7041.

[0010] As an optional embodiment, the SNP site is a combination of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, rs2910164, rs2568494, rs7041.

[0011] Further, the product comprises reagents for detecting the genotype of the SNP site by one or more of nucleic acid hybridization techniques, nucleic acid amplification techniques, sequencing techniques.

[0012] In some embodiments, the reagent is a probe that specifically recognizes the genotype of the SNP site; or, the reagent is a primer that specifically amplifies the gene fragment where the SNP site is located.

[0013] In the present application, the term "probe" refers to a molecule that selectively binds to a particular intended SNP site, such as a nucleotide transcript or protein encoded by or corresponding to an endogenous gene. The probe can be synthesized by a person skilled in the art, or can be from a suitable biological preparation. The probe can be specifically designed to be labeled. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, protein, antibody, and organic molecule.

[0014] In the present application, the term "primer" refers to a single-stranded polynucleotide that can hybridize to a nucleic acid and allow the polymerization of the complementary nucleic acid, generally by providing a free 3'-OH group.

[0015] Further, the sequence of the primer is shown in SEQ ID NO: 1-69.

[0016] In the context of the present application, the term "sample", as used, refers to a composition obtained or derived from a subject (e.g., an individual of interest) that comprises cellular and / or other molecular entities to be characterized and / or identified according to, for example, physical, biochemical, chemical, and / or physiological characteristics. For example, a sample refers to any sample derived from a subject of interest, which is expected or known to comprise cellular and / or molecular entities to be characterized.

[0017] In some embodiments, the sample comprises nucleic acid from the subject.

[0018] Further, the sample is selected from peripheral blood, saliva, oral swab, nasal swab, dried blood spot, urine, cerebrospinal fluid.

[0019] Further, the sample is peripheral blood or a buccal swab.

[0020] In some embodiments, the product comprises at least one of a kit, a chip, a nucleic acid membrane strip, a system, a device, a readable medium, a program.

[0021] The term "chip" also referred to as "array" refers to a solid support comprising attached nucleic acid or peptide probes. An array typically comprises a plurality of different nucleic acid or peptide probes attached to the surface of a substrate at different known locations. The array can comprise a flat surface, or can be nucleic acids or peptides on beads, gels, polymeric surfaces, fibers such as optical fibers, glass, or any other suitable substrate. The array can be packaged in a manner that allows diagnostic or other manipulation of the full functional device.

[0022] A "microarray" is an ordered arrangement of hybridization array elements, such as polynucleotide probes (e.g., oligonucleotides) or binding agents (e.g., antibodies), on a substrate. The substrate can be a solid substrate, e.g., a glass or silica slide, a bead, a fiber optic adhesive, or a semi-solid substrate, e.g., a nitrocellulose membrane. The nucleotide sequences can be DNA, RNA, or any permutation thereof.

[0023] In the present invention, a "nucleic acid membrane strip" comprises a substrate and oligonucleotide probes immobilized on the substrate; the substrate can be any substrate suitable for immobilizing oligonucleotide probes, including but not limited to nylon membrane, nitrocellulose membrane, polypropylene membrane, glass slide, silica gel chip, microscale magnetic beads.

[0024] In the present invention, the term "kit" includes reagents for detecting the genotype of the SNP locus according to the first aspect of the present invention, and one or more substances selected from the group consisting of a container, an instruction manual, a positive control, a negative control, a buffer, an adjuvant, or a solvent. The components of the kit can be packaged in an aqueous medium or in a lyophilized form. The appropriate containers to be used in the kits are intended to be at least one vial, test tube, flask, bottle, syringe, or other container, into which a component can be placed, and preferably, suitably aliquoted. Where

[0025] In some embodiments, the kit comprises a probe or primer.

[0026] Further, the kit further comprises one or more of a sample pretreatment reagent, a calibrator, a quality control, a diluent.

[0027] In some embodiments, the chip comprises a probe or a primer.

[0028] Further, the chip comprises at least one of a microfluidic chip, a microarray chip, a fiber-optic bead chip, a liquid phase chip, an in-situ synthesis chip.

[0029] Further, the chip is a microfluidic chip.

[0030] In the present application, the term "microfluidic chip" refers to a chip that can manipulate microscale fluid on the chip to carry out various functions of conventional physical, chemical or biological experiments, and the channel size on the chip can be in the order of micrometers (μm) or even nanometers (nm).

[0031] The second aspect of the present application provides a product for screening and / or risk assessment of a susceptible population of chronic obstructive pulmonary disease, the product comprising a reagent for detecting the genotype of a SNP site in a sample, the SNP site being the SNP site described in the first aspect of the present application.

[0032] In some embodiments, the sample comprises nucleic acid from a subject.

[0033] Further, the sample is selected from peripheral blood, saliva, oral swab, nasal swab, dried blood spot, urine, cerebrospinal fluid.

[0034] Further, the sample is peripheral blood or an oral swab.

[0035] As an optional embodiment, the product is a microfluidic chip, and the microfluidic chip comprises KASP amplification reagents and primers that specifically amplify the gene fragment in which the SNP site described in the first aspect of the present application is located.

[0036] Further, the microfluidic chip has at least 21 reaction wells, and each reaction well has primers that specifically amplify the gene fragment in which the SNP site described in the first aspect of the present application is located.

[0037] Further, the microfluidic chip has at least 23 reaction wells, and each reaction well has primers that specifically amplify the gene fragment in which the SNP site described in the first aspect of the present application is located.

[0038] In a specific embodiment of the present application, the microfluidic chip has at least 28 reaction wells, and 23 of the 28 reaction wells have primers that specifically amplify the gene fragment in which the SNP site described in the first aspect of the present application is located.

[0039] Further, the microfluidic chip further comprises a buffer.

[0040] Further, the buffer solution is 1x TE buffer solution.

[0041] Further, the sequence of the primer is shown as SEQ ID NO: 1-69.

[0042] The third aspect of the present application provides a method for constructing a chronic obstructive pulmonary disease multi-gene risk assessment model, and the steps of the method include: obtaining SNP site genotype data and subject clinical characteristics in a sample according to the first aspect of the present application; and constructing a multi-gene risk assessment model based on SNP site genotype data and subject clinical characteristics by an algorithm.

[0043] Further, the subject clinical characteristics include a population of people with chronic obstructive pulmonary disease and a healthy population.

[0044] Further, the algorithm includes one or more of a random forest model, a Cox risk regression model, principal component analysis, a deep neural network, a generalized linear model, logistic regression analysis, LASSO regression analysis, nearest neighbor analysis, a support vector machine, and a neural network model.

[0045] Further, the algorithm is a random forest model.

[0046] In some embodiments, the method for constructing a multi-gene risk assessment model belongs to the known art of those skilled in the art, and the steps of associating SNP site genotypes with a certain possibility or risk can be implemented and realized in different ways. Preferably, the determination results of SNP site genotypes are combined mathematically, and the scores of different genotypes are associated with the fundamental risk assessment problem. The determination results of SNP site genotypes can be combined by any suitable prior art mathematical method, and a multi-gene risk assessment model is constructed by an algorithm.

[0047] The fourth aspect of the present application provides a chronic obstructive pulmonary disease multi-gene risk assessment system, and the system includes the following modules: an acquisition module configured to acquire SNP site genotype data in a sample according to the first aspect of the present application; a processing module configured to input the SNP site genotype data in the sample according to the first aspect of the present application into a chronic obstructive pulmonary disease multi-gene risk assessment model constructed by the method according to the third aspect of the present application for analysis, and obtain an analysis result; and an output module configured to output the analysis result.

[0048] The present disclosure provides systems programmed to implement the methods of the present disclosure. The systems are programmed or otherwise configured to analyze sequence data, construct expression matrices for genes. The systems can regulate various aspects of the sequence analysis of the present disclosure, such as, for example, matching data to known sequences. The systems can be electronic devices of a user or computer systems remotely located with respect to the electronic devices. The electronic devices can be mobile electronic devices.

[0049] The fifth aspect of the present disclosure provides a computer device for chronic obstructive pulmonary disease polygenic risk assessment, the computer device comprising a memory and a processor, the memory for storing a computer program.

[0050] The processor executes the computer program, which, when executed, implements a method comprising: obtaining data, for obtaining SNP locus genotype data in a sample as described in the first aspect of the present disclosure; processing data, for inputting the SNP locus genotype data in the sample as described in the first aspect of the present disclosure into a chronic obstructive pulmonary disease polygenic risk assessment model constructed by the method described in the third aspect of the present disclosure for analysis, obtaining an analysis result; outputting results, for outputting the analysis result.

[0051] The sixth aspect of the present disclosure provides a computer program product comprising a computer program for chronic obstructive pulmonary disease polygenic risk assessment, which, when executed by a processor, implements a method comprising: obtaining data, for obtaining SNP locus genotype data in a sample as described in the first aspect of the present disclosure; processing data, for inputting the SNP locus genotype data in the sample as described in the first aspect of the present disclosure into a chronic obstructive pulmonary disease polygenic risk assessment model constructed by the method described in the third aspect of the present disclosure for analysis, obtaining an analysis result; outputting results, for outputting the analysis result.

[0052] It should be understood that the systems, devices and methods described herein can be implemented in other ways. For example, the system embodiments described above are merely illustrative, and the division of the modules is merely a logical functional division. In actual implementation, other division manners can be used, for example, multiple modules or components can be combined or integrated into another system, or some features can be omitted or not executed. In addition, the coupling or direct coupling or communication connection between the displayed or discussed modules can be indirect coupling or communication connection through some interfaces, devices or modules, which can be electrical, mechanical or other forms.

[0053] The advantages and beneficial effects of the present application are: 1. The microfluidic chip is used as a detection carrier, and the covered genes and SNP sites are more, which ensures effective screening of risk genes. 2. The microfluidic chip is used as a detection carrier, and the detection flux is much higher than that of conventional lung function and other methods. 3. The risk assessment is carried out by using automatic analysis software and multi-gene risk assessment (PRS) model, which reduces the requirement of manual operation. 4. The genetic screening method is flexible, which can be self-checked or sent out, and the result can be obtained in only 4 hours, which is beneficial to the development of ordinary medical units. BRIEF DESCRIPTION OF DRAWINGS

[0054] Figure 1 The figure is the test result of the primer for the 1st-23rd sites.

[0055] Figure 2 The figure is the test result of the supplementary primer for the 4th, 10th and 23rd sites.

[0056] Figure 3 The figure is the result of verifying the accuracy of the primer.

[0057] Figure 4 The figure is the test result of the primer for the 24th-26th sites and the test result of the expanded sample size for the 21st site.

[0058] Figure 5 The figure is the result of verifying the accuracy of the primer.

[0059] Figure 6 The figure is the result of verifying the accuracy of the primer for the 15th site by sanger sequencing.

[0060] Figure 7 The figure is the test result of the primer for the 27th and 28th sites.

[0061] Figure 8 The figure is the performance evaluation result of the multi-gene risk assessment model.

[0062] Figure 9 The figure is the ROC curve of the risk assessment verification of the 23 SNPs combination for the clinical sample of chronic obstructive pulmonary disease. DETAILED DESCRIPTION

[0063] The technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0064] Example 1 SNP site combination

[0065] I. SNP site screening

[0066] 1. Collecting the literature and guidelines related to COPD and screening the data according to the research population and results in the literature: Collect the latest expert consensus and guidelines, and refer to the genes and literature related to COPD susceptibility in the guidelines, and determine the genes related to COPD susceptibility in the Chinese guidelines; 467 articles related to COPD susceptibility were collected in the pubmed and China National Knowledge Infrastructure databases. Among them, 138 articles related to Chinese Han population involved 229 sites. Excluding repeated, non-statistically significant, less than 500 in the test population, inconsistent results between articles, no negative control group data, and referring to expert consensus or Chinese guidelines (2024 edition), excluding genes unrelated to oxidative stress, inflammatory response, proteinase / anti-proteinase imbalance, lung development, and autoimmune regulation, 46 gene sites (SNP) were left. According to the OR value in the literature, the SNPs with larger OR values were tested first. A total of 28 SNPs were tested (Table 1).

[0067] Table 1. 28 SNP site numbers

[0068]

[0069] 2. Primers for sites 1-23

[0070] 1) The experimental materials are shown in Table 2.

[0071] Table 2. Experimental materials-1

[0072]

[0073] 2) Methods

[0074] 1. Dot COPD IMAP chip

[0075] 1.1 Use 1x TE buffer to prepare mixed primers for each site F1, F2, and R primers with a final concentration of 0.5 μM: 0.5 μM: 1.25 μM.

[0076] 1.2 Dot the mixed primers of each site in the reaction wells of the IMAP chip according to 0.28 μL / well in order.

[0077] 1.3 Seal the film of the dried chip with a heat sealer. The chip after sealing is the COPD IMAP chip.

[0078] 2. Detection

[0079] 2.1 Mix the qualified nucleic acid samples after extraction, 1x TE buffer (blank control) and KASP reagent 20 μL: 20 μL uniformly, and load into the sample wells of the IMAP chip, respectively.

[0080] 2.2 Seal the sample inlet and outlet holes of the IMAP chip, and then put it into the centrifugal blocking all-in-one machine for centrifugation and blocking. The centrifugation will throw the sample and KASP reagent into the reaction hole, and the blocking will close the channel of the reaction hole, resulting in a completely closed and independent reaction hole.

[0081] 2.3 Put the sample-added IMAP chip into the flat plate PCR instrument for amplification reaction.

[0082] 2.4 Chip scanning and data processing: Put the amplified chip into the scanner to read the fluorescence detection results. Import the detection results into the COPD-risk software to obtain the genotyping results of each site.

[0083] 3) Experimental results: The results are shown in Figure 1 . The interpretation method is: red for homozygous type 1, yellow for heterozygous type, and green for homozygous type 2. From the test results: a, no amplification at the 4th site; b, the 5r1 primer set at the 5th site has better genotyping effect; c, the 9th, 10th, and 23rd sites need to analyze whether the primer sequence has non-specific amplification.

[0084] Analysis conclusion: a, the 9th site genome sequence is GGTA GCAGCAGC[A>G]GCAGCAGCCGCAGCCCGGAGG, and the primer cannot distinguish the SNP, so the site is discarded and no longer verified; b, redesign the primers of the 4th, 10th, and 23rd sites for verification.

[0085] 3, Supplementary primer test of the 4th, 10th, and 23rd sites

[0086] 1) Experimental materials and methods are the same as 2.

[0087] 2) Experimental results: The results are shown in Figure 2 . From the test results: a, the 4th, 10th, and 23rd sites are detected normally; b, the 15th and 21st sites only detect one type; and other sites detect at least two types.

[0088] Analysis conclusion: a, the 15th site has non-specific amplification on the genome, and the 21st site may have non-specific amplification; b, plasmid verification is needed; c, three sites (24-26) are supplemented for verification.

[0089] 4, Plasmid verification primer accuracy

[0090] 1) The experimental materials are shown in Table 3, wherein the plasmid is a custom plasmid for each site, and plasmid 1 corresponds to the homozygous wild genotype, and plasmid 2 corresponds to the homozygous mutant genotype. The method is the same as 2.

[0091] Table 3. Experimental materials-2

[0092]

[0093] 2) Experimental results: The results are as follows Figure 3 As shown, from left to right, the primers for plasmid 2 are 1000 copies / μL, 10000 copies / μL, and 100000 copies / μL; and the primers for plasmid 1 are 1000 copies / μL, 10000 copies / μL, and 100000 copies / μL. The detection results show that primers for all sites can be accurately genotyped.

[0094] 5. Primer test at positions 24-26 and sample size expansion test at position 21

[0095] 1) The experimental materials and methods are the same as in 2.

[0096] 2) Experimental results: The results are as follows Figure 4 As shown in the results, a) the detection results for sites 24-26 were normal; b) only one type was detected at site 21.

[0097] The analysis concluded that: a) non-specific amplification occurred at site 21 on the genome; b) the next step is to use Sanger sequencing to verify the accuracy of each primer group.

[0098] 6. Sanger sequencing to verify primer accuracy

[0099] 1) The experimental materials are shown in Table 4.

[0100] Table 4. Experimental Materials-3

[0101]

[0102] 2) Method

[0103] 1. Dilute the PCR primers with 1×TE buffer and prepare a primer mix with a final concentration of 5 μM.

[0104] 2. Prepare the reaction system according to Table 5.

[0105] Table 5. Reaction System

[0106]

[0107] 3. The PCR reaction procedure is shown in Table 6.

[0108] Table 6. PCR reaction procedure

[0109]

[0110] 3) Experimental results: Electrophoresis results are as follows Figure 5As shown, the Sanger sequencing results at site 15 are as follows: Figure 6 As shown. The analysis concluded that NB27 is homozygous GG type and NB46 is heterozygous GA type, which is inconsistent with the IMAP detection results. Looking at the peak diagram of Sanger sequencing, the high basal peaks in some regions may be due to non-specific amplification of homologous sequences in the genome. Additionally, site 21 was not sequenced, but it is speculated to be similar to site 15. Therefore, these two sites were discarded and no further verification was conducted. The detection results for other sites are consistent with the IMAP detection results.

[0111] 7. Supplement primer tests at sites 27 and 28.

[0112] 1) The experimental materials and methods are the same as in 2.

[0113] 2) Experimental results: The results are as follows Figure 7 As shown in the test results, the primers at positions 27 and 28 are normal.

[0114] 8. Risk assessment model construction and optimization

[0115] Based on the population distribution of genotypes in the disease and control groups in the literature, a preliminary risk assessment model was constructed. The risk assessment model was tested and optimized using the test results of 19 negative samples in this experiment. The optimized model was tested using the random forest method for different combinations of each locus. It was found that the influence coefficients of the three genotypes at loci 11 and 14 were not significantly different, so loci 11 and 14 were discarded and no further validation was performed.

[0116] Based on the test results of different combinations, the risk assessment model was reconstructed. The risk assessment model was tested and optimized using the test results of 16 negative samples from this experiment, and the final 23 SNP loci are shown in Table 7.

[0117] Table 7. Numbering of the 23 SNP sites used to construct the model

[0118]

[0119] 9. Model Performance Evaluation

[0120] 1) The experimental materials are shown in Table 8, and the method is the same as in 2.

[0121] Table 8. Experimental Materials-4

[0122]

[0123] 2) Experimental results are as follows Figure 8 As shown, a total of 64 people were tested (55 random samples), of which 9 were repeated tests, with a concordance rate of 100%.

[0124] 10. Nucleic acid mass spectrometry detection verification

[0125] 55 cases of random samples were verified for accuracy using nucleic acid mass spectrometry detection, and the sample detection results are shown in Tables 9-10. The consistency rate of nucleic acid mass spectrometry detection results with IMAP detection results was 100%.

[0126] Table 9. Clinical sample SNP site genotype detection results-1

[0127]

[0128]

[0129] Table 10. Random sample SNP site genotype detection results-2

[0130]

[0131]

[0132]

[0133] 11. Clinical sample verification

[0134] Before the start of this clinical trial, the investigator informed potential subjects in simple language about the purpose of the test, the process, the detection method, the intended result use, the risk of benefit, the cost burden, and the contact information of the ethics committee, and answered questions to ensure their understanding; after being fully informed, the subjects voluntarily signed the informed consent form, indicating their consent to participate. If you want to withdraw during the trial, you can inform the researcher at any time, and the withdrawal process will be carried out according to the rules and the relevant circumstances will be recorded.

[0135] 1) The source of the clinical samples was as follows: the control group was from the Linfen Central Hospital, and the inclusion criteria were: 1. Patients aged 45 years or older; 2. All patients were randomly selected and had no kinship; 3. ① had symptoms of chronic cough, sputum and dyspnea; ② FEV1 / FVC <0.7 after inhaling bronchodilators; ③ exclude other diagnoses.

[0136] The source of the clinical patient group was the Respiratory Department of Linfen Central Hospital, and the inclusion criteria were: 1. Patients aged 45 years or older; 2. All patients were randomly selected and had no kinship; 3. No respiratory symptoms, no lung imaging abnormalities, and normal lung function.

[0137] 2) 55 cases of positive samples and 55 cases of negative samples were verified clinically, and the clinical patient characteristics are shown in Table 11.

[0138] Table 11. Clinical patient characteristics

[0139]

[0140] 3) The experimental materials are shown in Table 12, and the method is as in 2.

[0141] Table 12. Experimental materials-5

[0142]

[0143] 4) The risk values calculated according to the risk assessment model of 55 COPD samples and 55 healthy control HC samples are shown in Table 13, and the data in Table 12 is analyzed using IBM SPSS Statistics 25, and the ROC curve is as shown in Figure 9 , and the AUC is 0.794711.

[0144] Table 13. Risk values of clinical samples

[0145]

[0146]

[0147] According to the analysis results, when the risk threshold is 0.6192, the sensitivity of the detection is 0.855, and the specificity is 0.6. According to the constructed model, the area under the curve (AUC) is shown in Table 14 when testing with / without the 27th / 28th site, so the combination of 23 SNPs, 21 SNPs (without C27, C28), 22 SNPs (without C27), and 22 SNPs (without C28) all have good performance in risk assessment of chronic obstructive pulmonary disease, and the combination of 23 SNPs has the best performance.

[0148] Table 14. AUC of different combinations in clinical sample verification

[0149]

[0150] The primer sequences used in the present application are shown in Table 15, and the specific composition of the primer set can be selected according to the site to be detected.

[0151] Table 15. Primer sequence list of 23 SNPs in the present application

[0152]

[0153]

[0154]

[0155]

[0156] The above description of the embodiments is only for understanding the method of the present application and its core idea. It should be noted that, for those skilled in the art, without departing from the principles of the present application, some improvements and modifications can be made to the present application, and these improvements and modifications will also fall within the protection scope of the claims of the present application.

Claims

1. The application of reagents for detecting SNP locus genotypes in samples in the preparation of products for screening and / or risk assessment of susceptible populations for chronic obstructive pulmonary disease, characterized in that, The SNP sites are combinations of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, and rs2910164.

2. The application according to claim 1, characterized in that, The SNP sites are combinations of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, rs2910164, and rs2568494; Preferably, the SNP sites are a combination of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, rs2910164, and rs7041. Preferably, the SNP sites are a combination of rs6495309, rs7689420, rs1695, rs9296092, rs161976, rs1800925, rs721917, rs1155002, rs1205, rs3025030, rs2736100, rs3736309, rs7671167, rs2070600, rs12922394, rs1038376, rs10759932, rs1800629, rs10873142, rs10519225, rs2910164, rs2568494, and rs7041.

3. The application according to claim 1, characterized in that, The product includes reagents for detecting SNP locus genotypes using one or more methods selected from nucleic acid hybridization technology, nucleic acid amplification technology, and sequencing technology; Preferably, the reagent is a probe that specifically recognizes the genotype of the SNP site; or, the reagent is a primer that specifically amplifies the gene fragment containing the SNP site. Preferably, the sequence of the primer is shown in SEQ ID NO:1-69.

4. The application according to claim 1, characterized in that, The sample included nucleic acids from the subject; Preferably, the sample is selected from peripheral blood, saliva, oral swabs, nasal swabs, dried blood spots, urine, and cerebrospinal fluid; Preferably, the sample is peripheral blood or an oral swab.

5. The application according to claim 1, characterized in that, The product includes at least one of the following: reagent kit, chip, nucleic acid membrane strip, system, device, readable medium, and program; Preferably, the kit comprises the probe of claim 3 or the primer of claim 3; Preferably, the kit further includes one or more of the following: sample pretreatment reagents, calibrators, quality control reagents, and diluents; Preferably, the chip includes the probe as described in claim 3 or the primer as described in claim 3; Preferably, the chip includes at least one of a microfluidic chip, a microarray chip, an optical fiber microbead chip, a liquid phase chip, and an in-situ synthesis chip; Preferably, the chip is a microfluidic chip.

6. A product for screening and / or risk assessment of susceptible populations for chronic obstructive pulmonary disease, characterized in that, The product includes a reagent for detecting the genotype of SNP sites in a sample, wherein the SNP sites are the SNP sites described in any one of claims 1-2; Preferably, the sample comprises nucleic acid from the subject; Preferably, the sample is selected from peripheral blood, saliva, oral swabs, nasal swabs, dried blood spots, urine, and cerebrospinal fluid; Preferably, the sample is peripheral blood or an oral swab; Preferably, the product is a microfluidic chip, which includes KASP amplification reagent and primers for specifically amplifying the gene fragment containing the SNP site as described in any one of claims 1-2; Preferably, the microfluidic chip has at least 21 reaction wells, each reaction well having primers that specifically amplify the gene fragment containing the SNP site as described in any one of claims 1-2; Preferably, the microfluidic chip has at least 23 reaction wells, each reaction well having primers that specifically amplify the gene fragment containing the SNP site as described in any one of claims 1-2; Preferably, the microfluidic chip has at least 28 reaction wells, and 23 of the 28 reaction wells contain primers that specifically amplify the gene fragment containing the SNP site as described in any one of claims 1-2. Preferably, the microfluidic chip further includes a buffer solution; Preferably, the buffer solution is a 1× TE buffer solution; Preferably, the sequence of the primer is shown in SEQ ID NO:1-69.

7. A method for constructing a multi-gene risk assessment model for chronic obstructive pulmonary disease, characterized in that, The method includes the following steps: obtaining SNP locus genotype data and subject clinical characteristics in the sample as described in any one of claims 1-2, and constructing a multi-gene risk assessment model based on the SNP locus genotype data and subject clinical characteristics using an algorithm. Preferably, the clinical characteristics of the subjects include individuals with chronic obstructive pulmonary disease and healthy individuals; Preferably, the algorithm includes one or more of the following: random forest model, Cox regression model, principal component analysis, deep neural network, generalized linear model, logistic regression analysis, LASSO regression analysis, nearest neighbor analysis, support vector machine, and neural network model; Preferably, the algorithm is a random forest model.

8. A multi-gene risk assessment system for chronic obstructive pulmonary disease, characterized in that, The system includes the following modules: The acquisition module is configured to acquire SNP locus genotype data as described in any one of claims 1-2 from the sample; The processing module is configured to input the SNP locus genotype data in any one of claims 1-2 from the sample into the chronic obstructive pulmonary disease multi-gene risk assessment model constructed by the method described in claim 7 for analysis, and obtain the analysis results; The output module is configured to output analysis results.

9. A computer device for multi-gene risk assessment of chronic obstructive pulmonary disease, characterized in that, The computer device includes a memory and a processor, the memory being used to store computer programs; The processor executes a computer program, which, when executed, implements the following method: Acquire data for obtaining SNP locus genotype data as described in any one of claims 1-2 in the sample; The data is processed to input the SNP locus genotype data in any one of claims 1-2 into the chronic obstructive pulmonary disease multigene risk assessment model constructed by the method described in claim 7 for analysis, and to obtain the analysis results; Output results, used to output analysis results.

10. A computer program product comprising a computer program for polygenic risk assessment of chronic obstructive pulmonary disease, characterized in that, When this computer program is executed by the processor, it implements the following method: Acquire data for obtaining SNP locus genotype data as described in any one of claims 1-2 in the sample; The data is processed to input the SNP locus genotype data in any one of claims 1-2 into the chronic obstructive pulmonary disease multigene risk assessment model constructed by the method described in claim 7 for analysis, and to obtain the analysis results; Output results, used to output analysis results.

Images