AsCas12f segmented expression mediated gene editing method

Abstract

The invention provides an AsCas12f gene segmentation expression mediated gene editing method. The AsCas12f gene segmentation expression mediated gene editing method is provided. The key point is that the AsCas12f gene is divided into two parts, the two parts are respectively cloned to expression vectors, and gene editing is realized after the two vectors are co-expressed. Preferably, the front half part of the AsCas12f comprises REC, WED and Linker sequences, the rear half part of the AsCas12f comprises Linker, RuvC and TNB sequences, a gRNA sequence and a target gene sequence, the two parts contain Linker overlapping sequences, a 5'end sequence of intein is added to the 3'end of the front half part, a 3 'end sequence of the intein is added to the 5' end of the rear half part, the two parts are expressed by utilizing plant virus vectors TRV (tobacco brittle virus) and PVX (potato virus X) respectively, and the AsCas12f is expressed by utilizing plant virus vectors. And gene editing of the target gene is realized.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to an AsCas12f gene segment expression mediated gene editing method and application thereof. BACKGROUND

[0002] The CRISPR / Cas gene editing technology has great application value in the fields of biological medicine, biological breeding and the like. At present, the most commonly used Cas protein for CRISPR / Cas gene editing is Cas9, but the gene thereof is large (about 4.2 kb), and it is difficult to use a viral vector for gene delivery. AsCas12f is a small Cas protein, only 422 amino acids, which greatly improves the feasibility of using a viral vector for gene delivery. Although AsCas12f is less than 1 / 3 of the size of Cas9, the AsCas12f gene plus a nuclear localization signal, and a gRNA sequence, exceeds 1.4 kb, still exceeding the range of many viral vectors for stable expression of exogenous genes. To solve this problem, the application segments the expression of the AsCas12f gene, further reduces the length of the exogenous gene expressed by the viral vector, so that the length of each part of the AsCas12f gene does not exceed 700 bp. After co-expression of the two parts, a functional AsCas12f is formed, and the gene editing effect on the target gene is achieved. SUMMARY

[0003] In view of the problems in the prior art, the application provides an AsCas12f gene segment expression gene editing vector, a gene editing method and application thereof. The AsCas12f gene segment expression method is that the first half part is a 645 bp sequence including REC, WED and Linker, the second half part is a 639 bp sequence including Linker, RuvC and TNB, and a gRNA sequence and a target gene sequence, the two parts contain an overlapping sequence of Linker, and the 3' end of the first half part is added with a 5' end sequence of an Intein, and the 5' end of the second half part is added with a 3' end sequence of the Intein. The two parts are expressed by using plant viral vectors TRV (tobacco rattle virus) and PVX (potato virus X), and a functional AsCas12f is formed after co-expression in plant leaves, so that gene editing on a target gene is achieved.

[0004] Specifically, the first aspect of the present application provides a gene editing vector for segment expression of AsCas12f gene, characterized in that the gene editing vector is a plant virus vector, and the gene editing vector utilizes the plant virus to segment express a gene editing element nCas12f-InteinN expression frame and an InteinC-cCas12f-Linker expression frame, to form a gene editing vector independently expressed respectively containing the nCas12f-InteinN expression frame structure and the InteinC-cCas12f-Linker expression frame.

[0005] In a preferred embodiment of the present application, the sequence of the nCas12f-InteinN expression frame is shown as SEQ ID NO. 1, and the sequence of the nCas12f-InteinN expression frame is shown as SEQ ID NO. 2, wherein N is an editing site sequence of a target gene, and the base number of N ranges from 15 to 25.

[0006] In a preferred embodiment of the present application, the vector is obtained by the following steps: The nCas12f-InteinN expression frame and the InteinC-cCas12f-Linker expression frame are respectively cloned into the multiple cloning sites of the plant virus vector.

[0007] Preferably, the molar ratio of the pNC-TRV2-OE vector to the nCas12f-InteinN expression frame or the InteinC-cCas12f-Linker expression frame in the cloning reaction system is 1:3 to 1:1.

[0008] Preferably, in the cloning reaction system, the pNC-TRV2-OE vector is 60 ng, the nCas12f-InteinN expression frame or the InteinC-cCas12f-Linker expression frame is 30-50 ng, the Nimble Mix reaction solution is 5 ul, the total system is 10 ul, and the reaction condition is 50℃ for 30 minutes.

[0009] Alternatively, the cloning reaction system can be proportionally enlarged or reduced according to the foregoing reaction system.

[0010] In another preferred embodiment, the nCas12f-InteinN expression frame and the InteinC-cCas12f-Linker expression frame are respectively cloned into the multiple cloning sites of the PVX plant virus vector.

[0011] In a preferred embodiment of the present application, the vector comprises a vector with the nucleotide sequences shown in SEQ ID NO. 22 and SEQ ID NO. 23, wherein N is an editing site sequence of a target gene, and the number of bases of N ranges from 15 to 25.

[0012] In another preferred embodiment of the present application, the gene editing vector for segmental expression of the AsCas12f gene comprises a vector with the nucleotide sequences shown in SEQ ID NO. 24 and SEQ ID NO. 25, wherein N is an editing site sequence of a target gene, and the number of bases of N ranges from 15 to 25.

[0013] Another aspect of the present application provides a method for constructing a plant virus gene editing vector, characterized in that the method is to clone the gene editing elements AsCas12f and its gRNA segmentally into the multiple cloning sites of the plant virus vector, to utilize the plant virus segmental expression of the gene editing elements AsCas12f and its gRNA, to form a gene editing vector comprising an independently expressed nCas12f-InteinN expression frame structure and an independently expressed InteinC-cCas12f-Linker expression frame, respectively.

[0014] Preferably, the sequence of the nCas12f-InteinN expression frame is shown in SEQ ID NO. 1, and the sequence of the InteinC-cCas12f-Linker expression frame is shown in SEQ ID NO. 2, wherein N is an editing site sequence of a target gene, and the number of bases of N ranges from 15 to 25.

[0015] Preferably, the number of bases of N ranges from 18 to 20.

[0016] Preferably, the number of bases of N is 20.

[0017] Preferably, the vector construction method comprises the following steps: cloning the nCas12f-InteinN expression frame and the InteinC-cCas12f-Linker expression frame into the cloning sites of the plant virus vector, respectively.

[0018] Preferably, the molar ratio of the pNC-TRV2-OE vector to the nCas12f-InteinN expression frame or the InteinC-cCas12f-Linker expression frame in the cloning reaction system is 1:3 to 1:1.

[0019] Preferably, the cloning reaction system contains 60 ng of pNC-TRV2-OE vector, 30-50 ng of nCas12f-InteinN expression cassette or InteinC-cCas12f-Linker expression cassette, 5 μL of Nimble Mix reaction solution, and a total system volume of 10 μL. The reaction conditions are 50 °C for 30 minutes.

[0020] Optionally, the cloning reaction system can be scaled up or down proportionally according to the aforementioned reaction system.

[0021] In another preferred embodiment, the nCas12f-InteinN expression cassette and the InteinC-cCas12f-Linker expression cassette are cloned into the multiple cloning site of the PVX plant virus vector, respectively.

[0022] Another aspect of the present invention provides a plant virus-mediated gene editing method, the specific steps of which are as follows: 1) Transform Agrobacterium using any of the aforementioned vectors or the vectors obtained by any of the aforementioned methods; 2) Infect the target plant with the Agrobacterium containing the carrier obtained in step 1), preferably by injection or immersion.

[0023] The present invention also provides a kit, characterized in that the kit comprises a pNC-TRV2-OE vector, an nCas12f-InteinN expression cassette, and an InteinC-cCas12f-Linker expression cassette, and further comprises a reaction solution for constructing the vector. The sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.1, and the sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.2, wherein N is the editing site sequence of the target gene, and the number of bases of N ranges from 15 to 25. The reaction solution is Nimble Mix reaction solution.

[0024] The present invention also provides a kit, characterized in that the kit comprises a PVX vector, an nCas12f-InteinN expression cassette, and an InteinC-cCas12f-Linker expression cassette, and further comprises primers and a reaction solution for constructing the vector. The sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.1, and the sequence of the InteinC-cCas12f-Linker expression cassette is shown in SEQ ID NO.2, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25. The reaction solution is NEBuilder enzyme solution.

[0025] The present invention also provides the application of the vector described in any of the foregoing claims, or the vector obtained by any of the methods described, or the kit described herein, in plant gene editing.

[0026] Compared with the prior art, the technical solution provided by this invention has the following advantages: By expressing the AsCas12f gene (including its nuclear localization signal and gRNA sequence) in segments, the gene length is further reduced, making vector expression more stable. Furthermore, co-expression can form a functional AsCas12f, thus achieving gene editing effects. Attached Figure Description

[0027] The beneficial effects of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0028] Figure 1 This is an electrophoresis image of the target fragment amplified using a TRV vector without Intein. 1: nCas12f (containing nuclear localization signal); 2: cCas12f-Linker (containing gRNA and target sequence); 3: cCas12f-RuvC (containing gRNA and target sequence); M: DL2000 Marker.

[0029] Figure 2 This is a schematic diagram of the gene editing element structure of the AsCas12f segmented expression vector. NLS: Nuclear localization signal.

[0030] Figure 3 The gene editing efficiency of the TRV vector expressing AsCas12f segments was significantly different between groups (P<=0.05).

[0031] Figure 4 This section describes the gene editing type and efficiency of the TRV vector expressing AsCas12f segments. Underlined sequences represent the target gene sequences. WT: Wild-type; D: Base deletion.

[0032] Figure 5 This is an electrophoresis image of the vector constructed using the PVX vector for AsCas12f segmentation expression and the amplified target fragment. 1: PVX vector; 2: nCas12f-InteinN; 3: InteinC-cCas12f-Linker; 4: InteinC-cCas12f-RuvC; M: DNA Marker.

[0033] Figure 6 The gene editing efficiency of the PVX vector expressing AsCas12f segments was significantly different between groups (P<=0.05). Detailed Implementation

[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0035] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0036] The partial nucleotide sequence involved in this invention is shown below: SEQ ID NO.1 ; SEQ ID NO.2 Atgatcaagatcgccaccaggaagtacctcggcaagcagaacgtctatgatataggggtggagcgcgaccacaacttcgcgctgaaaaatggatttattgcttccgaacctcaaacaagggtactagatctcaataaaattatggggatagatctgggagttgccgttgcagcatacatggcatttcagcacacaccagccaggtataaactcgaaggtggtgagattgagaactttagaagacaagttgagagcagacgaatttcaatgttacggcagggaaagtatgcagggggagcccgtggaggtcatggcagagataaaagaattaagcccattgaacaattacgtgacaagatcgccaacttccgggacactactaaccatcgttattcccgctacattgttgacatggctataaaggagggatgtggtacaattcaaatggaggatctaacaaacatacgcgacattggcagtaggttcttgcaaaattggacttactatgatcttcaacaaaaaattatatataaggctgaagaagctggtattaaggtcatcaagattgatccacagtatacttcacaaagatgcagtgaatgtgggaacatcgacagtggtaatagaattggtcaagctattttcaaatgcagagcttgtggatatgaggcaaatgctgattacaatgcagcgaggaatatcgctattcctaatatcgataagataatagcagagtcaattaaatctggtaagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaagtgaaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcaggattcgtcggttcagcgacgataagccgagaagtgccaataaaactgttaagtggtttggtaacgctcggtaaggtccgaaaggagaaccactgaacnttttttt; SEQ ID NO.3 agtggtctctgtccagtcctatggctccgaagaagaagag; SEQ ID NO.4 ggtctcagcagaccacaagttcatagtacccttgtttgaggtt; SEQ ID NO.5 agtggtctctgtccagtcctatggaacctcaaaagggtact; SEQ ID NO.6 ggtctcagcagaccacaagtaaaaaaatcgctactaccaa; SEQ ID NO.7 agtggtctctgtccagtcctatggatctcaataaaattatggg; SEQ ID NO.8 tagtacccttgttgaggtt; SEQ ID NO.9 aacctcaaacaagggtactatgtctttcctatgaaactga; SEQ ID NO.10 ggtctcagcagaccacaagttcaatttggcaggttgtcga; SEQ ID NO.11 agtggtctctgtccagtcctatgatcaagatcgccaccag; SEQ ID NO.12 ggaagcaataaatccatttt; SEQ ID NO.13 aaaatggatttattgcttccgaacctcaaaagggtact; SEQ ID NO.14 aaaatggatttattgcttccgatctcaataaaattatggg; SEQ ID NO.15 aggtcagcaccagctagcatatggctccgaagaagaagag; SEQ ID NO.16 attaaccgtcatcggcggtcgactcaatttggcaggttgtcga; SEQ ID NO.17 aggtcagcaccagctagcatatgatcaagatcgccaccag; SEQ ID NO.18 acttaaccgttcatcggcggtcgacaaaaaaatcgctactaccaaaac; SEQ ID NO.19 gaccgccgatgaaacggttaag; SEQ ID NO.20 atgctagctggtgctgacct; SEQ ID NO.21 Tgtctttcctatgaaactgaaatcctcaccgtagaatatggtttgctacccatcgggaaaattgtcgagaagagaattgagtgcacggtgtacagcgttgataacaatggcaacatctacacacaaccggtggcgcagtggcatgatcggggggagcaagaggtgttcgagtactgccttgaagatggatcattaatacgcgccaccaaggaccacaagttcatgacagttgacggccagatgctgcctattgatgaaatatttgagagggagctggatctcatgagggtcgacaacctgccaaatatgatcaagatcgccaccaggaagtacctcggcaagcagaacgtctatgatataggggtggagcgcgaccacaacttcgcgctgaaaaatggatttattgcttcc; SEQ ID NO.26

[0037] Example 1: Construction of TRV viral vectors with different structures for segmented expression of the AsCas12f gene and their gene editing efficiency. (1) Construction of TRV viral vector expressing AsCas12f gene segments without Intein Based on the nucleic acid sequences of AsCas12f (with nuclear localization signals added before and after) and its gRNA (containing the target sequence of the Nicotiana benthamiana PDS gene) (AsCas12f-tRNA-gRNA), a pair of primers was designed to amplify the 5' end sequence (containing REC, WED, and Linker) of the AsCas12f gene and its 5' end nuclear localization signal. The upstream primer is SEQ ID NO.3, and the downstream primer is SEQ ID NO.4. A pair of primers was designed to amplify the 3' end sequence (containing Linker, RuvC, and TNB) of the AsCas12f gene and the gRNA (containing the target sequence of the Nicotiana benthamiana PDS gene). The upstream primer is SEQ ID NO.5, and the downstream primer is SEQ ID NO.6. A pair of primers was designed to amplify the 3' end sequence (containing RuvC and TNB, but not Linker) of the AsCas12f gene and the gRNA (containing the target sequence of the Nicotiana benthamiana PDS gene). The upstream primer is SEQ ID NO.7, and the downstream primer is the same as SEQ ID NO.6. Using the artificially synthesized AsCas12f-tRNA-gRNA (Shanghai Sangon Biotech) as a template, PCR amplification was performed using the three pairs of primers described above and PrimeSTAR high-fidelity polymerase (Takara). The PCR amplification program was: 98℃ for 30 seconds; 98℃ for 10 seconds, 55℃ for 20 seconds, 72℃ for 30 seconds, for 28 cycles; and a final extension at 72℃ for 1 minute. The PCR products were detected by agarose gel electrophoresis, and the target band was recovered by gel excision. Figure 1The three recovered fragments were cloningd with the TRV viral vector pNC-TRV2-OE (patent publication number: CN116064647B) using Nimble Cloning. The cloning reaction system consisted of 50-70 ng of vector, 30-50 ng of recovered fragments, and 5 μL of Nimble Mix (Nixing Biotechnology), for a total system volume of 10 μL. The reaction conditions were 50°C for 30 minutes. 5 μL of the ligation product was transformed into competent E. coli cells, and the resulting single clones were identified by PCR and sequencing. Three TRV viral vectors containing the AsCas12f gene fragment with correct sequences were obtained and named pTRV2-nCas12f (containing amplified fragments of SEQ ID NO.3 and SEQ ID NO.4), pTRV2-cCas12f-Linker (containing amplified fragments of SEQ ID NO.5 and SEQ ID NO.6), and pTRV2-cCas12f-RuvC (containing amplified fragments of SEQ ID NO.7 and SEQ ID NO.6), respectively.

[0038] (2) Construction of TRV viral vector containing Intein-containing AsCas12f gene segment expression Based on the nucleic acid sequences of AsCas12f (with nuclear localization signals added before and after) and its gRNA (containing the target sequence of the Nicotiana benthamiana PDS gene), as well as the nucleic acid sequence of artificially synthesized Intein (SEQ ID NO. 15), a pair of primers was designed to amplify the 5' end sequence of the AsCas12f gene (containing REC, WED, and Linker) and its 5' end nuclear localization signal (named nCas12f). The upstream primer is the same as SEQ ID NO. 3, and the downstream primer is SEQ ID NO. 8. A pair of primers was designed to amplify the 5' end sequence of Intein (named InteinN). The upstream primer is SEQ ID NO. 9, and the downstream primer is SEQ ID NO. 10. SEQ ID NO. 8 and SEQ ID NO. 9 have a 20 bp overlap sequence for ligation of the two fragments. A pair of primers was designed to amplify the 3' end sequence of Intein (named InteinC). The upstream primer is SEQ ID NO. 11, and the downstream primer is SEQ ID NO. 10. NO. 12; A pair of primers was designed to amplify the 3' end sequence (containing Linker, RuvC, and TNB) and gRNA sequence (named cCas12f-Linker) of the AsCas12f gene. The upstream primer is SEQ ID NO. 13, and the downstream primer is the same as SEQ ID NO. 6. A pair of primers was designed to amplify the 3' end sequence (containing RuvC and TNB, but excluding Linker) and gRNA sequence (named cCas12f-RuvC) of the AsCas12f gene. The upstream primer is SEQ ID NO. 14, and the downstream primer is the same as SEQ ID NO. 6. SEQ ID NO. 12 and SEQ ID NO. 13-14 have a 20 bp overlap sequence, which is used for ligation of the two fragments. Using artificially synthesized AsCas12f-tRNA-gRNA (SEQ ID NO. 26, where N base is ttatgttttggtagtagcga) and Intein (Shanghai Sangon Biotech, SEQ ID NO. 21) as templates, PCR amplification was performed using the above 5 pairs of primers under the same amplification conditions. The amplification products were detected by agarose gel electrophoresis, and the target band was recovered by gel cutting.

[0039] The five recovered fragments were divided into three combinations (nCas12f+InteinN, InteinC+cCas12f-Linker, and InteinC+cCas12f-RuvC), and each was subjected to multi-fragment nimble cloning with the TRV viral vector pNC-TRV2-OE under the same reaction conditions. 5 μL of the ligation product was transformed into competent *E. coli* cells, and the resulting single clones were identified by PCR and sequencing. Three TRV viral vectors containing the AsCas12f gene fragment with correct sequences were obtained and named pTRV2-nCas12f-InteinN (SEQ ID NO. 22), pTRV2-InteinC-cCas12f-Linker (SEQ ID NO. 23), and pTRV2-InteinC-cCas12f-RuvC, respectively. Schematic diagrams of the gene editing element structures of the three vectors are shown below. Figure 2 The nucleic acid sequences of nCas12f-InteinN and InteinC-cCas12f-Linker are SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0040] (3) Gene editing efficiency of TRV viral vectors expressing AsCas12f gene segments Plasmids from the six vectors constructed in (1) and (2) above were extracted and transformed into Agrobacterium GV3101. Single colonies of Agrobacterium were picked for PCR identification. Single clones containing the target vector were inoculated into 5 ml of LB liquid medium and cultured at 200 rpm and 28°C with shaking until the OD600 reached 1.0-1.5. The bacterial culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. 5 ml of injection buffer (50 mM MES pH 5.6, 10 mM MgCl2, 100 uM acetosyringone) was added, and the culture was gently resuspended. The culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. Add injection buffer to an OD600 of 0.3-0.6, and incubate in the dark at room temperature for 1-2 hours. Inject four different combinations of T. Benzyl leaflets (using an equal proportion of TRV1 injection solution): Combination 1: pTRV2-nCas12f + pTRV2-cCas12f-Linker; Combination 2: pTRV2-nCas12f + pTRV2-cCas12f-RuvC; Combination 3: pTRV2-nCas12f-InteinN + pTRV2-InteinC-cCas12f-Linker; Combination 4: pTRV2-nCas12f-InteinN + pTRV2-InteinC-cCas12f-RuvC. Seven days post-injection, extract DNA from the injected area of ​​the leaflet using the TransDirect® Plant Tissue PCR Kit (Beijing TransGen), and amplify the target sequence by PCR. The amplification primers were: upstream primer: ggagtgagtacggtgtgcgaggtcttcgttggg; downstream primer: gagtggatgctggatggcctttgtcaatcttcgggtc. The PCR products were subjected to HI-TOM high-throughput sequencing, with three replicates tested, and the sequencing results were analyzed and compared. Sequencing results showed that neither combination 1 (pTRV2-nCas12f+pTRV2-cCas12f-Linker) nor combination 2 (pTRV2-nCas12f+pTRV2-cCas12f-RuvC) showed any gene editing effect, while both combination 3 (pTRV2-nCas12f-InteinN+pTRV2-InteinC-cCas12f-Linker) and combination 4 (pTRV2-nCas12f-InteinN+pTRV2-InteinC-cCas12f-RuvC) showed gene editing of the target gene, and the gene editing efficiency of combination 3 was significantly higher than that of combination 4. Figure 3This indicates that segmental expression of the AsCas12f gene cannot spontaneously form a complete and functional AsCas12f protein, but with the binding of the Intein protein, segmental expression of the AsCas12f gene can form a complete and functional AsCas12f protein. Furthermore, the presence of linker repeat sequences in two segments of the AsCas12f gene can improve gene editing efficiency. The detected gene editing types were mainly deletions of 8-13 bases. Figure 4 This conforms to the characteristics of AsCas12f gene editing, further proving that the segmented expression of the AsCas12f gene forms a complete and functional AsCas12f protein.

[0041] Example 2 Construction of PVX viral vector for segmented expression of the AsCas12f gene and its gene editing efficiency (1) Construction of PVX viral vector A pair of primers was designed to amplify the nCas12f-InteinN fragment used for PVX vector construction: upstream primer SEQ ID NO. 15 and downstream primer SEQ ID NO. 16. PCR amplification was performed using the constructed pTRV2-nCas12f-InteinN plasmid as a template. Another pair of primers was designed to amplify the InteinC-cCas12f-Linker and InteinC-cCas12f-RuvC fragments used for PVX vector construction: upstream primer SEQ ID NO. 17 and downstream primer SEQ ID NO. 18. PCR amplification was performed using the constructed pTRV2-InteinC-cCas12f-Linker and pTRV2-InteinC-cCas12f-RuvC plasmids as templates, respectively. Finally, based on the PVX vector sequence (Genbank: AY297843), a pair of primers was designed to amplify the PVX vector: upstream primer SEQ ID NO. 19 and downstream primer SEQ ID NO. 20. PCR amplification was performed using the PVX plasmid as a template. Electrophoresis followed by gel cutting and recovery of the target fragment ( Figure 5 The recovered target fragment and vector were ligated using NEBuilder enzyme solution. After transformation into Agrobacterium, clones were selected for PCR identification and sequence verification. Three PVX viral vectors expressing AsCas12f gene segments were successfully constructed and named pPVX-nCas12f-InteinN (SEQ ID NO.24), pPVX-InteinC-cCas12f-Linker (SEQ ID NO.25), and pPVX-InteinC-cCas12f-RuvC, respectively.

[0042] (2) Gene editing efficiency The gene editing efficiency of the three Agrobacterium-containing PVX vectors was tested by injecting them into tobacco leaves. The injection method was the same as above. The three vectors were divided into two combinations: Combination 1: pPVX-nCas12f-InteinN + pPVX-InteinC-cCas12f-Linker; Combination 2: pPVX-nCas12f-InteinN + pPVX-InteinC-cCas12f-RuvC. Gene editing efficiency at the injection site was tested 7 days post-injection, using the same method as above. The results showed that gene editing of the target gene was detected in both Combination 1 and Combination 2, and the gene editing efficiency of Combination 1 was significantly higher than that of Combination 2. Figure 6 The results show that segmented expression of the AsCas12f gene using the PVX vector resulted in the formation of a complete and functional AsCas12f protein. Furthermore, the presence of linker repeat sequences in the two segments of the AsCas12f gene can improve gene editing efficiency, further demonstrating that linker repeat sequences play an important role in the reassembly of the AsCas12f gene after segmented expression.

[0043] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A set of vector expression frames, the vector expression frames comprising an nCas12f-InteinN expression frame with a sequence as shown in SEQ ID NO.1 and an InteinC-cCas12f-Linker expression frame with a sequence as shown in SEQ ID NO.2, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25, the vector expression frames being used to construct a gene editing vector for segmented expression of the AsCas12f gene.

2. A gene editing vector for segmented expression of the AsCas12f gene, characterized in that, The gene editing vector is a plant virus vector. The gene editing vector utilizes the plant virus to express gene editing elements AsCas12f-InteinN and InteinC-cCas12f-Linker expression cassettes in segments, forming gene editing vectors that independently express the AsCas12f-InteinN expression cassette structure and the InteinC-cCas12f-Linker expression cassette structure, respectively. The sequence of the AsCas12f-InteinN expression cassette is shown in SEQ ID NO.1, and the sequence of the InteinC-cCas12f-Linker expression cassette is shown in SEQ ID NO.2, where N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25.

3. The gene editing vector according to claim 2, characterized in that, The gene editing vector was obtained through the following steps: The nCas12f-InteinN expression cassette and the InteinC-cCas12f-Linker expression cassette were cloned into the pNC-TRV2-OE vector or the PVX vector, respectively.

4. The gene editing vector according to claim 2, characterized in that, The gene editing vector comprises the vectors shown in SEQ ID NO.22 and SEQ ID NO.23, or the vectors shown in SEQ ID NO.24 and SEQ ID NO.

25.

5. A method for constructing a gene-editing vector based on a plant virus, characterized in that, The method involves cloning the gene editing element AsCas12f and its gRNA into the multiple cloning site of a plant virus vector in segments, and then expressing the gene editing element AsCas12f and its gRNA in segments using the plant virus to form independently expressed gene editing vectors containing an nCas12f-InteinN expression cassette and an InteinC-cCas12f-Linker expression cassette, respectively. The sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.1, and the sequence of the InteinC-cCas12f-Linker expression cassette is shown in SEQ ID NO.2, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25.

6. The method for constructing a gene editing vector according to claim 5, characterized in that, The method includes the following steps: The nCas12f-InteinN expression cassette and the InteinC-cCas12f-Linker expression cassette were cloned into the pNC-TRV2-OE vector or the PVX vector, respectively.

7. A plant virus-mediated gene editing method, characterized in that, The specific steps are as follows: 1) Transforming Agrobacterium using the gene editing vector according to any one of claims 2 to 4, or the gene editing vector obtained by the method according to any one of claims 5 to 6; 2) Use the Agrobacterium containing the gene editing vector obtained in step 1) to infect the target plant, wherein the target plant is tobacco.

8. A reagent kit, characterized in that, The kit comprises the pNC-TRV2-OE vector, the nCas12f-InteinN expression cassette, and the InteinC-cCas12f-Linker expression cassette, and also includes a reaction solution for constructing the vector. The sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.1, and the sequence of the InteinC-cCas12f-Linker expression cassette is shown in SEQ ID NO.2, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25. The reaction solution is Nimble Mix reaction solution.

9. A reagent kit, characterized in that, The kit comprises a PVX vector, an nCas12f-InteinN expression cassette, and an InteinC-cCas12f-Linker expression cassette, as well as primers and reaction solutions for constructing the vector. The sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.1, and the sequence of the InteinC-cCas12f-Linker expression cassette is shown in SEQ ID NO.2, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25. The reaction solution is NEBuilder enzyme solution.

10. The application of the gene editing vector according to any one of claims 2 to 4 in plant gene editing, wherein the plant is tobacco.

Images