Genetically engineered bacterium with high yield of L-homoserine as well as construction method and application of genetically engineered bacterium

Abstract

The invention belongs to the field of synthetic biology, and particularly relates to a genetically engineered bacterium for high-yield non-protein amino acid as well as a construction method and application of the genetically engineered bacterium. The genetically engineered bacterium is obtained by taking Escherichia coli HSCC4 as an original strain and carrying out the following various series of metabolic engineering modifications on the original strain, including a way of reducing the consumption of malic acid to generate pyruvic acid; the carbon flow is limited to enter a complete TCA cycle for oxygenolysis, and carbon metabolism is forced to more depend on a supplementation pathway to generate oxaloacetic acid; and the competitive pathway of carbon and nitrogen flowing to branched chain amino acid synthesis is reduced. The original strain is subjected to specific metabolic engineering modification, so that the original strain can better utilize carbon source substances such as glucose and the like to produce the L-homoserine, nutritional defects are remarkably reduced, and the strain without plasmids has better production performance. Compared with a starting strain HSCC4, the genetically engineered strain disclosed by the invention has the advantages that the shake flask level of a plasmid-free strain is improved from 18.83 g / L to 20.25 g / L, and the genetically engineered strain has important industrial application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of synthetic biology, and particularly relates to a genetically engineered bacterium with high yield of non-protein amino acid and a construction method and application thereof. BACKGROUND

[0002] L-homoserine (2-Amino-4-hydroxybutyric acid) is a non-essential amino acid that plays an important role in the body, is a key component of protein synthesis, and can participate in the construction of polypeptide chains of proteins. In addition, it is also involved in the synthesis of neurotransmitters, the construction of cell membranes, and other biological processes. In medicine, L-homoserine can be used as a nutritional supplement and is also used to treat specific genetic metabolic diseases. In industrial production, L-homoserine can be used to produce methionine, threonine and other amino acids, as well as a variety of C4 compounds and chiral herbicide L-phosphinothricin, etc. It is an intermediate with great industrial potential. In addition, L-homoserine and its derivatives are widely used in agriculture, animal husbandry, medicine and other industries.

[0003] In the prior art, there are three main methods for preparing L-homoserine, namely chemical synthesis, chemical chiral resolution and biological method. With the development of biological method, amino acids have been completely produced by microbial fermentation, thereby realizing the direct production of amino acids from renewable resources, reducing the dependence on petroleum-based raw materials, and being more green and environmentally friendly. In recent years, many researchers have studied L-homoserine and its derivatives, and many engineering strains have emerged. Existing researches mainly focus on the main synthesis pathway, the external transport system and the cofactor module, as well as the competition and degradation pathway. Among them, the modification of the main pathway is the most important, including improving the glucose uptake system, increasing the utilization rate of oxaloacetate, promoting the flux of aspartate, and enhancing the synthesis of L-homoserine. For example, the team of Professor Yu Bo of Beijing Institute of Microbiology systematically analyzed the synthesis pathway of L-homoserine, adjusted the flow ratio of aspartate synthesis, combined the aspartate synthesis pathway with the aspartate synthesis pathway, and finally achieved a fermentation level of 84.1 g / L. However, the defects of this strain are also very obvious. This strain is a nutrition-deficient strain composed of three amino acids, and has one or even two plasmids with genetic instability. For example, the team of Professor Rao Zhiming of Jiangnan University proposed a cofactor synergistic utilization strategy. In fed-batch fermentation, the strain produced 85.29 g / L L-homoserine with a glucose yield of 0.43 g / g. However, the above methods are difficult to meet the needs of large-scale industrial production. Suitable strains not only need to reduce amino acid nutritional deficiencies and use plasmids, but also need to improve yield and yield. SUMMARY

[0004] The present application is to overcome the low yield of biosynthesis of L-homoserine in the prior art, and the use of engineering bacteria containing plasmids affecting the stability of continuous production, and provides a genetically engineered bacteria with high yield of L-homoserine, and a construction method and application thereof to overcome the above defects.

[0005] To achieve the purpose of the application, the present application is realized by the following technical solutions: In a first aspect, the present application discloses a genetically engineered bacteria with high yield of L-homoserine, which is obtained by series of metabolic engineering modification on the starting strain Escherichia coli HSCC4. The metabolic engineering modification on the starting strain includes any one or more of the following methods: (1) reducing the pathway of malate consumed to generate pyruvate; (2) limiting the carbon flow into the complete TCA cycle for oxidative decomposition, and forcing the carbon metabolism to rely more on the re-supply pathway to generate oxaloacetate; (3) reducing the competition pathway of carbon and nitrogen flow to branched-chain amino acid synthesis.

[0006] The selected starting strain Escherichia coli HSCC4 has been disclosed in patent application No. 202311617947.2, publication No. CN117535330A, and is provided by Zhejiang University of Microbial Strain Preservation.

[0007] In Escherichia coli, the synthesis pathway of homoserine can be divided into two main modules: aspartate module and serine module. With glucose as the carbon source, it enters the cell through the phosphoenolpyruvate sugar phosphate transferase system (PTS) or the non-phosphoenolpyruvate sugar phosphate transferase system (no-PTS). Under the action of glycolysis pathway, phosphoenolpyruvate (PEP) and pyruvate (PYR) are generated. PEP is directly converted to oxaloacetate by phosphoenolpyruvate carboxylase (PEPC, encoded by ppc). Oxaloacetate forms aspartate under the action of aspartate transaminase (encoded by aspC). Aspartate is phosphorylated to aspartate-4-phosphate by aspartate kinase (encoded by ask). Aspartate-4-phosphate is dehydrogenated to aspartate-4-phosphate-semialdehyde by aspartate-4-phosphate dehydrogenase (encoded by asd). Aspartate-4-phosphate-semialdehyde is transaminated to homoserine by aspartate-4-phosphate-semialdehyde transaminase (encoded by thrA).

[0008] Therefore, the present application uses Escherichia coli HSCC4 as a chassis strain, and at least steps (1)-(3) are performed to construct a recombinant Escherichia coli, and the present application improves the production performance of the recombinant Escherichia coli by pulling carbon flow to products, weakening TCA and weakening branched-chain amino acid pathways.

[0009] Specifically, steps (1)-(3) achieve the following effects: In method (1), the pathway of malate consumed to generate pyruvate is reduced, so that more carbon flow tends to remain near oxaloacetate (or its aminated product aspartate); In method (2), the carbon flow entering the complete TCA cycle for oxidative decomposition is limited, forcing carbon metabolism to rely more on the back-up pathway (such as ppc) to generate oxaloacetate, thereby more specifically guiding carbon flow to the synthesis of aspartate and L-homoserine, so that more carbon flow flows to the synthesis pathway; In method (3), the expression of branched-chain amino acid transaminase gene ilvE is weakened, reducing the competition pathway of carbon and nitrogen to branched-chain amino acid synthesis, saving pyruvate (which can be used to back up OAA) and glutamate (which is used for transamination reaction).

[0010] Further, in the method (1), by knocking out the malate dehydrogenase encoding gene maeA, the pathway of malate consumed to generate pyruvate is reduced.

[0011] Further, in the method (2), by knocking out the fumarase encoding gene fumA, the carbon flow entering the complete TCA cycle for oxidative decomposition is limited.

[0012] Further, in the method (3), by weakening the expression of the branched-chain amino acid transaminase encoding gene ilvE, the competition pathway of carbon and nitrogen to branched-chain amino acid synthesis is reduced.

[0013] Further, in the method (3), the weakening of the expression of gene ilvE is achieved by changing the start codon.

[0014] Further, in the method (3), the weakening of the expression of ilvE is achieved by changing the start codon ATG to GTG.

[0015] The genes encoding malate dehydrogenase, fumarase and branched-chain amino acid transaminase in the application are generally represented as maeA, fumA and ilvE, respectively. The gene sequences of the above genes can be obtained from the public database, the National Center for Biotechnology Information (NCBI). The gene sequence of the maeA is Gene ID: 946031, the gene sequence of the fumA is Gene ID: 946826, and the gene sequence of the ilvE is Gene ID: 948278.

[0016] In a second aspect, the application further discloses an application of the genetically engineered bacteria for high-yield L-homoserine in microbial fermentation for producing L-homoserine.

[0017] In a third aspect, the application further discloses a method for producing L-homoserine, comprising the following steps: inoculating the genetically engineered bacteria as described above into a fermentation medium, and carrying out fermentation culture under the conditions of 25-35℃ and 180-220 rpm; and separating and purifying the culture solution at the end of the culture to obtain L-homoserine.

[0018] Further, the fermentation medium comprises 40 g / L Glucose, 17 g / L (NH4)2SO4, 4 g / L Yeast extract, 1 g / L KH2PO4, 1 g / L MgSO4, 0.005 g / L FeSO4·7H2O, 0.005 g / L MnSO4·7H2O, 0.005 g / L ZnSO4 and 25 g / L CaCO3.

[0019] Further, the CaCO3 in the fermentation medium is sterilized separately.

[0020] Therefore, the application has the following beneficial effects: Compared with the wild type and the chassis strain, the genetically engineered bacteria for high-yield L-homoserine can better utilize carbon source materials such as glucose for the production of L-homoserine, and greatly reduces the nutritional deficiency. The strain without plasmid can have good production performance, has high yield and high conversion rate. The strain with the best performance obtained after modification has a significant improvement in the level of fermentation production of L-homoserine compared with the starting strain HSCC4. The shake flask level of the strain without plasmid is increased from 18.83 g / L to 20.25 g / L, the 5L tank fermentation level is increased from 110 g / L to 120.16 g / L, the sugar acid conversion rate is 0.71 g / g, and the space-time yield is 1.668 g / L / h. The genetically engineered bacteria provided by the application have important industrial application value and are suitable for popularization and application in actual production. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Fermentation curve of 5L tank for engineering strain HBB-5. DETAILED DESCRIPTION

[0022] The application will be further described below in connection with specific embodiments. A person skilled in the art will be able to implement the application based on these descriptions. In addition, the embodiments of the application involved in the following description are generally only embodiments of a part of the application, not all embodiments. Therefore, based on the embodiments in the application, all other embodiments obtained by a person skilled in the art without creative labor shall fall within the scope of protection of the application. In the following examples, the experimental methods are conventional methods unless otherwise specified. The test materials used in the following examples are conventional biochemical reagents unless otherwise specified.

[0023] The chassis strain Escherichia coli HSCC4 used in the following examples has been disclosed in patent application No. 202311617947.2, publication No. CN117535330A, and is provided by the Microbial Strain Preservation Room of Zhejiang University of Technology. The genotype of Escherichia coli HSCC4 is (W3110ΔmetJΔmetBΔthrBΔmetAΔtdcC-metL-thrA(trc)ΔmgsAΔrelAΔpykAΔefeU::Ptrc-ptsGΔycjV::Ptrc-ppccgΔyjhE::Ptrc-pyccgΔygaY::Ptrcc-aspBcgΔrpnD::Ptrc-thrAG1279AΔldhA::Ptrc-lysCpa ΔyeeP::metJ-metB-metL-metA ΔycgH::lysAΔgltA::RBSdt-gltA).

[0024] The formulations of the culture medium and antibiotics used in the following examples are as follows: LB medium: 5 g / L Yeast extract, 10 g / L Typeptone, 10 g / L NaCl.

[0025] LB solid medium: 5 g / L Yeast extract, 10 g / L Typeptone, 10 g / L NaCl, 20 g / L Agar powder.

[0026] Antibiotics: working concentration of kanamycin (50 mg / L), spectinomycin (50 mg / L).

[0027] PCR amplification system see Table 1, fusion PCR system see Table 2, colony PCR system see Table 3.

[0028] Table 1 PCR amplification system Ingredients Addition (μL) 2×Phanta Max Buffer 25 dNTP 1 PF / PR Each 1 Super-Fidelity enzyme 1 Formwork 1 ddH2O Add to 50

[0029] Table 2 Fusion PCR system Ingredients Addition (μL) 2×PhantaMax Buffer 25μL dNTP Mix 1μL Primer1 1μL Primer2 1μL PhantaMax 1μL Template1(Target gene) 1μL Template2(Donnor DNA) Each 1μL ddH2O Upto 50μL

[0030] Table 3 Colony PCR system Ingredients Addition (μL) 2×Master Mix 10 PF / PR Each 1 Single colony / ddH2O Add to 20

[0031] DNA purification: Take the PCR amplification product, add 3 times the volume of Buffer PA (less than 100 uL, make up 100 mL), mix well. Transfer the mixed solution to the preparation tube, centrifuge at room temperature 12000 rpm for 1 min, discard the filtrate. Add 700 mL of Buffer W2, centrifuge at room temperature 12000 rpm for 1 min, discard the filtrate, repeat this step once. Room temperature 12000 rpm empty centrifugation 2 min, take out the preparation tube, open the preparation tube cover, room temperature for 2-5 min. Add 40 mL of preheated (50-65℃) ultrapure water, room temperature for 2-5 min, 12000 rpm centrifugation 1 min. The collected liquid is measured by nucleic acid micro-determination instrument, and stored at -20℃ for standby.

[0032] Plasmid extraction: Take 2 mL of 12-14 h overnight culture of bacteria to EP tube (the sampling amount can be adjusted according to the concentration of bacterial cells), centrifuge at room temperature 12000 rpm for 1 min, discard the supernatant, add 250 mL of Buffer S1 to the precipitate to suspend the cells, then add 250 mL of Buffer S2, gently roll 4-6 times to fully lyse the bacterial cells (this step should not exceed 5 min), then add 350 mL of Buffer S3, gently roll 6-8 times, centrifuge at room temperature 12000 rpm for 10 min. Absorb the supernatant into a preparation tube, centrifuge at 12000 rpm for 1 min, discard the filtrate; add 500 ml of Buffer W1, centrifuge at room temperature 12000 rpm for 1 min, discard the filtrate; add 600 ml of Buffer w2, centrifuge at room temperature 12000 rpm for 1 min, discard the filtrate, repeat this step once; room temperature 12000 rpm empty centrifugation 2 min, open the preparation tube cover, room temperature for 2-5 min. Put the preparation tube into a 1.5 mL centrifuge tube, add 40 mL of preheated (50-65℃) ultrapure water, room temperature for 2-5 min, 12000 rpm centrifugation 2 min, use nucleic acid micro-determination instrument to measure the concentration and purity of plasmid, -20℃ storage standby.

[0033] Chemically competent cell preparation The streaked plate was taken, and a single colony was picked and inoculated into 10 mL of LB liquid medium, which was incubated at 37°C, 180 rpm, overnight. Then, the overnight culture was transferred (1% inoculation) into 50 mL of LB liquid medium, which was incubated at 37°C, 180 rpm, until the OD 600 0.4-0.6. The bacterial solution was transferred into a 50 mL sterile centrifuge tube in a clean bench, which was centrifuged at 5500 rpm, 4°C, for 8 min, and the supernatant was discarded in the clean bench. Then, an appropriate amount of pre-cooled sterile CaCl2 solution (0.1 mol / L) was added, and the bacteria on the tube wall were gently blown to suspend them, which were immediately placed in an ice bath for 30 min, and then centrifuged at 5000 rpm, 4°C, for 5 min to collect the bacteria, and the supernatant was discarded in the clean bench. According to the amount of bacteria, an appropriate amount of pre-cooled sterile CaCl2 glycerol solution (0.1 mol / L, 15% glycerol) was added to resuspend the cells, which were aliquoted into 100 μL per tube on ice, and were immediately used or stored at -80°C for later use.

[0034] Example 1: Screening of effective target points by sRNA siRNA with a length of 21-23 nt can trigger RNAi, which can specifically eliminate or close the expression of a specific gene, and has the characteristics of high efficiency, easy synthesis, and easy operation, so this technology has been widely used in gene function exploration and gene therapy. The intermediates in the homoserine synthesis process also participate in other metabolic pathways. In order to further strengthen the homoserine synthesis pathway and find potential gene targets that affect homoserine synthesis, an sRNA plasmid expression library was constructed. The gene targets include 38 genes in sugar decomposition metabolism (pentose phosphate pathway, tricarboxylic acid cycle). Pentose phosphate pathway genes (zwf, gnd, pgl, rpe, rpiA, ripB, talA, talB, tktA, tkeB), tricarboxylic acid cycle genes (sdhA, sdhB, sdhC, sdhD, sucA, sucB, sucC, sucD, lpd, maeA, mqo, fumA, fumB, fumC, fumD, frdA, frdB, frdC, frdD, mdh, icd, acnA, acnB, ybnj, gltA, gltB, gltD, pck).

[0035] Take maeA as an example: With S2-pSEVA431 vector as a template, according to the maeA gene sequence of Escherichia coli W3110 published on NCBI, 24 nt nucleotide sequence starting from ATG was reverse complemented and inserted into S2-pSEVA431 vector, and the primer maeA-F / R was used as a template to perform amplification according to a PCR amplification system. After verification by agarose nucleic acid electrophoresis, the correct DNA fragment was purified to obtain the corresponding DNA target fragment. According to a one-step cloning system reaction, the DNA target fragment was further transformed into DH5α, coated on a spectinomycin (SD) plate, and a single colony was picked and used for colony PCR verification using the S2-pSEVA431 universal primer pSEVA-VF. Sequencing verification was performed to screen a successful clone to construct a pSEVA-maeA mutant vector capable of expressing sRNA of the target gene maeA.

[0036] The primer sequences used in Example 1 are shown in Table 4. Table 4 Primer sequences used in Example 1 Name Primer sequence (5'→3') maeA-F CTGTTTTTTTGTTTTTGGTTCCATTTTCTGTTGGGCCATTGC maeA-R AACCAAAAACAAAAAAACAGACTAGTATTATACCTAGGACTGAGC pSEVA-VF ATTACGTGGCCTGTAGACGT

[0037] Example 2: Construction of strain HBB-2 by metabolic engineering (1) Construction of maeA knockout vector With pTargetF vector as a template, the primer maeA-pT-line-F / R was used. According to the upstream and downstream sequences of the maeA gene of Escherichia coli W3110 published on NCBI, the primers maeA-up-F / R and maeA-down-F / R were used, and the wild-type Escherichia coli strain W3110 genome was used as a template to perform amplification according to a PCR amplification system. After verification by agarose nucleic acid electrophoresis, the correct DNA fragment was purified to obtain the corresponding DNA target fragment. According to a one-step cloning system reaction, the DNA target fragment was further transformed into DH5α, coated on a spectinomycin (SD) plate, and a single colony was picked and used for colony PCR verification using the pTarget universal primer Target-F / R. Sequencing verification was performed to screen a successful clone to construct a pTarget-maeA mutant vector capable of expressing sgRNA of the target gene maeA.

[0038] (2) Knockout of maeA in the genome Knockout of the maeA gene in the genome of the HSY43 strain by the CRISPR-Cas9 system. The strain HSY43 was made into a strain containing the Pcas9 plasmid using the principle of chemical competence, and the pTarget-maeA vector was introduced into the HSY43 strain containing the pcas9 vector by high-voltage electroporation. Then the bacterial liquid was inoculated on a solid LB plate containing SD+Kan resistance and cultured at 30°C overnight for 24h. Single colonies were picked as templates, and colony PCR was performed using the knockout verification primers maeA-VF / R to confirm the knockout of the maeA gene. The strain confirmed by this was cultured in LB medium containing 50mg / L kanamycin and 5mM IPTG at 30°C overnight to remove the pTarget-maeA vector. Then the strain that had removed the pTarget-maeA vector was cultured in LB medium at 42°C overnight to remove the pCas vector. The constructed Escherichia coli strain is denoted as HBB-1.

[0039] The primer sequences used in Example 2 are shown in Table 5: Table 5 Primer sequences used in Example 2 Name Primer sequence (5'→3') maeA-UP-F CTGAAGATGACATTCTCATG maeA-UP-R TCACTACCGGGCGCAGGCGTCACTCACTCTTTTTTGAAT maeA-down-F GCCTGCGCCCGGTAGTGA maeA-down-R GCCGAGTCCAGACCATCT maeA-pT-line-F AGATGGTCTGGACTCGGCCTGCAGAAGCTTAGATCTAT meaA-pT-line-R AGCTCCATGAGAATGTCATCTTCAGTCTAGAGAATTCAAAAAAAGCA maeA-VF AACCAGGACTAATCTTAACA maeA-VR TAAAGACATTCTTCGCGTAT

[0040] Example 3: Construction of strain HBB-2 by metabolic process modification (1) Construction of fumA knockout vector Using the pTargetF vector as a template, primers fumA-pT-line-F / R were used; according to the upper and lower sequences of the fumA gene of Escherichia coli W3110 published on NCBI, primers fumA-up-F / R and fumA-down-F / R were used, and the wild-type Escherichia coli strain W3110 genome was used as a template to amplify according to the PCR amplification system. After verification by agarose nucleic acid electrophoresis, the correct DNA fragments were purified to obtain the corresponding DNA target fragments, which were further transformed into DH5a according to the one-step cloning system reaction, spread on a spectinomycin (SD) plate, and single colonies were picked for colony PCR verification using pTarget universal primers Target-F / R. Sequencing verification was used to screen clones to successfully construct the pTarget-fumA mutant vector capable of expressing sgRNA of the target gene fumA.

[0041] (2) Knockout of fumA in the genome The fumA gene in the genome of the HSY43 strain was knocked out by the CRISPR-Cas9 system. The strain HSY43 was made into a strain containing the Pcas9 plasmid using the principle of chemical competence preparation, and the pTarget-fumA vector was used to high-voltage electroporation into the HSY43 strain containing the pcas9 vector. Then the bacterial liquid was inoculated on the solid LB plate containing SD+Kan resistance, and cultured at 30°C overnight for 24h. Single colonies were picked as templates, and colony PCR verification was performed using knockout verification primers fumA-VF / R to confirm the knockout of the fumA gene. The strain confirmed by this was cultured in LB medium containing 50mg / L kanamycin and 5mM IPTG at 30°C overnight to remove the pTarget-fumA vector. Then the strain which had removed the pTarget-fumA vector was cultured in LB medium at 42°C overnight to remove the pCas vector. The constructed Escherichia coli strain is denoted as HBB-2.

[0042] The primer sequences used in Example 3 are shown in Table 6: Table 6 Primer sequences used in Example 3 Name Primer sequence (5'→3') fumA-UP-F CGGCATTTTCTTTGGCAAAA fumA-UP-R CCCGAAGGGCGGCTCTGTTGTTCTCTCACTTACTGCC fumA-down-F ACAGAGCCGCCCTTCGGG fumA-down-R GAACTTTACGTTCCATCCC fumA-pT-line-F GGGATGGAACGTAAAGTTCCTGCAGAAGCTTAGATCTAT fumA-pT-line-R TTTGCCAAAGAAAATGCCGTCTAGAGAATTCAAAAAAAGCA fumA-VF CTGGAGTAGGGAGACAAT fumA-VR CATCCTGCAAGTGAGTAC

[0043] Experimental Example 4: Construction of strain HBB-3 by metabolic engineering The strain HBB-3 is a strain in which the maeA gene in the genome of the HBB-2 strain is knocked out by the CRISPR-Cas9 system. The strain HBB-2 was made into a strain containing the Pcas9 plasmid using the principle of chemical competence preparation, and the pTarget-maeA vector was used to high-voltage electroporation into the HBB-2 strain containing the pcas9 vector. Then the bacterial liquid was inoculated on the solid LB plate containing SD+Kan resistance, and cultured at 30°C overnight for 24h. Single colonies were picked as templates, and colony PCR verification was performed using knockout verification primers maeA-VF / R to confirm the knockout of the maeA gene. The strain confirmed by this was cultured in LB medium containing 50mg / L kanamycin and 5mM IPTG at 30°C overnight to remove the pTarget-maeA vector. Then the strain which had removed the pTarget-maeA vector was cultured in LB medium at 42°C overnight to remove the pCas vector. The constructed Escherichia coli strain is denoted as HBB-3.

[0044] Experimental Example 5: Construction of strain HBB-4 by metabolic engineering The specific steps for weakening the ilvE gene encoding branched-chain amino acid transaminase are as follows: using the pTargetF vector as a template after dilution, using primer 1 and primer 2, using primer 3 and primer 4 to amplify the upstream homologous sequence of the ilvE gene of Escherichia coli W3110 published on NCBI, and using primer 5 and 6 to amplify the downstream homologous sequence of the ilvE gene according to the same method. The PCR product is purified using a purification kit. The purified upstream and downstream homologous fragments of the weakened ilvE gene and the ilvE gene fragment are subjected to fusion PCR using primer 3 and primer 6 to obtain a knock-in frame. The pTarget-ΔilvE mutant vector capable of expressing the sgRNA of the target ilvE gene is constructed by PCR. The PCR product is transformed into E. coli DH5α competent cells, and the correct sequencing pTarget-ΔilvE vector is obtained by screening with a hydrochloric acid spectinomycin (SD) resistant plate. The pTarget-ΔilvE vector is electroporated into the HBB-2 strain containing the pCas vector, a single colony is picked as a template, and colony PCR verification is performed to confirm the weakening of the ilvE gene.

[0045] The strain HBB-4 is obtained by weakening the ilvE gene of the strain HBB-2 and knocking out the ilvE gene in the genome of the strain HBB-2 by the CRISPR-Cas9 system. The strain HBB-2 is made into a strain containing the pCas9 plasmid by using the principle of chemical competence, and the pTarget-ilvE vector is electroporated into the HBB-2 strain containing the pCas9 vector. Then the bacterial solution is inoculated on a solid LB plate containing SD+Kan resistance, and cultured at 30°C overnight for 24h. A single colony is picked as a template, and colony PCR verification is performed to confirm the knockout of the ilvE gene. The strain confirmed by this is cultured in LB medium containing 50mg / L kanamycin and 5mM IPTG at 30°C overnight to remove the pTarget-ilvE vector. Then the strain in which the pTarget-ilvE vector has been removed is cultured in LB medium at 42°C overnight to remove the pCas vector. The constructed Escherichia coli strain is recorded as HBB-4.

[0046] The primer sequences used in Example 5 are shown in Table 7: Table 7 Primer sequences used in Example 5 Name Primer sequence (5'→3') 1 TAATACTAGTCAATGGGGAGATGGTTCGCTGTTTTAGAGCTAGAAATAGC 2 GCTCTAAAACAGCGAACCATCTCCCCATTGACTAGTATTATACCTAGGAC 3 CTTTTTTTGAATTCTCTAGACAGCGAAACCACCCTTACTG 4 GTTAAACCAAATGTAATCAGCTTTCTTCGTGGTCACTTTTATATTCCTTTTGCGCTCAG 5 CTGATTACATTTGGTTTAACGGAGAAATGGTGAGGTGGGAAGACGCGAAGGTG 6 ATAGATCTAAGCTTCTGCAGGATACCTTCCTGATAACCGTG

[0047] Example 6: Constructing strain HBB-5 by metabolic process modification Strain HBB-5 is a strain of E. coli in which the ilvE gene is attenuated and knocked out of the genome of strain HBB-1 using the CRISPR-Cas9 system. Strain HBB-1 is made into a strain containing the pCas9 plasmid using the principle of chemical competence, and the pTarget-ilvE vector is introduced into the HBB-1 strain containing the pCas9 vector using high-voltage electroporation. Then the bacterial solution is spread on a solid LB plate containing SD+Kan resistance and cultured at 30°C overnight for 24 hours. Single colonies are picked as templates for colony PCR to verify the knockout of the ilvE gene. The strain confirmed by this is cultured in LB medium containing 50 mg / L kanamycin and 5 mM IPTG at 30°C overnight to remove the pTarget-ilvE vector. Then the strain in which the pTarget-ilvE vector has been removed is cultured in LB medium at 42°C overnight to remove the pCas vector. The constructed E. coli strain is designated HBB-5.

[0048] Experimental Example 7: Construction of strain HBB-6 using metabolic engineering Strain HBB-6 is a strain of E. coli in which the ilvE gene is attenuated and knocked out of the genome of strain HBB-3 using the CRISPR-Cas9 system. Strain HBB-3 is made into a strain containing the pCas9 plasmid using the principle of chemical competence, and the pTarget-ΔilvE vector is introduced into the HBB-3 strain containing the pCas9 vector using high-voltage electroporation. Then the bacterial solution is spread on a solid LB plate containing SD+Kan resistance and cultured at 30°C overnight for 24 hours. Single colonies are picked as templates for colony PCR to verify the knockout of the ilvE gene. The strain confirmed by this is cultured in LB medium containing 50 mg / L kanamycin and 5 mM IPTG at 30°C overnight to remove the pTarget-ΔilvE vector. Then the strain in which the pTarget-ΔilvE vector has been removed is cultured in LB medium at 42°C overnight to remove the pCas vector. The constructed E. coli strain is designated HBB-6.

[0049] Shake flask fermentation experiment HSCC4 strain, HBB-1 strain prepared in the examples, HBB-2 strain, HBB-3 strain, HBB-4 strain, HBB-5 strain and HBB-6 strain were subjected to fermentation test in a shake flask to compare the ability of each genotype strain to produce L-homoserine. The shake flask fermentation experiment was carried out according to the following scheme: each strain was streaked on LB plates and cultured overnight in a 37°C incubator, and single colonies were picked and inoculated into 5 ml of LB medium, and cultured overnight at 200 rpm in a 37°C incubator to obtain seed liquid. 20 ml of fermentation medium was added to 5 500 ml shake flasks, and 400 μL of seed liquid of different strains was inoculated into the fermentation medium. The final concentration of the fermentation medium was: 40 g / L glucose, 17 g / L (NH4)2SO4, 4 g / L yeast extract, 1 g / L KH2PO4, 1 g / L MgSO4, 0.005 g / L FeSO4·7H2O, 0.005 g / L MnSO4·7H2O, 0.005 g / L ZnSO4, 25 g / L CaCO3, 115°C sterilization for 30 minutes, wherein CaCO3 needs to be sterilized separately. Incubate at 200 rpm in a 30°C incubator for 48 hours, take a certain amount of fermentation broth from the shake flask, dilute with ultrapure water by 100 times, filter with a membrane, and then detect the content of L-homoserine in the fermentation broth by amino acid analyzer, and finally compare the amount of L-homoserine obtained by different genotype strains. The results of shake flask fermentation experiment of the metabolically engineered strains are shown in Table 8.

[0050] Table 8: Homoserine yield of each genotype strain in shake flask fermentation Strain Genotype L-homoserine production g / L HSCC4 W3110ΔmetJΔmetBΔthrBΔmetAΔtdcC-metL-thrA(trc)ΔmgsAΔrelAΔpykAΔefeU::Ptrc- ptsGΔycjV::Ptrc-ppccgΔyjhE::Ptrc-pyccgΔygaY::Ptrcc-aspBcgΔrpnD::Ptrc-thrAG1279AΔldhA:: Ptrc-lysCpaΔyeeP::metJ-metB-metL-metAΔycgH::lysAΔgltA::RBSdt-gltA 18.83 HBB-1 HSCC4ΔmaeA 19.73 HBB-2 HSCC4ΔfumA 19.20 HBB-3 HSCC4ΔfumAΔmaeA 18.84 HBB-4 HSCC4ΔfumAΔilvE 19.14 HBB-5 HSCC4ΔmaeAΔilvE 20.25 HBB-6 HSCC4ΔfumAΔmaeAΔilvE 19.85

[0051] According to Table 8, the HBB-5 strain after metabolic modification does not need to carry exogenous plasmid and has the ability to produce and accumulate L-homoserine outside the cell, which can better utilize carbon source materials such as glucose to produce L-homoserine compared with the wild type strain. The strain with the best performance after modification can improve the level of L-homoserine production from 18.83 g / L to 20.25 g / L compared with the starting strain HSCC4 strain. Other strains after modification have different degrees of improvement in the level of L-homoserine production compared with the original strain.

[0052] 5L fermentation test of engineered strains The optimal strain HBB-5 selected in the shake flask test was used for high homoserine production performance test in a 5L fermenter. The strain was streaked on LB plates and incubated in a 37°C incubator overnight. A single colony was picked and inoculated into 10ml of LB medium and incubated at 37°C for 8h. Then 1ml of the test tube culture was inoculated into a 500ml flask containing 100ml of seed (LB liquid) medium and incubated in a 37°C incubator at a speed of 200rpm for 8-10h. 200ml of the seed culture was inoculated into a 5L fermenter (BIOTECH-5JG) containing 1.5L of fermentation medium, and the feed medium was added by fed-batch method, and the fermentation period was 50-100h. The glucose concentration was controlled at 1-5g / L during the fermentation process by feeding. The DO level was controlled at about 20% during the fermentation process by stirring coupled with DO mode, the stirring speed was controlled at 300-600rpm, the aeration rate was controlled at 1-2vvm, and the culture temperature was controlled at 30°C during the fermentation process, and the pH was adjusted to the range of 6.8±0.2 with 50% ammonia water. The fermentation medium composition is: 22g / L Glucose (glucose), 8g / L Yeast extract (yeast extract), 12g / L Typeptone (peptone), 4.02g / L K3PO4 (potassium phosphate), 3g / L NaCl, 2.2g / L citric acid monohydrate, 2.5g / L (NH4)2SO4, 0.5g / L MgSO4·7H2O (magnesium sulfate heptahydrate), 0.3g / L ammonium ferric citrate, 1g / L betaine, 0.7g / L threonine. Defoamer (1 mL / L), 115°C sterilization for 30 min. The solvent is deionized water, and the pH value is 6.8; the specific configuration of the feed medium is: weigh 700 g Glucose (glucose) into the feed bottle, add 300 mL tap water; weigh 16 g KH2PO4 (potassium dihydrogen phosphate) into a 500 mL flask, add 100 mL water; weigh 14 g (NH4)2SO4 (ammonium sulfate) and 1 g betaine into a 500 mL flask, add 70 mL water; weigh 4 g threonine into a 500 mL flask, add 50 mL water, sterilize at 115°C for 30 min. Mix the KH2PO4 solution, (NH4)2SO4 solution, and threonine solution in the flask into a 1L feed bottle in a clean bench.

[0053] The fermentation curve during the fermentation process is shown in Figure 1 As can be seen from the figure, the yield of homoserine is 120.16g / L after 72h, the sugar acid conversion rate is 0.71g / g, and the space-time yield is 1.668g / L / h, which fully proves that the genetically engineered strain for high-yield L-homoserine of the application has great industrial application value.

[0054] Finally, it should be noted that the above experiments and examples are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions recorded in the foregoing examples can still be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A genetically engineered bacterium that produces high levels of L-homoserine, characterized in that: The genetically engineered bacteria were obtained by performing a series of metabolic engineering modifications on Escherichia coli HSCC4 as the starting strain. The metabolic engineering modification of the starting strain includes any one or more of the following methods: (1) Reduce the pathway by which malic acid is consumed to generate pyruvate; (2) Restricting carbon flow into the complete TCA cycle for oxidative decomposition forces carbon metabolism to rely more on the replenishment pathway to generate oxaloacetate; (3) Reduce the competitive pathways for carbon and nitrogen to flow to the synthesis of branched amino acids.

2. The genetically engineered bacterium producing high levels of L-homoserine according to claim 1, characterized in that: In method (1), the pathway by which malic acid is consumed to generate pyruvate is reduced by knocking out the malate dehydrogenase encoding gene maeA.

3. The genetically engineered bacterium producing high levels of L-homoserine according to claim 1, characterized in that: In method (2), the carbon flow is restricted from entering the complete TCA cycle for oxidative decomposition by knocking out the fumarate enzyme encoding gene fumA.

4. The genetically engineered bacterium producing high levels of L-homoserine according to claim 1, characterized in that: In method (3), the expression of the gene ilvE encoding branched-chain amino acid transaminase is weakened, thereby reducing the competitive pathway for carbon and nitrogen to flow to the synthesis of branched-chain amino acids.

5. The genetically engineered bacterium producing high levels of L-homoserine according to claim 4, characterized in that: In method (3), the expression of gene ilvE is weakened by changing the start codon.

6. The genetically engineered bacterium producing high levels of L-homoserine according to claim 5, characterized in that: In method (3), the expression of ilvE is weakened by changing the start codon ATG to GTG.

7. The application of a genetically engineered bacterium that produces high levels of L-homoserine as described in any one of claims 1-6 in the microbial fermentation production of L-homoserine.

8. A method for producing L-homoserine, characterized in that, The process includes the following steps: inoculating the genetically engineered bacteria that produce high levels of L-homoserine as described in any one of claims 1-3 into a fermentation medium, fermenting at 25-35°C and 180-220 rpm, and separating and purifying the culture medium after the culture is completed to obtain L-homoserine.

9. A method for producing L-homoserine according to claim 8, characterized in that: The fermentation medium consisted of: 40 g / L glucose, 17 g / L (NH4)2SO4, 4 g / L yeast extract, 1 g / L KH2PO4, 1 g / L MgSO4, 0.005 g / L FeSO4·7H2O, 0.005 g / L MnSO4·7H2O, 0.005 g / L ZnSO4, and 25 g / L CaCO3.

10. A method for producing L-homoserine according to claim 8, characterized in that: The CaCO3 in the fermentation medium was sterilized separately.

Images