Preparation method and application of monoclonal antibody with nano luciferase label

Abstract

The invention relates to the technical field of gene editing, in particular to a preparation method and application of a monoclonal antibody with a nano luciferase label. A CRISPR / Cas9 gene editing technology is utilized, a nano luciferase gene is knocked into an Ig gene of a hybridoma cell secreting a monoclonal antibody to obtain a stable cell strain with a function of secreting the monoclonal antibody with the nano luciferase label, and then the monoclonal antibody with the nano luciferase label is prepared by utilizing the stable cell strain. According to the method provided by the invention, the sensitivity of an antigen immunoassay method can be improved from the perspective of signal labeling, and the detection limit is reduced.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene editing, in particular to a preparation method and application of monoclonal antibody with nanoluciferase label. BACKGROUND

[0002] Currently, there are three main signal labeling methods for monoclonal antibodies: (1) horseradish peroxidase (HRP) labeled secondary antibody; (2) primary antibody coupled with fluorescent proteins, tandem dyes, enzymes, oligonucleotides and gold nanoparticles, etc.; (3) genetically engineered enzyme-labeled single-chain antibody. Method (1) is cumbersome to operate, has batch-to-batch differences, and the detection results are unstable; method (2) is blind and non-directional, the location and quantity of the label coupled to the antibody are uncertain, and the chemical reagents can easily damage the activity of the antibody and enzyme, affecting the detection results; method (3) is mostly expressed in prokaryotic cells using E. coli as a carrier, which has the problems of small expression amount, low expression activity and low stability of the antibody. Therefore, it is necessary to develop new labeling technology.

[0003] CRISPR / Cas9 is a gene editing technology that can quickly, cheaply and relatively easily modify genes in cells and organisms, and is superior to early methods such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) in cost-effectiveness and ease of use, marking a major advance in the field. The CRISPR-Cas9 system consists of two basic components: Cas9 protein and guide RNA (gRNA). Cas9 acts as a molecular scissors that cuts DNA at a predetermined target site under the guidance of gRNA, and gRNA pairs with the target DNA sequence. This molecular mechanism is originally derived from the adaptive immune system of bacteria, and due to its simplicity and adaptability, it has been used for genome editing in various organisms including humans, and has immeasurable value in basic research, treatment and crop improvement.

[0004] Aflatoxin M1 (AFM1) is a product of hydroxylation of aflatoxin B1 (AFB1) in the liver of mammals such as cattle and sheep after eating feed contaminated by AFB1, and is secreted and enriched in milk. It is the only mycotoxin with a safety limit in milk. AFM1 can promote the occurrence and development of liver cancer, immune system diseases, and growth-related problems in children, and can also cause intestinal barrier damage such as intestinal cell damage, destruction of intestinal tight junctions, and increased intestinal permeability. In China, in December 2011, a brand of pure milk was detected to exceed the standard of AFM1, and in July 2012, a brand of infant milk powder was detected to exceed the standard of AFM1. In the world, AFM1 is also a mycotoxin that poses a greater risk to human health, and is the focus of food safety risk assessment research. Different countries have set maximum residue limits for AFM1 in milk and dairy products. The limit of AFM1 in the United States and China is not higher than 0.5 μg / kg, and the limit of AFM1 in the European Union is not higher than 0.05 μg / kg, and it is also stipulated that AFM1 cannot be detected in infant milk products.

[0005] Immunoassay technology is a common technology for detecting AFM1 in milk and dairy products. The main methods are colloidal gold test strips and ELISA kits. The detection limit of colloidal gold test strips is about 50 ppt, and the detection limit of ELISA is about 5 ppt, but the working stability is low, and the linear range is narrow, which are difficult to meet the detection requirements. Antibodies are the core reagents of immunoassay technology, and there is an upper limit to the affinity and specific recognition of AFM1. At present, the technology for preparing antibodies cannot obtain antibodies with ultra-high sensitivity.

[0006] Therefore, the present application is proposed. SUMMARY

[0007] To solve the above technical problems, the present application provides a preparation method and application of a monoclonal antibody with a luciferase label, which aims to improve the sensitivity of the AFM1 immunoassay method and reduce the detection limit from the perspective of signal labeling.

[0008] Specifically, the technical scheme of the present application is as follows:

[0009] In a first aspect, the present application provides a preparation method of a monoclonal antibody with a luciferase label, which uses CRISPR / Cas9 to knock in a luciferase gene into the Ig gene of a hybridoma cell secreting a monoclonal antibody, to obtain a stable cell strain with the function of secreting a monoclonal antibody with a luciferase label, and then uses the stable cell strain to prepare a monoclonal antibody with a luciferase label.

[0010] Preferably, the hybridoma cell is an AFM1 hybridoma cell of IgG1 subtype.

[0011] Preferably, the luciferase is Nanoluciferase (NLuc).

[0012] Preferably, the nucleotide sequence of the luciferase gene is shown in SEQ ID NO. 01.

[0013] In the second aspect, the present application provides a monoclonal antibody labeled with luciferase, which is prepared by the preparation method of the first aspect.

[0014] Preferably, the monoclonal antibody is labeled with NanoLuc luciferase, the molecular weight of NanoLuc luciferase is 19 kDa, which can produce extremely bright and persistent luminescent signals, is independent of ATP, has good stability in high temperature, pH value, urea and NaCl sensitivity determination, and maximizes the luminescent signal through Furimazine substrate.

[0015] In the third aspect, the present application provides a hybridoma cell strain for preparing the monoclonal antibody, the hybridoma cell strain has the function of secreting the AFM1 monoclonal antibody labeled with NanoLuc luciferase, and the gene for expressing NanoLuc luciferase is located at the C-terminal of the AFM1 antibody gene.

[0016] In the fourth aspect, the present application provides a biological material for constructing the hybridoma cell strain, the biological material includes sgRNA-Cas9 ribonucleoprotein complex and / or homologous recombination repair template plasmid; the homologous recombination repair template plasmid contains GGGGS)3 linker peptide, the gene of NanoLuc luciferase and puromycin drug selection gene.

[0017] In the fifth aspect, the present application provides the application of the preparation method of the first aspect, the monoclonal antibody of the second aspect, the hybridoma cell strain of the third aspect or the biological material of the fourth aspect in detecting AFM1 for non-disease diagnosis purposes.

[0018] In the sixth aspect, the present application provides the application of the preparation method of the first aspect, the monoclonal antibody of the second aspect, the hybridoma cell strain of the third aspect or the biological material of the fourth aspect in preparing an enzyme-linked immunoassay kit for detecting AFM1.

[0019] Beneficial effects:

[0020] The application provides a preparation method and application of a monoclonal antibody labeled with luciferase, and the method comprises the following steps: firstly, a luciferase gene is knocked into an Ig gene of a hybridoma cell secreting a monoclonal antibody by using a CRISPR / Cas9 gene editing technology, so that a stable cell strain with the function of secreting the monoclonal antibody labeled with luciferase is obtained; and then the stable cell strain is used to prepare the monoclonal antibody labeled with luciferase. The method provided by the application can improve the sensitivity of an antigen immunization analysis method and reduce the detection limit from the perspective of signal labeling. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be described below.

[0022] Figure 1 is a biological luminescence reaction mechanism catalyzed by Nanoluc luciferase in the application.

[0023] Figure 2 is a Sanger sequencing result of a B19 cell genome in embodiment 1 of the application.

[0024] Figure 3 is an IGHG1 gene map of a hybridoma cell after gene knock-in in embodiment 1 of the application.

[0025] Figure 4 is a PCR identification result of a T1 cell pool after transfection under the conditions of 200V, 250V and 300V in embodiment 1 of the application.

[0026] Figure 5 is a product electrophoresis map of amplification and identification of a NanoLuc luciferase gene after formal transfection of T1, T2 and T3 cell pools under the condition of 250V in embodiment 1 of the application.

[0027] Figure 6 is a Sanger sequencing identification result of a T1 cell pool in embodiment 1 of the application.

[0028] Figure 7 is a standard curve diagram of B19 cells established in the comparison of antibody sensitivity in the performance evaluation part of the monoclonal antibody in embodiment 1 of the application.

[0029] Figure 8 is a standard curve diagram of KIB19 cells established in the comparison of antibody sensitivity in the performance evaluation part of the monoclonal antibody in embodiment 1 of the application.

[0030] Figure 9 is a primer map for modification of a cell line verification in the application. DETAILED DESCRIPTION

[0031] The application provides a preparation method and application of a monoclonal antibody labeled with luciferase, and aims to improve the sensitivity and reduce the detection limit of an AFM1 immune analysis method from the perspective of signal labeling.

[0032] To achieve the object of the application, a simple and efficient enzyme labeling method is developed by taking a hybridoma cell secreting aflatoxin monoclonal antibody as a model cell, a Nanoluc gene is knocked into an Ig gene of the hybridoma cell secreting AFM1 monoclonal antibody by using CRISPR / Cas9 technology, that is, the Nanoluc gene fragment is integrated at the Fc end of the antibody, a stable cell line secreting the antibody labeled with the Nanoluc luciferase signal is constructed, and a bioluminescence immunoassay (BLIA) is established by using the Nanoluc enzyme, so that the disadvantages of a traditional signal labeling method are overcome, the sensitivity of the AFM1 immune analysis method is improved, and the detection limit is reduced from the perspective of signal labeling.

[0033] The application provides a method for establishing a hybridoma cell strain with an AFM1 antibody C-terminal gene labeled with a Nanoluc luciferase gene, which comprises the following steps:

[0034] (1) performing genome sequencing on the Fc end of the AFM1 hybridoma cell of the IgG1 subtype;

[0035] (2) designing and synthesizing an sgRNA-Cas9 ribosome nucleoprotein complex (RNP complex) and a homologous repair template plasmid according to the sequencing result;

[0036] (3) optimizing the electroporation voltage condition in consideration of the transfection efficiency and cell survival rate;

[0037] (4) co-transfecting the sgRNA-Cas9 RNP complex and the template plasmid into the AFM1 hybridoma cell under the voltage condition in step (3), and obtaining the stably transfected cell through antibiotic resistance screening.

[0038] (5) amplifying and identifying the Nanoluc luciferase gene of the cell line obtained through screening by using PCR and DNA sequencing.

[0039] Preferably, the sgRNA sequence is GGACACTGGGATCATTTACC (SEQ ID NO. 02).

[0040] Preferably, the homologous repair template sequence comprises a Nanoluc luciferase gene and a puromycin drug selection gene.

[0041] Preferably, the antibiotic resistance screening is to culture the transfected cells in a selection medium containing puromycin, and the unsuccessfully transfected cells without the resistant gene are killed by the antibiotic, so as to obtain a stably transfected cell strain.

[0042] The puromycin is an aminoglycoside antibiotic produced by Streptomyces alboniger, is an analogue of the 3' end of aminoacyl-tRNA molecules, can be combined with the A site of ribosome and incorporated into the extended peptide chain, disrupts the peptide transport on the ribosome, causes the immature chain to terminate in the translation process, and thus inhibits protein synthesis.

[0043] In a more specific embodiment provided in the present application, the primer map for verifying the modified cell line is shown in the following table: Figure 9 . Figure 9 In a specific embodiment, the primers C7387-HAL-F / R, C7387-HAR-2F / 2R are used for detecting the target insertion sequence of the T1 cell pool. The primers C7387-HA-F / R are used for amplification and sequencing of the B19 negative cells. The hybridoma cells successfully transfected and identified by PCR and DNA sequencing, i.e. the hybridoma cells secreting the AFM1 antibody labeled with Nanoluc luciferase, are named as KI B19 in the present application.

[0044] The primer sequences involved are as follows:

[0045] C7387-HAL-F / R (5'>3'):

[0046] Forward: GATTCCCTCGTAAGGCCTGC (SEQ ID NO. 03)

[0047] Reverse: TCATCTGTCTTCATCTTCCCCC (SEQ ID NO. 04)

[0048] C7387-HAR-2F / 2R (5'>3'):

[0049] Forward: CGCCAGTCTGAGGTTCAGG (SEQ ID NO. 05)

[0050] Reverse: AACCTGGGAGTGTCTGTGAC (SEQ ID NO. 06)

[0051] C7387-HA-F / R (5'>3'):

[0052] Forward: GCCTAGGGATAAGGCTCCAC (SEQ ID NO. 07)

[0053] Reverse: AGCCAGCGGAGAACTACAAG (SEQ ID NO. 08)

[0054] The application further provides a preparation method of a mouse-derived AFM1 monoclonal antibody labeled with NanoLuc luciferase, comprising the following steps:

[0055] The KIB19 is cultured in large scale, the supernatant antibody titer of all cell plates in each group is detected by the BLIA method under the optimal coating original concentration, the number of hybridoma clones in each well is observed under a microscope according to the titer result, and the positive cell well with high titer and few clones is selected for subsequent inhibition detection.

[0056] The optimal coating original concentration needs to be observed after subculturing for one week, and is determined by setting different concentrations of coating original for positive pre-detection of the supernatant of hybridoma cells.

[0057] According to the inhibition detection result in the supernatant stage, the inhibition of the supernatant antibody of each positive well is detected by the BLIA method with two gradient standard product concentrations, and finally the cell well with high titer, good inhibition and few cell clones is selected for subcloning.

[0058] The KIB19 monoclonal cell strain is preferably subcloned by the limited dilution method. The monoclonal antibody is an antibody secreted by a single hybridoma cell and its offspring which can only produce a single antibody, and the limited dilution cloning can ensure to avoid the problem of multiple specificity and at the same time reduce the risk of excessive growth of cells which do not produce antibodies as much as possible.

[0059] The KIB19 after subcloning is preferably cultured in large scale, and the monoclonal antibody is prepared by the in vivo induced ascites method.

[0060] The application further provides a BLIA method based on the AFM1 monoclonal antibody, and the specific steps are as follows:

[0061] (1) coating: 100ul / well of coating original, 4℃, 16h overnight coating. Wash once and spin dry;

[0062] (2) blocking: 160ul / well of blocking solution, 37℃ incubator, 1h. Spin dry;

[0063] (3) AFM1 standard product, 50ul / well, Ab, 50ul / well. 37℃ incubator, 30min.

[0064] Wash 3 times and spin dry;

[0065] (4) substrate: Furimazine substrate 1:50 dilution, 100ul / well;

[0066] (5) Multifunctional enzyme reader.

[0067] Wherein, the coating agent is preferably AFM1 conjugated BSA. The Furimazine substrate is preferably from the Luciferase Assay System kit produced by Promega Company. Luciferase Assay System kit.

[0068] The present application takes hybridoma cells secreting AFM1 antibodies as model cells, after sequencing, designs sgRNA and homologous recombination repair template, transfects, and obtains stably transfected cells (can secrete AFM1 monoclonal antibodies, which have Nanoluc gene in Ig gene) through antibiotic screening, PCR identification and DNA sequencing, that is, the Fc end of the antibody integrates the Nanoluc gene fragment, realizes that the secreted antibody is labeled with NanoLuc luciferase signal, and obtains single hybridoma cells that only produce single antibodies through hybridoma cell screening technology and limited dilution method. The AFM1 monoclonal antibody labeled with NanoLuc luciferase is produced by using in vivo induction of ascites, and an immunoassay method is established, which improves the sensitivity of the AFM1 immunoassay method from the perspective of signal labeling, and is of great significance to the improvement of the detection limit of AFM1. In addition, the method provided by the present application is a general method, and all hybridoma cells can obtain labeled antibodies with labeled signal enzyme molecules by using this method.

[0069] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application. If not specifically indicated, the experimental methods used in the examples are conventional methods; the materials, reagents and the like used can be obtained from commercial channels.

[0070] The materials and reagents used in the following examples are as follows: sgRNA is purchased from GenScript Company; DMEM is purchased from ATCC Company; puromycin and FBS are purchased from Gibco Company; BSA, DMSO, HAT and HT are purchased from Sigma Company; 96-well enzyme-labeled plate is purchased from Costar Company; electroporation equipment is purchased from Celetrix Company; centrifuge is purchased from Eppendorf Company; CO2 incubator is purchased from Thermo Company; microplate dehydration instrument is purchased from Labgic Tianjin Bioses Company; Balb / c mice are purchased from Beijing Vito Li Hua Experimental Animal Technology Co., Ltd. Luciferase Assay kit is purchased from Promega Company.

[0071] Example 1

[0072] (I) Construction of hybridoma cell strain with NanoLuc luciferase gene at C-terminal of AFM1 antibody

[0073] 1. Select an antibody affinity higher IgG1 subtype of AFM1 hybridoma cell strain B19 from the laboratory, extract the Fc region genomic DNA of B19 and then sequence;

[0074] 2. Design sgRNA and homologous repair templates according to the sequencing results, design 3 sgRNAs at the position of the CH3 end, and synthesize 3 different sgRNA-Cas9 ribosome nucleoprotein complexes (RNP complexes).

[0075] gRNA-T1: GGACACTGGGATCATTTACC (SEQ ID NO. 02)

[0076] gRNA-T2: GGGATCATTTACCAGGAGAG (SEQ ID NO. 09)

[0077] gRNA-T3: GTAAATGATCCCAGTGTCCT (SEQ ID NO. 10)

[0078] The gene of NanoLuc luciferase is codon-optimized and designed into a homologous repair template together with a puromycin drug selection gene;

[0079] The application provides a NanoLuc target insertion sequence:

[0080] GGGGGCGGGGGTTCAGGTGGTGGTGGTTCAGGGGGGGGTGGGTCCGTGTTTACACTGGAAGATTTCGTCGGTGATTGGAGACAGACTGCCGGCTACAACCTGGACCAGGTGCTGGAGCAGGGCGGAGTGAGCTCCCTGTTCCAGAACCTGGGAGTGTCTGTGACACCAATCCAGAGGATCGTGCTGAGCGGCGAGAACGGACTGAAGATCGACATCCACGTGATCATCCCCTACGAGGGCCTGTCCGGAGATCAGATGGGCCAGATCGAGAAGATCTTCAAGGTGGTGTACCCTGTGGACGATCACCACTTTAAGGTGATCCTGCACTACGGCACACTGGTGATCGACGGAGTGACCCCCAACATGATCGATTACTTCGGCAGGCCTTACGAGGGAATCGCCGTGTTCGATGGCAAGAAGATCACCGTGACAGGCACCCTGTGGAACGGAAACAAGATCATCGACGAGAGACTGATCAACCCAGATGGATCTCTGCTGTTTAGAGTGACTATCAATGGAGTGACTGGGTGGAGACTGTGCGAGAGGATTCTGGCT (SEQ ID NO. 01)

[0081] 3. Detect the transfection efficiency and cell viability after transfection at different voltages (Table 1). Optimize the voltage conditions for electroporation of B19 with one of the RNP complexes. Set 200V, 250V, 300V, 3 voltage gradients, after the transfection of the cells is expanded and cultured for PCR amplification detection, HAL, HAR primers are used for the detection of inserted sequences, HA primers are used for the detection of B19 negative control original gene. The results show that with the increase of voltage, the transfection efficiency is improved, but the cell viability is decreased obviously, finally 250V is selected for formal transfection;

[0082] Table 1 Cell viability under different voltage conditions

[0083]

[0084]

[0085] 4. 250V voltage 3 kinds of RNP complex with homologous repair template plasmid co-transfected into B19, three rounds of puromycin drug screening transfection successful cells. The three cell pools obtained were amplified and identified by NanoLuc luciferase gene, and the target fragment was detected;

[0086] 5. Then the whole fragment of gene knock-in was sequenced and verified. The NanoLuc gene was detected in the three cell pools, but there was drug selection gene loss and complex unknown integration problem in T3 cell pool; finally, T1 cell pool was selected for expansion culture.

[0087] (II) Screening of hybridoma cells

[0088] 1. Preparation of feeder cells

[0089] The feeder cells were prepared from 2-month-old non-immune Balb / c mice one day before fusion, and the operation process was as follows:

[0090] (1) The mouse was killed by cervical dislocation with appropriate force to prevent excessive force from causing internal bleeding, then it was soaked in 75% alcohol for 5 min and transferred to the clean bench for operation;

[0091] (2) Place the mouse belly up in a sterile plastic shell, use a sterilized forceps to lift the abdominal skin, cut a small hole with scissors, then gently tear the skin with your hand to expose the mouse peritoneum;

[0092] (3) Hold the peritoneum with a sterilized forceps in the left hand, hold a syringe containing 5 mL of 20% HT medium in the right hand, inject the medium into the mouse abdominal cavity along the horizontal direction, then gently massage the abdomen for 2-3 min to fully dissociate the cells in the abdominal cavity, and then use a syringe to aspirate the liquid in the abdominal cavity. Repeat the above operation to fully obtain the cells in the mouse abdominal cavity;

[0093] (4) The feeder cells prepared from each mouse can be plated in 6 96-well cell plates, and a certain amount of feeder cells are prepared according to the experimental requirements, plated in 96-well cell culture plates at 100 μL / well, and cultured in a 37°C, 5% CO2 incubator.

[0094] 2. Observe the growth state of the hybridoma cells after successful transfection, set different concentrations of coating agent, and pre-detect the positive KIB19 supernatant (Table 2). Under the optimal coating agent concentration of 9K, detect the antibody titer of the supernatant of all cell plates in each group by BLIA method, observe the number of hybridoma clones in each well under a microscope according to the titer results, select the positive cell well with high titer and few clones for subsequent inhibition detection (Table 3), set two gradient standard concentrations, 0.5 ng / mL and 1 ng / mL respectively, and detect the inhibition of the supernatant antibody of each positive well by BLIA method, and finally select the cell well with high titer, good inhibition and few cell clones for subcloning.

[0095] Table 2 Positive detection of cell supernatant before subcloning

[0096]

[0097] Table 3 Inhibition detection of cell supernatant before subcloning (coating agent: AFM1-BSA 9k)

[0098]

[0099]

[0100] 3. Subcloning of hybridoma cells, the subcloning process adopts limited dilution method, and the operation process is as follows:

[0101] (1) Observe and record the number of cell clusters and their approximate positions in the cell well under a microscope, then transfer to the super-clean bench for operation, gently suck the supernatant away from the cell distribution position, put the supernatant into a cryopreservation tube and mark it, then gently add 100 μL of 20% HT medium along the well wall, and then suck it again and put it into the cryopreservation tube. On the one hand, it is to remove the suspended cells on the cell clusters, and on the other hand, it is to save the cell strain to prevent the cell strain from turning negative or being lost in the subsequent cloning process;

[0102] (2) Use a 200 μL pipette to suck a single cell cluster at the corresponding position, then transfer the sucked cell cluster to the A1 well of the feeder cell plate, add 100 μL of medium again, and observe whether the cell cluster is successfully sucked under a microscope. If it is successfully sucked, the next cell cluster can be sucked according to the same operation until all the cell clusters in a well are sucked. Add to the first column of 8 wells of the feeder cells, and ensure that A1 to H1 wells are single cell clusters;

[0103] (3) Subclone by 3-fold dilution: use the gun to add 200 μL HT medium to the first column of the feeder cell plate, at this time the liquid volume of the first column is 300 μL, after mixing gently, 100 μL is taken to the second column, the third column, 200 μL HT medium is added to the first column again, 100 μL is taken to the fourth column, the fifth column, and so on until the last column is diluted. Finally, the volume of all wells is supplemented to 300 μL;

[0104] (4) KI B19 and B19 are subcloned separately according to the above operation, and after labeling, they are placed in a 37°C, 5% CO2 incubator for culture. After 7-10 days, the next round of cell supernatant detection and subcloning can be performed;

[0105] (5) Stable hybridoma cell lines can be obtained when single cell clusters appear in each group of cells during subcloning for three consecutive times.

[0106] 4. Expansion culture and cryopreservation of hybridoma cells

[0107] (1) Expansion culture: select 5-10 cell wells that perform well in the last subcloning process, and transfer the cells to a 24-well cell plate for expansion culture. Observe the growth state of the cells, and replace the culture medium every 2-3 days. When the cell number occupies about 80% of the cell well, transfer to a 6-well cell plate for expansion culture. When the cells grow to fill the 6-well cell plate, cryopreservation can be performed.

[0108] (2) Cell cryopreservation: collect the cells in the 6-well cell plate and transfer them to a centrifuge tube. Mix thoroughly, take 20 μL of the cell suspension, and count the cells according to the above operation. Centrifuge at 1000 rpm for 5 min, discard the supernatant, and add cryopreservation solution (90% serum + 10% DMSO) to dilute the cell concentration to about 10 8 cells / mL. Add 1 mL of cells to each cryopreservation tube. Label the cryopreservation tubes, first store them in a -20°C freezer for 24 h, and then transfer them to a liquid nitrogen tank for long-term storage.

[0109] (Three) Preparation of monoclonal antibodies

[0110] Monoclonal antibodies are prepared by in vivo induction of ascites, and the operation process is as follows:

[0111] (1) Select 8 Balb / c mice aged 2 months or older, and inject liquid paraffin into the abdominal cavity of the mice 7-15 days in advance, 0.5 mL per mouse, to reduce the generation of solid tumors and induce the body to produce ascites;

[0112] (2) Collect B19 and KI B19 in 24-well cell plates in logarithmic growth phase, centrifuge at 1000 rpm for 5 min, discard the supernatant after the end, add 5 mL of 10% DMEM medium to resuspend the cells, mix thoroughly, then take 20 μL of the cell suspension to count the cells according to the above operation, and control the cell concentration at 10 6 cells / mL, take the cell suspension with a 5 mL syringe for standby;

[0113] (3) Hold the mouse with the left hand, tilt the syringe to the right hand at the midpoint of the two nipples, insert the needle into the mouse abdominal cavity, shake gently to ensure that it does not pierce the subcutaneous or internal organs, then inject. Each mouse is injected with 0.5 mL of cell suspension;

[0114] (4) After inoculation of hybridoma cells for 7-10 days, observe the mice daily to prevent sudden death of the mice, and collect the ascites after the mouse abdomen is swollen;

[0115] (5) When collecting ascites, still hold the mouse with the left hand, tilt the syringe to the right hand at the midpoint of the two nipples, then slowly suck outward, if resistance is felt, adjust the needle direction appropriately and gently massage the mouse abdomen to collect more ascites;

[0116] (6) Place the collected ascites in a centrifuge tube, centrifuge at 10000 rpm for 10 min, collect the clear liquid to obtain the monoclonal antibody, then store it in a -20℃ refrigerator after aliquoting for standby.

[0117] (Four) Evaluation of the performance of the monoclonal antibody

[0118] 1. Screening of the coated original

[0119] The ic-ELISA method and the BILA method were used to cross-pair the monoclonal antibodies of B19 and KI B19 with three coated originals (AFM1-BSA, AFB1-BSA, AFB2-BSA, purchased from Beijing Weide Weikang Biotechnology Co., Ltd., or can be synthesized by oneself) respectively, and a standard curve was established to obtain the sensitivity (IC50) of the antibody. The ODmax / IC50 value or the Relative Light Unit (RLU) RLUmax / IC50 value was used as the judgment standard for antibody coated original screening (ODmax / RLUmax refers to the OD value or RLU without standard competition), the higher the ratio, the higher the affinity of the antibody to the coated original. The results are shown in Table 4. The results show that the best coated original of B19 is AFB2-BSA, and the best coated original of KI B19 is AFB2-BSA.

[0120] Table 4 Screening results of monoclonal antibody coated original

[0121]

[0122] 2. Antibody sensitivity comparison

[0123] Establishment of standard curve of B19 monoclonal antibody Figure 7 ) and KI B19 Figure 8 ) monoclonal antibody, and the IC50 of B19 is 0.044 μg / L; the IC50 of KI B19 is 0.035 μg / L. Comprehensive analysis shows that the monoclonal antibody obtained by the hybridoma cell (KI B19) transfected with sgRNA-Cas9 ribonucleoprotein complex (RNP complex) and the hybridoma cell strain with NanoLuc luciferase gene at the C-terminal gene of AFM1 antibody has the highest sensitivity, and the detection limit of AFM1 reaches the requirements of the United States and China of 0.5 μg / kg, and also reaches the high standard of the European Union of 0.05 μg / kg limit, and the sensitivity is improved compared with the original antibody. Therefore, it can be concluded that the preparation of AFM1 monoclonal antibody with NanoLuc luciferase label and the establishment of immunoassay method can improve the sensitivity of AFM1 immunoassay method.

[0124] The above-described embodiments only express several embodiments of the present application, facilitate specific and detailed understanding of the technical solutions of the present application, but cannot be understood as a limitation on the protection scope of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which all belong to the protection scope of the present application.

Claims

1. A method for preparing a monoclonal antibody labeled with nanoluciferase, characterized by, The application discloses a method for preparing a monoclonal antibody with a nanoluciferase label by using CRISPR / Cas9 to knock in a nanoluciferase gene into an Ig gene of a hybridoma cell secreting a monoclonal antibody, and a monoclonal antibody with a nanoluciferase label prepared by using the stable cell strain.

2. The method for preparing monoclonal antibodies with self-contained luciferase nanoparticle labeling according to claim 1, characterized in that, The hybridoma cell is an AFM1 hybridoma cell of IgG1 subtype.

3. The method of claim 1 or 2, wherein the monoclonal antibody is labeled with a nanoluciferase. The nanoluciferase is NanoLuc luciferase.

4. The method for preparing the monoclonal antibody labeled with nanoluciferase according to any one of claims 1-3, characterized in that, The nucleotide sequence of the nanoluciferase gene is shown as SEQ ID NO.

01.

5. A monoclonal antibody labeled with nanoluciferase, characterized in that, The monoclonal antibody with a nanoluciferase label is prepared by the method of any one of claims 1-4.

6. The monoclonal antibody of claim 5, wherein, The monoclonal antibody with a nanoluciferase label is prepared by the method of any one of claims 1-4.

7. A hybridoma cell strain for the preparation of a monoclonal antibody according to claim 5 or 6, characterized in that, The nanoluciferase has a molecular weight of 19 kDa, and a luminescent signal is maximized by using a Furimazine substrate.

8. Biomaterial for the construction of the hybridoma cell line according to claim 7, characterized by the fact that it is a mixture of 50% of DMEM and 50% of RPMI 1640. The hybridoma cell strain has the function of secreting an AFM1 monoclonal antibody with a nanoluciferase label, and a gene for expressing the nanoluciferase is located at the C terminal of the AFM1 antibody gene. The biomaterials include sgRNA-Cas9 ribonucleoprotein complex and / or a homologous recombination repair template plasmid; the homologous recombination repair template plasmid contains a (GGGGS)3 connecting peptide, a gene of nanoluciferase and a puromycin drug selection gene.

9. The application of the preparation method of any one of claims 1-4 or the monoclonal antibody of any one of claims 5 or 6 or the hybridoma cell strain of claim 7 or the biomaterial of claim 8 in detecting AFM1 for non-disease diagnosis purposes.

10. The application of the preparation method of any one of claims 1-4 or the monoclonal antibody of any one of claims 5 or 6 or the hybridoma cell strain of claim 7 or the biomaterial of claim 8 in preparing an enzyme-linked immunoassay kit for detecting AFM1.

Images