Nano-enzyme coating recombinant probiotics as well as preparation method and application thereof
By using genetic engineering and nanozyme coating technology, the ROS clearance capacity and gastrointestinal survival rate of Escherichia coli Nissle 1917 were enhanced, solving the problems of insufficient ROS tolerance and targeting of probiotics in the gastrointestinal tract, and achieving effective treatment for ulcerative colitis.
Patent Information
- Application Number
- CN202511897621.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-03-03
AI Technical Summary
In existing technologies, probiotics such as Escherichia coli Nissle 1917 have low tolerance to reactive oxygen species (ROS), and nanozymes have insufficient targeting in the gastrointestinal tract, resulting in limited efficacy in treating oxidative stress-related intestinal diseases such as ulcerative colitis.
By genetically engineering Escherichia coli Nissle 1917 to overexpress glutathione peroxidase and glutathione reductase, and electrostatically modifying its surface with chitosan and cerium dioxide nanoenzyme coatings, a nanoenzyme-coated recombinant probiotic was formed, which improved its survival rate and ROS scavenging ability in the gastrointestinal environment.
It significantly improves the survival rate of probiotics in the gastric acid and bile salt environment, enhances the ability to clear ROS, effectively relieves the symptoms of ulcerative colitis, improves intestinal colonization and therapeutic effect, and has high targeting and safety.
Smart Images

Figure CN121592569A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and nanomedicine, specifically relating to a nanoenzyme-coated recombinant probiotic, its preparation method, and its application. Background Technology
[0002] Ulcerative colitis (UC) is a chronic inflammatory bowel disease with a rising global incidence. Its pathological features include excessive accumulation of reactive oxygen species (ROS) in the gut, epithelial barrier damage, and microbiome dysbiosis. Current clinical treatments mainly rely on aminosalicylic acid drugs, corticosteroids, and immunosuppressants, but these methods have limitations such as high relapse rates, strong hepatotoxicity, and high costs. Probiotic therapy has attracted attention due to its good safety profile and intestinal colonization ability. Escherichia coli Nissle 1917 (ECN) is one of the most widely studied probiotics, possessing anti-inflammatory and intestinal barrier repair effects. However, natural ECN has low tolerance to ROS, poor survival rate in the acidic and bile salt environment of the stomach, and lacks a highly efficient ROS-clearing enzyme system, limiting its efficacy. On the other hand, nanozymes (such as cerium dioxide) have antioxidant enzyme-mimicking activity and can degrade various ROS, but they are easily degraded by the gastrointestinal tract after oral administration, resulting in insufficient targeting. In existing technologies, neither simply genetically engineering probiotics nor using nanozymes can simultaneously achieve efficient ROS clearance and intestinal-targeted delivery. For example, overexpression of a single antioxidant enzyme (such as GPX) leads to glutathione (GSH) depletion, while nanozymes lack biocompatibility when used alone.
[0003] Therefore, it is urgent to develop a nanoenzyme-coated recombinant probiotic that can synergistically enhance probiotic tolerance and therapeutic effects. Summary of the Invention
[0004] Therefore, the purpose of this invention is to provide a nanoenzyme-coated recombinant probiotic, its preparation method, and its application. By using genetic engineering and nanocoating technology, the survival rate and colonization ability of engineered bacteria in the harsh environment of the gastrointestinal tract are improved, the engineered bacteria are endowed with efficient and sustainable ROS clearance function, its therapeutic efficacy is verified in disease models such as UC, and its clinical application is promoted.
[0005] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a nanoenzyme-coated recombinant probiotic, wherein the core engineered bacterium is an engineered Escherichia coli Nissle 1917 whose genome integrates the T7 RNA polymerase gene, the core engineered bacterium overexpresses exogenous glutathione peroxidase gene and glutathione reductase gene, and the surface of the core engineered bacterium is modified with a chitosan and cerium dioxide nanoenzyme composite coating by electrostatic layer-by-layer self-assembly, wherein the mass ratio of chitosan to cerium dioxide nanoenzyme is 1:1 to 1:2, and the ratio of the total mass of the coating to the mass of the core engineered bacterium is 1:1 to 4:1.
[0006] Among them, the core engineered bacteria is the engineered Escherichia coli Nissle 1917 strain ECN(DE3), which integrates the T7 RNA polymerase gene into its genome. It was commercially purchased from Hangzhou Hongsai Biotechnology Co., Ltd.
[0007] Among them, exogenous glutathione peroxidase is abbreviated as GPX, glutathione reductase is abbreviated as GR, and cerium dioxide nanozyme is abbreviated as CNP.
[0008] Based on the above technical solution, the cerium dioxide nanozyme has a particle size of 100–300 nm and has catalytic activity that mimics catalase and superoxide dismutase.
[0009] Based on the above technical solution, the coding sequence of the exogenous glutathione peroxidase gene is shown in SEQ ID NO:1, and the coding sequence of the glutathione reductase gene is shown in SEQ ID NO:2; the exogenous glutathione peroxidase gene and the glutathione reductase gene are regulated by the T7 promoter and can be expressed by IPTG induction.
[0010] Based on the above technical solution, further, the particle size and zeta potential are kept stable by storing the material at 25°C for 6 days.
[0011] Secondly, the present invention provides a method for preparing the above-mentioned nanoenzyme-coated recombinant probiotic, comprising the following steps: S1: The exogenous glutathione peroxidase gene and glutathione reductase gene were cloned into the expression vector, and the expression vector was transformed into the engineered Escherichia coli Nissle 1917 with the T7 RNA polymerase gene integrated. Expression was induced and enzyme activity was verified to obtain the core engineered strain @GPX-GR. S2: Cerium dioxide nanozymes were synthesized via a hydrothermal method, and their catalytic activity and biocompatibility were characterized. S3: The core engineered bacteria @GPX-GR were co-incubated with chitosan solution, washed, and then incubated a second time with cerium dioxide nanozyme solution to obtain nanozyme-coated recombinant probiotics.
[0012] The study used *Escherichia coli* Nissle 1917-derived strain ECN(DE3) as the host. This strain integrates T7 RNA polymerase into its chromosome, enabling efficient and precise expression of exogenous genes. The expression vector was pETduet, where GPX catalyzes the reduction of peroxides by GSH, and GR regenerates GSH, forming a synergistic antioxidant cycle.
[0013] The process employs electrostatic layer-by-layer self-assembly technology, first adsorbing positively charged chitosan onto the bacterial cell surface (neutralizing the negative charge of the bacterial cell), and then adsorbing negatively charged cerium dioxide nanozyme (CNP) to form a stable double-layer coating. The CNP is synthesized via a hydrothermal method and exhibits catalase and superoxide dismutase mimicry activities.
[0014] Based on the above technical solution, the conditions for inducing expression in S1 are as follows: 1 mM IPTG is added to LB medium, and expression is induced at 37°C for 12 hours.
[0015] Where mM refers to mmol / L.
[0016] Thirdly, the present invention provides the application of the above-mentioned nanoenzyme-coated recombinant probiotic in the preparation of drugs for the prevention or treatment of oxidative stress-related intestinal diseases.
[0017] Based on the above technical solution, the oxidative stress-related intestinal diseases further include ulcerative colitis or intestinal barrier dysfunction.
[0018] Fourthly, the present invention provides a pharmaceutical composition for the prevention or treatment of oxidative stress-related intestinal diseases, characterized in that it comprises a nanoenzyme-coated recombinant probiotic as described above and a pharmaceutically acceptable carrier.
[0019] Fifthly, the present invention provides a method for evaluating the efficacy of the above-mentioned pharmaceutical composition for the prevention or treatment of oxidative stress-related intestinal diseases, using a DSS-induced ulcerative colitis animal model, and evaluating the efficacy by monitoring body weight, disease activity index, colon length, histological indicators and ZO-1 protein expression level.
[0020] The efficacy of nanozyme-coated recombinant probiotics was evaluated through in vitro ROS clearance experiments and in vivo UC models, including tolerability, colonization ability, and inflammatory remission indicators.
[0021] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention utilizes genetically engineered probiotics combined with nanozyme coating technology to treat oxidative stress-related intestinal diseases such as ulcerative colitis (UC), addressing the problems of significant side effects and poor targeting in existing treatments. Specifically, using engineered Escherichia coli Nissle 1917 (ECN(DE3)) as the host, a highly efficient antioxidant enzyme system is constructed by overexpressing glutathione peroxidase (GPX) and glutathione reductase (GR) genes through genetic engineering. Furthermore, using electrostatic layer-by-layer self-assembly technology, chitosan and cerium dioxide nanozymes (CNPs) are sequentially modified onto the bacterial surface to form a protective coating. The nanozyme coating significantly improves the survival rate of recombinant probiotics in harsh environments such as simulated gastric acid (pH 2.5) and bile salts (0.3%), and enhances their ability to scavenge reactive oxygen species (ROS), including hydrogen peroxide, superoxide anions, hydroxyl radicals, and DPPH radicals.
[0022] 2. Animal experiments of this invention demonstrate that this system can effectively alleviate inflammation, repair intestinal barrier function, and reduce the disease activity index (DAI) in a DSS-induced ulcerative colitis (UC) mouse model. This invention can be used to prepare oral drugs with advantages such as strong targeting, high safety, and long-lasting efficacy.
[0023] 3. This invention significantly improves gastrointestinal tolerance. The chitosan / CNP coating increases the survival rate of engineered bacteria by >50% in simulated gastric acid (pH 2.5) and by >40% in 0.3% bile salts, far exceeding that of uncoated strains. 4. This invention synergistically enhances ROS scavenging efficiency. The nanoenzyme-coated recombinant probiotics maintain effective DPPH free radical scavenging for 60 minutes, achieve a 90% degradation rate of H2O2 within 30 minutes, and effectively scaveng hydroxyl radicals (OH-). - ) and superoxide anion (O2) - The scavenging activity reached 13.5 U / OD. 600 and 470.5 U / OD 600 It is 3-5 times higher than that of a single component.
[0024] 5. The present invention shows through mouse experiments that the colonization of coated bacteria in the duodenum, cecum and colon is increased by 2-3 times, and can significantly repair the expression of tight junction protein ZO-1 and reduce the disease activity index (DAI) in UC model.
[0025] 6. The CNP of this invention exhibits good biocompatibility and does not affect bacterial growth. After 6 days of storage at room temperature, the coated bacteria show no significant changes in zeta potential and particle size, making it suitable for industrial production. Attached Figure Description
[0026] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.
[0027] Figure 1 This is a diagram showing the Western blot verification results of GPX and GR proteins in Example 1 of the present invention; Figure 2 This is a CNP transmission electron microscope (TEM) image of Embodiment 2 of the present invention; Figure 3 Figure A shows the results of the nanozyme cell activity assay in Example 2 of this invention; Figure B shows the results of the cytotoxicity assay, Figure C shows the results of the reactive oxygen species (ROS) level assay, Figure D shows the results of the cytokine TNF-α level assay, and Figure D shows the results of the cytokine IL-6 level assay. Figure 4 This is a graph showing the change in Zeta potential and particle size distribution on the surface of the recombinant engineered bacteria with nanoenzyme coating in Example 3 of the present invention. Figure 5 This is a scanning electron microscope (SEM) image of the nanozyme-coated recombinant engineered bacteria of Example 3 of the present invention; Figure 6 This is a graph showing the storage stability results of the nanoenzyme-coated recombinant engineered bacteria in Example 3 of the present invention; Figure 7 The following are the results of the tolerance of the nanozyme-coated recombinant engineered bacteria in Example 4 of the present invention: A is the survival rate in simulated gastric acid, B is the survival rate in bile salt solution, C is the result of live bacteria staining verification, D is the result of fluorescence distribution in mice, E is the result of quantitative fluorescence, and F is the result of intestinal colony counting. Figure 8 The following graphs show the ROS scavenging activity results of the nanozyme-coated recombinant engineered bacteria in Example 5 of this invention: A represents the ROS scavenging activity, H represents the DPPH free radical scavenging activity, B represents the H2O2 degradation activity, and C represents the OH radical degradation activity. - The result of the cleaning process is shown in the image, where D represents O2. - Image showing the results of the cleanup; Figure 9 The following figures illustrate the therapeutic effects of the nanozyme-coated recombinant engineered bacteria of Example 6 of this invention on ulcerative colitis: A is the experimental design flowchart, B is the mouse weight change result, C is the disease activity index (DAI) score result, D is the colon length comparison result, E is the colon length statistics result, F is the colon tissue H&E staining result, G is the histological damage score result, and H is the ZO-1 immunofluorescence staining result. Detailed Implementation
[0028] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.
[0029] Unless otherwise specified, all materials mentioned in the embodiments are commercially available.
[0030] Example 1 Construction and validation of engineered bacteria ECN(DE3)@GPX-GR Gene cloning: The GPX gene (SEQ ID NO:1) and GR gene (SEQ ID NO:2) were ligated into the pETduet vector using restriction endonuclease to construct the recombinant plasmid pETduet-GPX-GR.
[0031] Transformation and induction: The recombinant plasmid was transformed into ECN(DE3) strain by heat shock and cultured in LB medium (containing 50 μg / mL kanamycin) until OD600=0.6, and then 1 mM IPTG was added for induction for 12 hours.
[0032] Protein validation: SDS-PAGE and Western blot analysis were used. GPX-6His fusion protein (approximately 14 kDa) was detected using anti-6-His antibody, and GR-S-Tag fusion protein (approximately 54 kDa) was detected using anti-S-Tag antibody. Figure 1 As shown, protein expression was successfully confirmed.
[0033] Example 2 Preparation and characterization of cerium dioxide nanozymes (CNPs).
[0034] Synthesis method: 0.1 M CeCl3 solution was mixed with 0.1 M sodium hydroxide and placed in a high-pressure reactor to react at 180°C for 12 hours. After centrifugation and washing, CNP powder was obtained.
[0035] Characterization results: such as Figure 2 As shown, transmission electron microscopy (TEM) revealed that CNPs exhibit a regular nanoparticle morphology with a particle size distribution of 100-300 nm. Enzyme activity assays confirmed that they possess catalase and superoxide dismutase-mimicking activities. Figure 3 As shown, CNP at a concentration of 100 μg / mL was non-toxic to RAW264.7 cells and could inhibit the release of inflammatory factors.
[0036] Example 3 Preparation and optimization of nanozyme-coated recombinant probiotics.
[0037] Coating process: The induced engineered bacteria were resuspended in 0.5 M NaCl solution (pH 6.0) and the cell concentration was adjusted to 1×10⁻⁶. 9CFU / mL. Add 2 mg / mL chitosan solution (chitosan to cell mass ratio 1:1), incubate at 25°C for 1 hour, and centrifuge and wash. Then add 2 mg / mL CNP solution (chitosan to CNP mass ratio 1:1) and incubate under the same conditions for 1 hour.
[0038] Quality control: such as Figure 4 As shown, Zeta potential analysis revealed a potential of -16.8 mV for the uncoated bacteria, which increased to +5.8 mV after the addition of chitosan, and recovered to -20.9 mV after the addition of CNP. The particle size increased from 931.8 nm to 1563.6 nm, confirming the successful coating. Figure 5 As shown, scanning electron microscopy (SEM) reveals a uniform granular layer covering the bacterial cell surface. Figure 6 As shown, the coated bacteria were stored at 25°C for 6 days to maintain stable zeta potential and particle size.
[0039] Example 4 Gastrointestinal tolerance assessment.
[0040] Experimental design: Coated engineered bacteria and uncoated engineered bacteria were placed in simulated gastric juice (SGF, pH 2.5) and 0.3% bile salt solution, respectively, and incubated at 37°C with shaking for 0, 1 and 2 hours.
[0041] The tolerance results of nanozyme-coated recombinant engineered bacteria are as follows: Figure 7 As shown: Results analysis: Plate counts showed that the survival rate of coated bacteria increased from 20% to 75% in gastric acid and from 30% to 70% in bile salts; live bacteria staining showed that most coated bacteria maintained membrane integrity, while uncoated bacteria showed a large amount of red fluorescence (dead bacteria).
[0042] Example 5 In vivo colonization and ROS clearance experiments.
[0043] Animal model: C57BL / 6 mice were used, and administered orally 1×10 8 CFU ECN(DE3)@RFP@CNP or PBS.
[0044] Results of ROS scavenging activity of nanozyme-coated recombinant engineered bacteria as follows: Figure 8 As shown: Colonization analysis: Four hours later, in vivo imaging showed a 3-fold increase in the fluorescence signal intensity in the abdomen of the coated group. Colony counting of intestinal contents confirmed that the colonization of coated bacteria in the duodenum, cecum, and colon was 2.5 times, 3.0 times, and 2.8 times that of the uncoated group, respectively.
[0045] ROS scavenging: In vitro experiments showed that the nanozyme-coated recombinant probiotics degraded 64% of 300 mM H2O2 within 30 minutes, and also exhibited significant ROS scavenging activity. - The scavenging rate is as high as 470.5 U / OD600, which is significantly better than that of a single component.
[0046] Example 6 Experimental treatment of ulcerative colitis.
[0047] Model establishment: UC model was induced in mice by drinking 3% DSS solution for 6 days, followed by grouped treatment with oral administration of 1×10⁻⁶ mg / L daily. 8 CFU / g, for 7 consecutive days.
[0048] therapeutic indicators such as Figure 9 As shown: Weight loss: The weight loss in the nanoenzyme-coated recombinant probiotic group was only 5%, significantly lower than that in the model group (15.3%). DAI score: The score of the nanozyme-coated recombinant probiotic group decreased from 3.5 to 1.0, which is close to that of the normal group; Colon length: The colon length of the nanozyme-coated recombinant probiotic group recovered to 8.5 cm, which was significantly improved compared with the model group (6.0 cm); Histological analysis: H&E staining showed that the nanozyme-coated recombinant probiotic group had reduced inflammatory cell infiltration, increased ZO-1 immunofluorescence intensity by 80%, and had the lowest histological damage score.
[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
[0050] SEQ ID NO:1 ATGGTTTCACAAGAAACAATAGAGCACGTAAAGAAACTGATTGCGCAGAAAGAAGTTTTCGTGGCCAGCAAAACCTACTGCCCGTATTGTCATGCAGCTTTAAACACCCTGTTTGGCAAGCTGAAAGTCCCAAAATCCAAGGCGTTGGTTCTGCAACTGAACGAAATGGATGATGGTGCGGAAATCCAGGCAGCGTTGTACGAGATCAACGGTCAGCGTACCGTGCCGAATATTTATATCAACGGCAAGCACATCGGCGGTAACGACGACCTCCAAGAGCTGTTGGAGACGGGTGAACTGGAGGACCTGCTTGAGCCGATTCTGGCTAAT SEQ ID NO:2
Claims
1. A nanoenzyme-coated recombinant probiotic, characterized in that, The core engineered bacterium is an engineered Escherichia coli Nissle 1917 whose genome integrates the T7 RNA polymerase gene. The core engineered bacterium overexpresses exogenous glutathione peroxidase and glutathione reductase genes. The surface of the core engineered bacterium is modified with a chitosan and cerium dioxide nanozyme composite coating through electrostatic layer-by-layer self-assembly. The mass ratio of chitosan to cerium dioxide nanozyme is 1:1 to 1:2, and the ratio of the total mass of the coating to the mass of the core engineered bacterium is 1:1 to 4:
1.
2. The nanoenzyme-coated recombinant probiotic according to claim 1, characterized in that, The cerium dioxide nanozyme has a particle size of 100–300 nm and exhibits catalytic activity that mimics catalase and superoxide dismutase.
3. The nanoenzyme-coated recombinant probiotic according to claim 1, characterized in that, The coding sequence of the exogenous glutathione peroxidase gene is shown in SEQ ID NO:1, and the coding sequence of the glutathione reductase gene is shown in SEQ ID NO:2; the exogenous glutathione peroxidase gene and the glutathione reductase gene are regulated by the T7 promoter and can be induced by IPTG.
4. The nanoenzyme-coated recombinant probiotic according to claim 1, characterized in that, Stored at 25°C for 6 days, the particle size and zeta potential remained stable.
5. The method for preparing nanoenzyme-coated recombinant probiotics according to any one of claims 1 to 3, characterized in that, Includes the following steps: S1: The exogenous glutathione peroxidase gene and glutathione reductase gene were cloned into the expression vector, and the expression vector was transformed into the engineered Escherichia coli Nissle 1917 with the T7 RNA polymerase gene integrated. Expression was induced and enzyme activity was verified to obtain the core engineered strain @GPX-GR. S2: Cerium dioxide nanozymes were synthesized via a hydrothermal method, and their catalytic activity and biocompatibility were characterized. S3: The core engineered bacteria @GPX-GR were co-incubated with chitosan solution, washed, and then incubated a second time with cerium dioxide nanozyme solution to obtain nanozyme-coated recombinant probiotics.
6. The preparation method according to claim 4, characterized in that, The conditions for inducing expression in S1 are as follows: 1 mM IPTG is added to LB medium, and expression is induced at 37°C for 12 hours.
7. The use of a nanozyme-coated recombinant probiotic as described in any one of claims 1 to 3 in the preparation of a medicament for the prevention or treatment of oxidative stress-related intestinal diseases.
8. The application according to claim 6, characterized in that, The oxidative stress-related intestinal diseases include ulcerative colitis or intestinal barrier dysfunction.
9. A pharmaceutical composition for the prevention or treatment of oxidative stress-related intestinal diseases, characterized in that, It comprises a nanoenzyme-coated recombinant probiotic as described in any one of claims 1 to 3 and a pharmaceutically acceptable carrier.
10. The method for evaluating the efficacy of a pharmaceutical composition for the prevention or treatment of oxidative stress-related intestinal diseases as described in claim 8, characterized in that, Using a DSS-induced ulcerative colitis animal model, the disease was assessed by monitoring body weight, disease activity index, colon length, histological parameters, and ZO-1 protein expression levels.
Citation Information
Cited By
Engineering probiotics of intracellular chimeric nano-enzyme as well as preparation and application of engineering probiotics
CN122097615A