DNA molecular marker related to rice seedling stage cold-tolerant gene haplotype and application thereof

Abstract

The invention discloses a DNA molecular marker related to rice seedling stage cold-tolerant gene haplotype and application of the DNA molecular marker, and belongs to the technical field of functional molecular markers. The rice seedling stage cold-resistant gene OsCTS11 has three main linkage imbalance blocks. Through correlation analysis of low-temperature stress phenotypes and haplotypes, it is determined that Hap4 (GCACA) of LD BLOCK1, Hap3 (GAA) of BLOCK2 and Hap4 (GTTG) of BLOCK3 are dominant haplotypes. The KASP molecular marker developed on the basis of different haplotype SNP sites can be used for analyzing OsCTS11 genotypes in different rice materials, and breeding materials with seedling-stage cold resistance can be screened out through the molecular marker.

Description

Technical Field

[0001] This invention relates to the field of functional molecular marker technology, specifically to a DNA molecular marker related to a haplotype of a cold-resistant gene in rice seedlings and its application. Background Technology

[0002] Rice, one of the world's most important food crops, originated in tropical and subtropical regions and is extremely sensitive to temperate low-temperature environments, especially in the early seedling and reproductive stages. Low temperatures significantly impact its growth and development, leading to a 30%-40% reduction in yield. Studies have shown that low temperatures during the seedling stage disrupt rice photosynthesis, damage chloroplast structure and function, reduce chlorophyll content, and cause membrane lipid peroxidation and the accumulation of reactive oxygen species. Furthermore, low temperatures affect the activity of antioxidant enzymes, energy metabolism, and hormone balance in rice, exacerbating physiological damage. In China, cold damage frequently occurs in early rice growing areas in the middle and lower reaches of the Yangtze River, rice-growing areas in Northeast and Northwest China, double-cropping early rice areas in Sichuan, and single-cropping rice areas in the Yunnan-Guizhou Plateau. Especially severe cold snaps in spring often lead to serious seedling rot and death in early rice in the south. Moreover, with the earlier seedling raising time in some rice-growing areas, the risk of low-temperature stress during the seedling raising period for early rice in the south has further increased. Therefore, breeding and planting rice varieties with strong cold resistance is considered the most economical and effective way to address these challenges and is crucial for ensuring food security.

[0003] In recent years, with the rapid development of molecular biology and genomics technologies, significant progress has been made in the research of cold-resistance genes in rice seedlings. Currently, over 250 quantitative trait loci (QTLs) associated with cold tolerance have been identified; approximately 90 QTLs have been identified in the seedling stage. Since japonica rice is typically distributed in higher latitude and altitude regions, its cold tolerance is superior to that of indica rice; therefore, most of these QTLs originate from japonica rice, some from indica rice, and a small number from wild rice. However, only a few genes associated with seedling cold tolerance have been successfully cloned and validated, such as OsGSTZ2, LTT7, COLD1, HAN1, OsCSP1, OsCSP2, COLD11, OsCTS11, and COG1, and these genes have different mechanisms of action. The OsCTS11 gene was identified as a cold-related gene at the seedling stage using BSA (Bipolar Subtraction Angiography) combined with transcriptome and gene expression analysis in cold-tolerant japonica rice NIP and cold-sensitive indica rice WD16343. This gene was induced by cold stress, and its expression in the cold-sensitive variety WD16343 was significantly higher than that in NIP. Gene-edited mutant lines showed enhanced cold tolerance, while overexpression lines showed decreased cold tolerance, indicating that the expression level of the OsCTS11 gene is negatively correlated with the cold-tolerant phenotype, suggesting it is a cold-sensitive gene.

[0004] Therefore, the application of the OsCTS11 gene requires the construction of gene-edited mutant materials or lines with suppressed expression. However, these materials are transgenic, and their safety is subject to regulatory restrictions, limiting their further application. In recent years, some negative regulatory genes or transcription factors have been identified based on cold tolerance traits in rice seedlings. For example, the HAN1 gene, as a negative regulator of cold tolerance, participates in regulating the jasmonic acid (JA)-mediated low-temperature response; overexpressed HAN1 plants wilt during the seedling stage, while gene knockout enhances cold tolerance. COLD6 and OSM1 form a cold-resistance sensor complex, which triggers the production of 2',3'-cyclic adenosine monophosphate (2',3'-cAMP), thereby enhancing rice's cold tolerance; COLD6 negatively regulates cold tolerance, and its knockout enhances cold tolerance. Therefore, the application of negative regulatory genes or transcription factors in breeding through non-transgenic methods urgently requires new molecular marker development strategies. With the rapid development of molecular biology and genomics technologies, rice genome resequencing has facilitated the discovery of favorable haplotypes for cold-resistance genes. Summary of the Invention

[0005] To address the aforementioned shortcomings in existing technologies, the present invention aims to discover favorable haplotypes of the negative regulatory gene OsCTS11 through natural variation, develop molecular markers for detecting haplotype types, and utilize these molecular markers to create new cold-resistant rice germplasm and breed new varieties using MAS technology. This would solve the problem of cold stress during the seedling stage in early rice production in southern China, while also enabling the breeding application of negative regulatory genes or transcription factors.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides a DNA molecular marker associated with haplotypes of a cold-resistant gene in rice seedlings. The cold-resistant gene OsCTS11 in rice seedlings has three key linkage disequilibrium blocks (LD BLOCK1-3), and four haplotypes were resolved from each block.

[0008] 1. OsCTS11 gene LD BLOCK1 haplotype molecular marker

[0009] The downstream control zone consists of Chr11-24225824 (SNP340918381, C / G), Chr11-24225868 (SNP340918425, G / C), and Chr11-24226167 (SNP340918724, A / G), while the upstream control zone consists of Chr11-24228106 (SNP340920663, C / A) and Chr11-24229054 (SNP340921611, A / T). The detection label for SNP340918381 is CTS11-824-KASP, used to distinguish between C and G bases at position Chr11-24225824; the detection label for SNP340918425 is CTS11-868-KASP, used to distinguish between C and G bases at position Chr11-24225868; and the detection label for SNP340918724 is CTS11-167-KASP, used to distinguish between C and G bases at position Chr11-24225868. The detection marker for SNP340920663 is CTS11-106-KASP, used to distinguish A or C bases at positions Chr11-24228106; the detection marker for SNP340921611 is CTS11-054-KASP, used to distinguish A or T bases at positions Chr11-24229054; or complementary bases at the above positions.

[0010] The detection primer sequences for the above molecular markers are as follows:

[0011] 1) CTS11-824-KASP

[0012] 824FAM: GAAGGTGACCAAGTTCATGCTAAAATGACCCATTCATTTAAGTGG,

[0013] 824HEX:GAAGGTCGGAGTCAACGGATTAAAATGACCCATTCATTTAAGTGC,

[0014] 824C:ACTGAAAAGAAGTAGTGGCAACATT;

[0015] 2) CTS11-868-KASP

[0016] 868FAM:GAAGGTGACCAAGTTCATGCTAGAATTAGAAAATGTTGCCACTACTTC,868HEX:GAAGGTCGGAGTCAACGGATTAGAATTAGAAAATGTTGCCACTACTTG,868C:CTACGTGTAGCCCATGGACG;

[0017] 3)CTS11-167-KASP

[0018] 167FAM:GAAGGTGACCAAGTTCATGCTCTTATGTTTGTGTTGATTTTTGGGTAA,167HEX:GAAGGTCGGAGTCAACGGATTCTTATGTTTGTGTTGATTTTTGGGTAG,167C:CCGACTTGTACTGCATCTGC;

[0019] 4)CTS11-106-KASP

[0020] 106FAM:GAAGGTGACCAAGTTCATGCTTTAATAAAAAAATAGCTTATGGTAAAT C,

[0021] 106HEX:GAAGGTCGGAGTCAACGGATTTTAATAAAAAAATAGCTTATGGTAAAT A,

[0022] 106C:TAAGCATAACGGAGGTAGTAGGAA;

[0023] 5)CTS11-054-KASP

[0024] 054FAM:GAAGGTGACCAAGTTCATGCTAAGGCAGATTAAGTAGCAAAATT,

[0025] 054HEX:GAAGGTCGGAGTCAACGGATTAAGGCAGATTAAGTAGCAAAATA,

[0026] 054C:CCGTCACTAACATAGAACAGGC。

[0027] An identification method based on the aforementioned DNA molecular markers is provided, employing KASP molecular markers. The KASP molecular marker primer combination includes two specific primers and one universal primer. One specific primer has a fluorescent tag FAM attached to its 5' end. After PCR amplification, the product carrying the FAM sequence appears as an orange circle under fluorescence illumination. The other specific primer has a fluorescent tag HEX attached to its 5' end. After PCR amplification, the product carrying the HEX sequence appears as a blue square under fluorescence illumination. If the product appears as a green triangle under fluorescence illumination, the genotype of the rice material being tested is heterozygous.

[0028] After PCR amplification, fluorescence detection was performed. The detection marker for SNP340918381 was CTS11-824-KASP, and the results were as follows: orange circles (FAM) represented the GG genotype, blue squares (HEX) represented the CC genotype, and green triangles represented the GC genotype (heterozygous). Similarly, the detection marker for SNP340918425 was CTS11-868-KASP, and the results were as follows: orange (FAM) represented the CC genotype, blue (HEX) represented the GG genotype, and green represented the CG genotype (heterozygous). The detection marker for SNP340918724 was CTS11-167-KASP, and the results were as follows: orange (FAM) represented the AA genotype, blue (HEX) represented the GG genotype, and green represented the AG genotype (heterozygous). The detection marker for SNP340920663 was CTS11-106-KASP, with results as follows: orange (FAM) indicates CC type, blue (HEX) indicates AA type, and green indicates CA type (heterozygous). The detection marker for SNP340921611 was CTS11-054-KASP, with results as follows: orange (FAM) indicates TT type, blue (HEX) indicates AA type, and green indicates TA type (heterozygous). Genotyping of the sample materials at SNP loci using these five KASP markers was performed. A result of CGACA was classified as haplotype Hap1; GCACT as haplotype Hap2; CGGCA as haplotype Hap3; and GC ACA as haplotype Hap4. Hap4 is a favorable haplotype of the cold-tolerant OsCTS11 gene LD BLOCK1 in seedlings.

[0029] 2. OsCTS11 gene LD BLOCK2 haplotype molecular marker

[0030] The upstream regulatory regions of the OsCTS11 gene, namely Chr11-24229461 (SNP340922018, G / A), Chr11-24229565 (SNP340922122, G / A), and Chr11-24229696 (SNP340922253, A / C), form LD BLOCK2. The detection marker for SNP340922018 is CTS11-461-KASP, used to distinguish between A or G bases at position Chr11-24229461; the detection marker for SNP340922122 is CTS11-565-KASP, used to distinguish between A or G bases at position Chr11-24229565; the detection marker for SNP340922253 is CTS11-696-KASP, used to distinguish between A or C bases at position Chr11-24229696; or complementary bases at the above sites.

[0031] The detection primer sequences for the above molecular markers are as follows:

[0032] 1) CTS11-461-KASP

[0033] 461FAM: GAAGGTGACCAAGTTCATGCTACAAACACCATCATAATCCCAAATG,

[0034] 461HEX:GAAGGTCGGAGTCAACGGATTACAAACACCATCATAATCCCAAATA,

[0035] 461C:TGGCAGCAATCTAAATAGGGTCT;

[0036] 2) CTS11-565-KASP

[0037] 565FAM: GAAGGTGACCAAGTTCATGCTTCTTTACAATGCCAAAATTTTA,

[0038] 565HEX:GAAGGTCGGAGTCAACGGATTTCTTTACAATGCCAAAATTTTG,

[0039] 565C:AAATATTGGTACCGCCTAAA;

[0040] 3) CTS11-696-KASP

[0041] 696FAM: GAAGGTGACCAAGTTCATGCTACCCCCTTCATCTACTTTTGATAGTA,

[0042] 696HEX:GAAGGTCGGAGTCAACGGATTACCCCCTTCATCTACTTTTGATAGTC,

[0043] 696C: ACGAGGTATGACTAGCAACATGT;

[0044] After PCR amplification, fluorescence detection revealed that SNP340922122 was identified by the marker CTS11-565-KASP, with KASP results as follows: orange (FAM) indicates AA type, blue (HEX) indicates GG type, and green indicates AG type (heterozygous). SNP340922253 was identified by the marker CTS11-696-KASP, with KASP results as follows: orange (FAM) indicates AA type, blue (HEX) indicates CC type, and green indicates AC type (heterozygous). When using these three KASP markers to genotype SNP sites in the sample materials, a result of GGA was classified as haplotype Hap1; GGC as haplotype Hap2; GAA as haplotype Hap3; and AGA as haplotype Hap4. Hap3 is a favorable haplotype of the cold-tolerant OsCTS11 gene LD BLOCK2 in seedlings.

[0045] 3. OsCTS11 gene LD BLOCK3 haplotype molecular marker

[0046] The Chr11-24229710 (SNP340922267, A / G), Chr11-24229747 (SNP340922304, C / T), Chr11-24229774 (SNP340922331, C / T), and Chr11-24229785 (SNP340922342, G / A) in the upstream regulatory region of the OsCTS11 gene constitute LD BLOCK3.

[0047] The detection marker for SNP340922267 is CTS11-710-KASP, used to distinguish between A and G bases at position Chr11-24229710; the detection marker for SNP340922304 is CTS11-747-KASP, used to distinguish between C and T bases at position Chr11-24229747; the detection marker for SNP340922331 is CTS11-774-KASP, used to distinguish between C and T bases at position Chr11-24229774; the detection marker for SNP340922342 is CTS11-785-KASP, used to distinguish between G and A bases at position Chr11-24229785; or complementary bases at the above sites.

[0048] The detection primer sequences for the above molecular markers are as follows:

[0049] 1) CTS11-710-KASP

[0050] 710FAM: GAAGGTGACCAAGTTCATGCTAATTACTTATTCTTGATATGAATGC,

[0051] 710HEX: GAAGGTCGGAGTCAACGGATTAATTACTTATTCTTGATATGAATGT,

[0052] 710C: TACCCCCTTCATCTACTTTTG;

[0053] 2) CTS11-747-KASP

[0054] 747FAM: GAAGGTGACCAAGTTCATGCTTATGACTAGCAACATGTTTAAATG,

[0055] 747HEX: GAAGGTCGGAGTCAACGGATTTATGACTAGCAACATGTTTAAATA,

[0056] 747C: CCCTTCATCTACTTTTGATAGTAA;

[0057] 3) CTS11-774-KASP

[0058] 774FAM: GAAGGTGACCAAGTTCATGCTTTAAACATGTTGCTAGTCATACCTC,

[0059] 774HEX: GAAGGTCGGAGTCAACGGATTTTAAACATGTTGCTAGTCATACCTT,

[0060] 774C: GCGTGACTCTCTATTTTTCCACA;

[0061] 4) CTS11-785-KASP

[0062] 785FAM: GAAGGTGACCAAGTTCATGCTGCTAGTCATACCTCGTAAATAAGCG,

[0063] 785HEX:GAAGGTCGGAGTCAACGGATTGCTAGTCATACCTCGTAAATAAGCA,

[0064] 785C: GCGTGACTCTCTATTTTTCCACA;

[0065] After PCR amplification, SNP340922267 was detected using the detection label CTS11-710-KASP, and the KASP results were as follows: orange (FAM) indicates CC type, blue (HEX) indicates TT type, and green indicates CT type (heterozygous). SNP340922304 was detected using the detection label CTS11-747-KASP, and the KASP results were as follows: orange (FAM) indicates GG type, blue (HEX) indicates AA type, and green indicates GA type (heterozygous). SNP340922331 was detected using the detection label CTS11-774-KASP, and the KASP results were as follows: orange (FAM) indicates CC type, blue (HEX) indicates TT type, and green indicates CT type (heterozygous). The detection marker for SNP340922342 was CTS11-785-KASP. The KASP results were as follows: orange (FAM) indicated the GG type, blue (HEX) indicated the AA type, and green indicated the GA type (heterozygous). When using these four KASP markers to genotype SNP sites in the sample materials, a result of ACCG was classified as haplotype Hap1; a result of GCCG was classified as haplotype Hap2; and a result of GCCA was classified as haplotype Hap3. Hap4 is a favorable haplotype of the cold-tolerant OsCTS11 gene LD BLOCK3 in seedlings.

[0066] In summary, Hap4 of LD BLOCK1, Hap3 of LD BLOCK2, and Hap4 of LD BLOCK3 of the OsCTS11 gene are all dominant haplotypes of the OsCTS11 gene. These haplotypes or haplotype combinations can serve as important genetic markers for molecular breeding of cold tolerance in rice seedlings.

[0067] Based on the above technical solution, the embodiments of the present invention can produce at least the following technical effects:

[0068] This invention provides a method for identifying favorable haplotypes of the negative regulatory gene OsCTS11 through natural variation and developing molecular markers for detecting haplotype types. The Hap4 of LD BLOCK1, Hap3 of LD BLOCK2, and Hap4 of LD BLOCK3 of the OsCTS11 gene developed using this invention are all dominant haplotypes of the OsCTS11 gene. These haplotypes or haplotype combinations can serve as important genetic markers for molecular breeding of cold-resistant rice seedlings. Using these developed molecular markers, haplotype typing of the OsCTS11 gene can be performed on a large number of germplasm resources and new breeding materials to identify seedling-hardy materials carrying the superior OsCTS11 gene haplotype. This method is more time-saving, labor-saving, efficient, and cost-effective than traditional phenotypic screening. Furthermore, molecular markers can be used to create new cold-resistant rice seedling germplasm and breed new varieties using MAS technology, solving the problem of cold stress during the seedling stage in early rice production, while simultaneously enabling the breeding application of negative regulatory genes or transcription factors. Attached Figure Description

[0069] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.

[0070] Figure 1 The physical locations of the 14 SNPs in the OsCTS11 gene in this example are shown.

[0071] Figure 2 Linkage disequilibrium and LD BLOCK analysis of 14 SNPs in the OsCTS11 gene in the examples;

[0072] Figure 3 For the analysis of significant differences in the LD BLOCK1 haplotype of the OsCTS11 gene in the examples;

[0073] Figure 4 For the statistical analysis of the significant differences in the LD BLOCK2 haplotype of the OsCTS11 gene in the examples;

[0074] Figure 5 For the analysis of significant differences in the LD BLOCK3 haplotype of the OsCTS11 gene in the examples;

[0075] Figure 6 The percentage of different haplotypes of the OsCTS11 gene LD BLOCK1 in 2277 3K germplasm accessions in the examples;

[0076] Figure 7This example shows the distribution of different haplotypes of the OsCTS11 gene LD BLOCK1 in 2277 3K germplasms among subspecies;

[0077] Figure 8 This example shows the percentage of different haplotypes of the LD BLOCK2 gene in the OsCTS11 gene from 2322 3K germplasms.

[0078] Figure 9 This example illustrates the distribution of different haplotypes of the OsCTS11 gene LD BLOCK2 in 2322 3K germplasms among subspecies.

[0079] Figure 10 The percentage of different haplotypes of the OsCTS11 gene LD BLOCK3 in 2300 3K germplasm accessions in the examples;

[0080] Figure 11 This example illustrates the distribution of different haplotypes of the OsCTS11 gene LD BLOCK3 in 2300 3K germplasm accessions among subspecies.

[0081] Figure 12 This example demonstrates the KASP molecular detection of 12 specific SNP sites for the OsCTS11 gene haplotype.

[0082] Figure 13 This study analyzed the significant differences in OsCTS11 gene expression levels among the 10 haplotype combinations in the examples under low-temperature stress. Detailed Implementation

[0083] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In addition, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.

[0084] Example

[0085] (1) Identification of cold tolerance phenotype of seedlings of the test materials.

[0086] 529 core germplasm resources, 42 production-use indica, japonica, and hybrid indica rice accessions collected from 3K resequencing materials were placed in a constant-temperature oven at 45°C for 2 days to reduce moisture content and break dormancy. 500 seeds from each material were selected and treated with a 1.5% (v / v) sodium hypochlorite solution for 20 minutes, followed by thorough rinsing with ultrapure water. The seeds were then soaked for 2 days and germinated in a constant-temperature oven at 32°C for approximately 1 day. When the sprouts reached approximately 5 mm in length, uniformly germinated seeds were sown in 96-well germination plates, with 32 seeds per replicate, and 3 replicates for each material. After adding nutrient solution, the plants were grown at room temperature (28°C) under normal light conditions for 2 weeks. Subsequently, they were placed in an artificial climate chamber and treated at a constant temperature of 6°C for 7 days. After treatment, the samples were transferred to a suitable temperature of 28°C and continued to grow under normal light for 10 days. The number of surviving seedlings was then recorded and the seedling survival rate was calculated.

[0087] (2) Extraction of SNP information from OsCTS11 gene.

[0088] The OsCTS11 gene has a Gene ID of LOC_Os11g40600. The gene sequence information of the Nipponbare OsCTS11 gene (Rice Genome Annotation Project) was retrieved using this Gene ID. The physical location of the positive strand sequence of the CDS region of the OsCTS11 gene is 24226246-24227813 in chr11. After downloading the genomic SNP information of 3024 rice 3K materials (3kb accessions) from snp-seek.irri.org / _download.zul, the OsCTS11 gene CDS region and the upstream and downstream 2kb and 1kb SNP information (chr11: 24225245-24229813bp) were extracted from 529 core 3K accessions using Plink (v1.9) software and filtered. The filtering criteria were: SNPs with a deletion rate greater than 0.2 were deleted; samples with a deletion rate greater than 0.2 were deleted; and SNPs with a minor allele frequency (MAF) less than 0.05 were removed. Within the CDS region of the OsCTS11 gene and its upstream and downstream 2kb regions, a total of 14 polymorphic SNP sites located in introns and regulatory regions were identified. Of these, 1 SNP was located in the intron region, 10 SNPs in the upstream regulatory region, and 3 SNPs in the downstream regulatory region. Figure 1The filtered files were analyzed using Haploview software for LD block and linkage disequilibrium (LD) analysis. The results showed that the downstream control region's Chr11-24225824 (SNP340918381, C / G), Chr11-24225868 (SNP340918425, G / C), and Chr11-24226167 (SNP340918724, A / G), along with the upstream control region's Chr11-24228106 (SNP340920663, C / A) and Chr11-24229054 (SNP340921611, A / T), constituted a significant LD block. BLOCK1 shows a strong linkage disequilibrium, with the linkage strength index D' between every two SNPs ranging from 0.86 to 1.00. The upstream control regions Chr11-24229461 (SNP340922018, G / A), Chr11-24229565 (SNP340922122, G / A), and Chr11-24229696 (SNP340922253, A / C) form a significant LD block (LD). BLOCK2); the upstream control area contains Chr11-24229710 (SNP340922267, A / G), Chr11-24229747 (SNP340922304, C / T), Chr11-24229774 (SNP340922331, C / T) and Chr11-24229785 (SNP340922342, G / A), which constitute a significant LD block (LDBLOCK3). Figure 2 ).

[0089] (3) Haplotype analysis of LD BLOCK1 in OsCTS11 gene.

[0090] The standardized format conversion of genomic and phenotypic data was completed using Plink (v1.9), Tassel5 (v5.2.81), and R language (v4.2.1). For the filtered 429 3K core germplasm resources, the geneHapR package in R language was used to analyze the haplotypes of LD BLOCK1, LD BLOCK2, and LD BLOCK3 within the OsCTS11 genomic region (Chr11:24225245-24229813). The results showed that the five SNPs of LD BLOCK1 could be divided into four major haplotypes: Hap1 (CGACA) was mainly found in indica rice (67%), Hap2 (GCACT) was mainly found in japonica rice (54.3%), Hap3 (CGGAA) was mainly found in indica rice (97.4%), and Hap4 (GCACA) was mainly found in japonica rice (97.1%) (Table 1). After low-temperature stress, the seedling survival rate of Hap4 was the highest (65.38%), which was significantly higher than that of Hap1 (22.26%), Hap2 (36.07%) and Hap3 (16.19%). Figure 3 Therefore, Hap4 was identified as a favorable haplotype for seedling cold tolerance in the LD BLOCK1 region of the OsCTS11 gene.

[0091] Table 1. Four haplotypes of LD BLOCK1 in the OsCTS11 gene.

[0092]

[0093]

[0094] (4) Haplotype analysis of LD BLOCK2 in OsCTS11 gene.

[0095] The three SNPs of LD BLOCK2 can be divided into four main haplotypes. Hap1 (GGA) is mainly found in indica rice (74.3%), Hap2 (GGC) accounts for 48.8% in indica rice, Hap3 (GAA) is mainly found in japonica rice (96.6%), and Hap4 (AGA) is mainly found in indica rice (92.7%) (Table 2). Under cold stress during the seedling stage, Hap3 had the highest seedling survival rate (58.41%), which was significantly higher than Hap1 (22.38%), Hap2 (23.32%), and Hap4 (10.24%). Figure 4 Therefore, Hap3 is a favorable haplotype for cold tolerance in the seedling stage of the OsCTS11 gene LDBLOCK2.

[0096] Table 2. Four haplotypes of the OsCTS11 gene LD BLOCK2

[0097]

[0098] (5) Haplotype analysis of LD BLOCK3 in OsCTS11 gene.

[0099] The four SNPs of LD BLOCK3 can be divided into four major haplotypes. Hap1 (ACCG) is mainly found in indica rice (85.7%), Hap2 (GCCG) is mainly found in japonica rice (56.1%), Hap3 (GCCA) is mainly found in indica rice (59.4%), and Hap4 (GTTG) is mainly distributed in japonica rice (95.2%) (Table 3). Regarding seedling survival rate, Hap4 performed best (51.48%), significantly higher than Hap1 (19.02%) and Hap3 (22.64%), and significantly higher than Hap2 (39.92%). Figure 5 Therefore, Hap4 was identified as a favorable haplotype for seedling cold tolerance in the LD BLOCK3 region of the OsCTS11 gene.

[0100] Table 3. Four haplotypes of LD BLOCK3 in the OsOsCTS11 gene.

[0101]

[0102]

[0103] The above results indicate that Hap4 of LD BLOCK1, Hap3 of LD BLOCK2, and Hap4 of LD BLOCK3 in the OsCTS11 gene are all dominant haplotypes, and are mainly found in japonica rice. These haplotypes can serve as important genetic markers for molecular breeding of cold tolerance in rice seedlings.

[0104] (6) Distribution of LD BLOCK1 haplotypes in the OsCTS11 gene.

[0105] Haplotype analysis of five key SNP sites in the LD BLOCK1 locus of the OsCTS11 gene from 2277 rice accessions in the filtered 3K germplasm bank was performed using the geneHapR package in R. The results showed significant differences in the frequency distribution of the four main haplotypes: Hap1 (79.19%) > Hap3 (10.92%) > Hap2 (10.37%) > Hap4 (8.00%). Figure 6Further analysis revealed the subgroup composition characteristics of each haplotype: Hap1 was dominated by indica rice (Indica I-III, Indadx, 52.98%), supplemented by japonica rice (Japadx, TEJ, TRJ, 36.66%), with other types being less distributed; Hap2 was mainly composed of indica rice (Indica II, Indica III, Indadx, 94.26%), with Indica I, TRJ, and Intermediate being less distributed; Hap3 was also mainly composed of indica rice (Indica II, Indica III, Indadx, 92.31%), with Indica... Haplotypes I, TRJ, and Intermediate were less prevalent; among the dominant haplotype Hap4, japonica rice types accounted for 74.57%, with Japadx, temperate japonica rice (TEJ), and tropical japonica rice (TRJ) accounting for 13.29%, 10.98%, and 50.29%, respectively, while indica rice (Indica I, Indica II), intermediate type (Admix), and Aro had lower proportions. Figure 7 ).

[0106] (7) Distribution of LD BLOCK2 haplotypes of OsCTS11 gene.

[0107] Haplotype analysis of three key SNP sites in the LD BLOCK2 locus of the OsCTS11 gene from 2322 rice accessions in the filtered 3K germplasm bank was performed using the geneHapR package in R. The results showed significant differences in the frequency distribution of the four main haplotypes: Hap1 (43.96%) > Hap2 (31.78%) > Hap3 (15.28%) > Hap4 (9.02%). Figure 8 Further analysis revealed the subgroup composition characteristics of each haplotype: Hap1 was mainly composed of indica rice (Indica I-III, Indadx, 73.73%), supplemented by japonica rice (Japadx, TEJ, 36.66%) and AUS rice (11.76%), with other types being less distributed; Hap2 was mainly composed of japonica rice (TRJ, TEJ, Japadx, 52.82%), supplemented by indica rice (Indica II, Indica III, Indadx, 34.45%), with Indica I, Admix, and AUS being less distributed; Hap3 was composed of both indica rice (41.34%) and japonica rice (44.44%), with Indica III, Indadx, and Indica... II, TRJ, TEJ, Japadx, and Aro accounted for a relatively large proportion; among haplotype Hap4, indica rice types accounted for 87.98%, and Aus rice types accounted for 12.02%, with indica rice types Indica III and Indadx accounting for a relatively large proportion. Figure 9 ).

[0108] (8) Distribution of LD BLOCK3 haplotypes of OsCTS11 gene.

[0109] Haplotype analysis of four key SNP sites in the LD BLOCK3 locus of the OsCTS11 gene from 2300 filtered rice accessions was performed using the geneHapR package in R. The results showed significant differences in the frequency distribution of the four main haplotypes: Hap1 (51.41%) > Hap2 (25.57%) > Hap3 (15.53%) > Hap4 (7.49%). Figure 10 Further analysis revealed the subgroup composition characteristics of each haplotype: Hap1 was mainly composed of indica rice (Indica I-III, Indadx, 71.76%), japonica rice accounted for 16.30% (mainly Japadx, TEJ), and AUS rice accounted for 10.67%, with other types being less distributed; Hap2 was mainly composed of japonica rice (TRJ, TEJ, 67.86%), supplemented by indica rice (Indica II, Indica III, 26.15%), followed by Aro (4.27%) and AUS rice (1.71%), with other types being less distributed; Hap3 was mainly composed of indica rice (Indica... III, Indadx (88.76%), Aus rice accounted for 8.43%, and other types were less distributed; Hap4 was mainly composed of japonica rice (TRJ, TEJ, Japadx, 77.38%), indica rice types accounted for only 7.14%, Aro rice accounted for 11.31%, and other types were less distributed ( Figure 11 ).

[0110] (9) Development of favorable haplotype molecular markers for the OsCTS11 gene.

[0111] DNA was extracted from 3K resources and 43 rice germplasms used in production applications using the CTAB method. KASP primers for detecting 12 SNP sites of the OsCTS11 gene were developed using Primer5 software. The 12 pairs of molecular markers, including CTS11-824-KASP, CTS11-868-KASP, and CTS11-106-KASP, were composed of two specific primers and one universal primer. One specific primer had a fluorescent tag FAM (sequence: GAAGGTGACCAAGTTCATGCT) attached to its 5′ end. After PCR amplification, the product carrying the FAM sequence showed a circular orange color under fluorescence illumination (wild-type homozygous or mutant homozygous genotype). The other specific primer had a fluorescent tag HEX (sequence: GAAGGTCGGAGTCAACGGATT) attached to its 5′ end. After PCR amplification, the product carrying the HEX sequence showed a square blue color under fluorescence illumination (mutant homozygous or wild-type homozygous genotype); green triangles indicated heterozygous genotypes. KASP markers for detecting five SNP sites in the OsCTS11 gene LD BLOCK1 were developed using Primer5 software. These include Chr11-24225824 (SNP340918381, C / G), Chr11-24225868 (SNP340918425, G / C), Chr11-24226167 (SNP340918724, A / G), Chr11-24228106 (SNP340920663, C / A), and Chr11-24229054 (SNP340921611, A / T). The marker for detecting SNP340918381 is called CTS11-824-KASP and consists of three primers: 824FAM, 824HEX, and 824C. These markers are used to distinguish between C and G bases at the Chr11-24225824 position. Primer 824FAM has a fluorescent tag FAM attached to its 5' end and a G base at its 3' end; primer 824HEX has a fluorescent tag HEX attached to its 5' end and a C base at its 3' end. After PCR amplification, fluorescence detection of Chr11-24225824 indicates the following: orange circles (FAM) represent the GG type, blue squares (HEX) represent the CC type, and green triangles represent the GC type (heterozygous). Similarly, the detection marker for SNP340918425 is CTS11-868-KASP, and the results are: orange (FAM) represents the CC type, blue (HEX) represents the GG type, and green represents the CG type (heterozygous). The detection marker for SNP340918724 is CTS11-167-KASP, and the results are as follows: orange (FAM) indicates AA type, blue (HEX) indicates GG type, and green indicates AG type (heterozygous).The detection marker for SNP340920663 is CTS11-106-KASP, and the results are as follows: orange (FAM) indicates CC type, blue (HEX) indicates AA type, and green indicates CA type (heterozygous). The detection marker for SNP340921611 is CTS11-054-KASP, and the results are as follows: orange (FAM) indicates TT type, blue (HEX) indicates AA type, and green indicates TA type (heterozygous). Figure 12 (Table 4). Genotyping of SNP sites was performed on the sample materials using the five KASP markers mentioned above. When the result was CGACA, it was classified as haplotype Hap1; when the result was GCACT, it corresponded to haplotype Hap2; when the result was CGGCA, it belonged to haplotype Hap3; and when the result was GCACA, it was determined to be haplotype Hap4. Among these, Hap4 is a favorable haplotype of the cold-resistant OsCTS11 gene LD BLOCK1 in seedlings.

[0112] KASP genotyping markers were developed for three SNP sites in LD BLOCK2: Chr11-24229461 (SNP340922018, G / A), Chr11-24229565 (SNP340922122, G / A), and Chr11-24229696 (SNP340922253, A / C). The marker for SNP340922018 was named CTS11-461-KASP. For Chr11-24229461, the KASP genotyping results are as follows: orange (FAM) indicates GG type, blue (HEX) indicates AA type, and green indicates GA type (heterozygous). The detection marker for SNP340922122 is CTS11-565-KASP. For Chr11-24229565, the KASP results are: orange (FAM) indicates AA type, blue (HEX) indicates GG type, and green indicates AG type (heterozygous). The detection marker for SNP340922253 is CTS11-696-KASP. For Chr11-24229696, the KASP results are: orange (FAM) indicates AA type, blue (HEX) indicates CC type, and green indicates AC type (heterozygous). Figure 12 (Table 4). When using these three KASP markers to genotype SNP sites in the sample materials, a result of GGA was classified as haplotype Hap1; a result of GGC was classified as haplotype Hap2; a result of GAA was classified as haplotype Hap3; and a result of AGA was classified as haplotype Hap4. Among them, Hap3 is a favorable haplotype of the OsCTS11 gene LD BLOCK2 for cold tolerance in seedlings.

[0113] KASP detection markers were developed for four SNP sites in LD BLOCK3: Chr11-24229710 (SNP340922267, A / G), Chr11-24229747 (SNP340922304, C / T), Chr11-24229774 (SNP340922331, C / T), and Chr11-24229785 (SNP340922342, G / A). SNP340922267 was detected using the marker CTS11-710-KASP. For Chr11-24229710, the KASP results are as follows: orange (FAM) indicates CC genotype, blue (HEX) indicates TT genotype, and green indicates CT genotype (heterozygous). The detection marker for SNP340922304 is CTS11-747-KASP. For Chr11-24229747, the KASP results are: orange (FAM) indicates GG type, blue (HEX) indicates AA type, and green indicates GA type (heterozygous). The detection marker for SNP340922331 is CTS11-774-KASP. For Chr11-24229774, the KASP results are: orange (FAM) indicates CC type, blue (HEX) indicates TT type, and green indicates CT type (heterozygous). The detection marker for SNP340922342 is CTS11-785-KASP. For Chr11-24229785, the KASP results are: orange (FAM) indicates GG type, blue (HEX) indicates AA type, and green indicates GA type (heterozygous). Figure 12 (Table 4). When using these four KASP markers to genotype the SNP sites of the sample materials, when the test result was ACCG, it was identified as haplotype Hap1; when the result was GCCG, it was classified as haplotype Hap2; when the result was GCCA, it belonged to haplotype Hap3; among them, Hap4 is the favorable haplotype of the cold-resistant OsCTS11 gene LDBLOCK3 in seedling stage.

[0114] Table 4. KASP marker primer sequences for CTS11 gene haplotype SNP sites

[0115]

[0116]

[0117] (10) Validation of haplotype molecular markers of the OsCTS11 gene.

[0118] Eighty accessions were selected from 529 accessions in the 3K Rice Core Germplasm Resource Bank used for cold tolerance analysis. These accessions covered 10 haplotype combinations of the OsCTS11 gene, from LD BLOCK1 to LD BLOCK3, with eight samples for each haplotype type. The developed molecular markers were validated. Using KASP technology, molecular analysis was performed on the selected 80 3K core germplasm resources using 12 molecular markers, including CTS11-824-KASP, CTS11-565-KASP, and CTS11-785-KASP. The results were compared with the IRRI-SNP database (snp-seek.irri.org / _download.zul). All KASP genotyping results were completely consistent with the original SNP information, confirming that 12 molecular markers, including CTS11-824-KASP, CTS11-565-KASP, and CTS11-785-KASP, can effectively distinguish genetic variations at 12 key SNP sites of the OsCTS11 gene (Table 5).

[0119] Table 5. KASP typing results of SNP sites of the OsCTS11 gene LD BLOCK1-3 in 80 3K germplasms

[0120]

[0121]

[0122] To further investigate the expression changes of OsCTS11 in different haplotype combinations of LD BLOCK1-LD BLOCK3 under cold stress, qRT-PCR was used to analyze the expression levels of the OsCTS11 gene in eight germplasm accessions from each of the ten haplotype combinations after 7 days of room temperature (CTSS0d) and low temperature treatment (CTSS7d). The results showed that after low temperature stress at the seedling stage, the expression levels of all haplotype combinations decreased significantly, ranging from 3.4 to 64.4-fold. Among them, the combinations containing the dominant haplotypes LD BLOCK1(Hap4), LD BLOCK2(Hap3), and LD BLOCK3(Hap4)—Hap1+Hap3+Hap2, Hap1+Hap3+Hap4, and Hap4+Hap3+Hap2—showed the largest decreases, at 28.1-fold, 39.9-fold, and 64.4-fold, respectively. The other seven combinations, which do not contain a dominant haplotype, saw a decrease ranging from 3.4 to 8.2 times. Figure 13 The results showed that the expression level of the OsCTS11 gene was significantly reduced under the regulation of the dominant haplotype, thereby improving the seedling's resistance to cold stress.

[0123] (11) Haplotype analysis of the OsCTS11 gene in 42 rice materials.

[0124] KASP genotyping technology was used to perform gene detection and haplotype typing on 12 key SNP sites, including SNP340918381, SNP340918425, and SNP340918724, of the OsCTS11 gene BLOCK1, BLOCK2, and BLOCK3 in 42 rice germplasms and hybrid rice used in production. The results showed that the haplotype combinations of BLOCK1, BLOCK2, and BLOCK3 in the OsCTS11 gene of 9 hybrid rice varieties, including Pingliangyou Mingyue Simiao, were Hap1+Hap1+Hap1; the haplotype combination of Gongliangyou 892 was Hap1+Hap1+Hap3; and the haplotype combination of BLOCK1 and BLOCK2 in Fengliangyou Xiang 1 was Hap1+Hap1. No favorable haplotypes were detected in the OsCTS1 gene BLOCK1, BLOCK2, and BLOCK3 of 11 hybrid rice varieties, and the seedling survival rate was 0 under low temperature. The OsCTS11 gene BLOCK1, BLOCK2, and BLOCK3 haplotype combinations of Jingguizhan, Yue Nong Simiao, and Shaoxiang 100 are Hap1+Hap1+Hap1; the haplotype combinations of Minghui 86, R8612, Guanghui 398, Xiangzaoxian 45, and Meixiangzhan 2 are Hap2+Hap1+Hap1; the haplotype combinations of Zhenhui 084 and Shuhui 527 are Hap2+Hap1+Hap3; the haplotype combination of Huazhan is Hap1+Hap1+Hap2; and the haplotype combination of R9311 is Hap1+Hap2+Hap1. No favorable haplotypes were detected in these indica rice materials, and the seedling survival rate was 0 under low temperature. The OsCTS11 gene of indica rice R676 showed a favorable haplotype Hap4 in BLOCK1, while BLOCK2 and BLOCK3 were Hap1 and Hap3, respectively. The haplotype combination was Hap4+Hap1+Hap3. This variety achieved a seedling survival rate of 69.0% under low temperature conditions, demonstrating extremely strong cold resistance. The BLOCK1, BLOCK2, and BLOCK3 of the OsCTS11 gene in Suijing 18 and Nanjing 5055 are Hap2, Hap1, and Hap1, respectively. The haplotype combinations of 12 japonica rice varieties, including Jiahexiang 1, Songzaoxiang 1, and Songxiangjing 1018, are Hap2+Hap1+Hap2. The haplotype combinations of Ningxiangjing 9, Nanjing 5718, and Dongdao 275 are Hap2+Hap3+Hap2. The haplotype combination of Yunjing 15 is Hap1+Hap2+Hap1. The haplotype combination of Suxiangjing 100 is Hap2+Hap1+Hap3. The haplotype combination of Jinjing 818 is Hap2+Hap2+Hap3. No favorable haplotypes were detected in these japonica rice materials, and their seedling survival rates at low temperatures ranged from 0.0% to 18.9%.The OsCTS11 gene BLOCK2 of the japonica rice variety Nanjing 5718 showed a favorable haplotype Hap3. The haplotypes of BLOCK1 and BLOCK3 are Hap2 and Hap2, respectively, and the haplotype combination is Hap2+Hap3+Hap2. This variety has a seedling survival rate of 46.6% under low temperature, showing strong cold resistance (Table 6).

[0125] Table 6. Molecular detection and haplotype typing results of 42 indica, japonica, and hybrid indica rice germplasms used in production.

[0126]

[0127] In summary, this invention utilizes Plink (v1.9), Tassel5 (v5.2.81), R language (v4.2.1), and Haploview software to analyze the dominant haplotypes of the rice seedling cold-resistance gene OsCTS11. Linkage disequilibrium analysis revealed three major linkage disequilibrium blocks (LD BLOCK1-3) in the OsCTS11 gene. Haplotype association analysis with low-temperature stress phenotypes identified Hap4 (GCACA) in LD BLOCK1, Hap3 (GAA) in Block2, and Hap4 (GTTG) in Block3 as the dominant haplotypes. The KASP molecular marker, developed based on different haplotype SNP sites, can be used to analyze the OsCTS11 genotype in different rice materials. Furthermore, testing of existing rice varieties demonstrates that the superior haplotypes selected using this molecular marker exhibit significantly higher seedling cold-resistance compared to non-superior haplotypes. This invention mines favorable haplotypes of target genes through natural variation and develops efficient molecular markers for identifying dominant haplotypes of the OsCTS11 gene. It is a new method for the breeding application of negative regulatory genes or transcription factors through non-transgenic methods.

[0128] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.

Claims

1. A DNA molecular marker associated with a haplotype of a cold-resistance gene in rice seedlings, characterized in that, The OsCTS11 haplotype molecular marker for cold tolerance in rice seedlings includes 12 sites, as follows: SNP340918381 is located at Chr11-24225824 in the genome, and its polymorphism is either C or G. SNP340918425 is located at Chr11-24225868 in the genome, and its polymorphism is either G or C. SNP340918724 is located at Chr11-24226167 in the genome, and its polymorphism is either A or G. SNP340920663 is located at Chr11-24228106 in the genome, and its polymorphism is either C or A. The genomic location of SNP340921611 is Chr11-24229054, and the polymorphism is A or T; SNP340922018 is located at Chr11-24229461 in the genome, and its polymorphism is either G or A. The genomic location of SNP340922122 is Chr11-24229565, and the polymorphism is G or A; SNP340922253 is located at Chr11-24229696 in the genome, and its polymorphism is either A or C. The genomic location of SNP340922267 is Chr11-24229710, and the polymorphism is A or G; SNP340922304 is located at Chr11-24229747 in the genome, and its polymorphism is C or T. The genomic location of SNP340922331 is Chr11-24229774, and the polymorphism is C or T; SNP340922342 is located at Chr11-24229785 in the genome, and its polymorphism is either G or A.

2. The DNA molecular marker associated with the haplotype of the cold tolerance gene in rice seedlings according to claim 1, characterized in that, The SNPs 340918381, 340918425, 340918724, 340920663, and 340921611 constitute LDBLOCK1. These five SNPs are classified into four main haplotypes: Hap1: CGACA, Hap2: GCACT, Hap3: CGGAA, and Hap4: GCACA. Among them, Hap4 was identified as a favorable haplotype for cold tolerance in seedlings in the LD BLOCK1 region. SNP340922018, SNP340922122, and SNP340922253 constitute LD BLOCK2. The three SNPs are divided into four main haplotypes: Hap1: GGA, Hap2: GGC, Hap3: GAA, and Hap4: AGA. Among them, Hap3 is a favorable haplotype for cold tolerance in the seedling stage of LD BLOCK2. The SNPs 340922267, 340922304, 340922331, and 340922342 constitute LD BLOCK3. The four SNPs are divided into four main haplotypes: Hap1: ACCG, Hap2: GCCG, Hap3: GCCA, and Hap4: GTTG. Hap4 is a favorable haplotype for cold tolerance in seedlings in the LD BLOCK3 region.

3. The DNA molecular marker associated with haplotypes of cold-resistance genes in rice seedlings according to claim 1, characterized in that, The molecular marker for detecting SNP340918381 is CTS11-824-KASP, and its detection primer sequences are shown in SEQ ID No. 1-SEQ ID No. 3; The molecular marker for detecting SNP340918425 is CTS11-868-KASP, and its detection primer sequences are shown in SEQ ID No. 4-SEQ ID No.

6. The molecular marker for detecting SNP340918724 is CTS11-167-KASP, and its detection primer sequences are shown in SEQ ID No. 7-SEQ ID No.

9. The molecular marker for detecting SNP340920663 is CTS11-106-KASP, and its detection primer sequences are shown in SEQ ID No. 10-SEQ ID No.

12. The molecular marker for detecting SNP340921611 is CTS11-054-KASP, and its detection primer sequences are shown in SEQ ID No. 13-SEQ ID No.

15. The molecular marker for detecting SNP340922018 is CTS11-461-KASP, and its detection primer sequences are shown in SEQ ID No. 16-SEQ ID No.

18. The molecular marker for detecting SNP340922122 is CTS11-565-KASP, and its detection primer sequences are shown in SEQ ID No. 19-SEQ ID No.

21. The molecular marker for detecting SNP340922253 is CTS11-696-KASP, and its detection primer sequences are shown in SEQ ID No. 22-SEQ ID No.

24. The molecular marker for detecting SNP340922267 is CTS11-710-KASP, and its detection primer sequences are shown in SEQ ID No. 25-SEQ ID No.

27. The molecular marker for detecting SNP340922304 is CTS11-747-KASP, and its detection primer sequences are shown in SEQ ID No. 28-SEQ ID No.

30. The molecular marker for detecting SNP340922331 is CTS11-774-KASP, and its detection primer sequences are shown in SEQ ID No. 31-SEQ ID No.

33. The molecular marker for detecting SNP340922342 is CTS11-785-KASP, and its detection primer sequences are shown in SEQ ID No. 34-SEQ ID No.

36.

4. A method for identifying haplotypes of cold-resistant genes in rice seedlings, characterized in that, KASP molecular markers were used, and the KASP molecular marker primer combination included two specific primers and one universal primer. One specific primer was connected to the fluorescent tag FAM at its 5′ end. After PCR amplification, the product carrying the FAM sequence showed an orange circle under fluorescence irradiation. The other specific primer was connected to the fluorescent tag HEX at its 5′ end. After PCR amplification, the product carrying the HEX sequence showed a blue square under fluorescence irradiation. If the product showed a green triangle under fluorescence irradiation, the genotype of the rice material being tested was heterozygous.

5. The method for identifying haplotypes of cold-resistant genes in rice seedlings according to claim 4, characterized in that, The detection marker for SNP340918381 is CTS11-824-KASP, where an orange circle represents the GG type, a blue square represents the CC type, and a green triangle represents the GC type; the detection marker for SNP340918425 is CTS11-868-KASP, where orange represents the CC type, blue represents the GG type, and green represents the CG type; the detection marker for SNP340918724 is CTS11-167-KASP, where orange represents the AA type, blue represents the GG type, and green represents the AG type; the detection marker for SNP340920663 is CTS11-1 06-KASP, orange indicates CC type, blue indicates AA type, and green indicates CA type; the detection marker for SNP340921611 is CTS11-054-KASP, orange indicates TT type, blue indicates AA type, and green indicates TA type; the above 5 KASP markers are used to genotype the SNP sites in the sample materials. When the detection result is CGACA, it is classified as haplotype Hap1; when the result is GCACT, it corresponds to haplotype Hap2; when the result is CGGCA, it belongs to haplotype Hap3; and when the result is GCACA, it is determined to be haplotype Hap4.

6. The method for identifying haplotypes of cold-resistant genes in rice seedlings according to claim 4, characterized in that, The detection marker for SNP340922122 is CTS11-565-KASP, with orange indicating AA type, blue indicating GG type, and green indicating AG type. The detection marker for SNP340922253 is CTS11-696-KASP, with orange indicating AA type, blue indicating CC type, and green indicating AC type. When using these three KASP markers to genotype SNP sites in sample materials, a result of GGA is classified as haplotype Hap1; a result of GGC is classified as haplotype Hap2; a result of GAA is classified as haplotype Hap3; and a result of AGA is classified as haplotype Hap4.

7. The method for identifying haplotypes of cold-resistant genes in rice seedlings according to claim 5, characterized in that, SNP340922267 uses the detection marker CTS11-710-KASP, with orange indicating CC type, blue indicating TT type, and green indicating CT type; SNP340922304 uses the detection marker CTS11-747-KASP, with orange indicating GG type, blue indicating AA type, and green indicating GA type; SNP340922331 uses the detection marker CTS11-774-KASP, with orange indicating CC type, blue indicating TT type, and green indicating CT type. The detection marker for SNP340922342 is CTS11-785-KASP, with orange indicating GG type, blue indicating AA type, and green indicating GA type. When using these four KASP markers to genotype SNP sites in sample materials, if the detection result is ACCG, it is classified as haplotype Hap1; if the result is GCCG, it is classified as haplotype Hap2; if the result is GCCA, it belongs to haplotype Hap3; and if the result is GTTG, it belongs to haplotype Hap4.

8. The application of the DNA molecular markers according to claim 1 in rice breeding.

9. The application of the DNA molecular marker according to claim 1 in screening breeding materials with cold resistance in rice seedlings.

Images