Split intein for use in the treatment of CEP290-associated disease

Abstract

The present disclosure relates to the use of split inteins for expressing centrosomal protein 290 (CEP290) protein encoded by CEP290 gene in a subject in need thereof for gene therapy in particular for the treatment of CEP290-associated disease, preferably Leber congenital amaurosis.

Description

SPLIT INTEIN FOR USE IN THE TREATMENT OF CEP290-ASSOCIATED DISEASETECHNICAL FIELDThe present disclosure relates to the use of split inteins for expressing centrosomal protein 290 (CEP290) protein encoded by CEP 290 gene in a subject in need thereof for gene therapy in particular for the treatment of CEP290-associated disease, preferably Leber congenital amaurosis.BACKGROUNDDefects in primary cilium formation and function are responsible for a variety of human diseases and developmental disorders, collectively termed ciliopathies. Mutations in the gene CEP290 have been described in numerous cases of the devastating inherited blinding disease Leber congenital amaurosis and other more debilitating ciliopathies, such as Joubert syndrome, Senior Loken Syndrome, and Meckel-Gruber syndrome. These disorders range in severity from isolated retinal degeneration to renal dysfunction, central nervous system malformations, hepatic development defects, and embryonic lethality.Adeno-associated viruses (AAV) have been widely used for viral delivery in gene therapy. However, the size of a gene that can be encapsulated into AAV has been reported to be limited to ~5 kb (Grieger and Samulski 2005, J Virol 79: 9933-9944). Gene therapy strategies for treating CEP290 associated disease are complicated by the size of the protein and the difficulty of packaging large sequences (7.5 kb) into currently used gene therapy vectors.Due to its large size, CEP290 cannot be encapsulated into a single AAV, and there remains a need to develop new strategies to deliver CEP290 gene inside target cells.Inteins are genetic elements that carry out trans-splicing, where two protein fragments bind to form a catalytically competent enzyme, then catalyze their own excision and the ligation of their flanking sequences. Split inteins have been mainly used to fuse different functional protein domains in protein purification system and labeling steps.Tornabene et al. 2009 used split intein-mediated protein trans-splicing to reconstitute CEP290 protein. However, CEP290 protein reconstitution is only observed when CEP290 protein was split into three fragments flanked by split-inteins. Split intein-mediated protein trans-splicingwith CEP290 split in two fragments was shown to be inefficient in this study. However, by splitting CEP290 in three fragments, there is a risk that trans-splicing events occurs between the first and third AAV vectors reducing therefore the amount of full-length protein generated and inducing potential toxicity in vivo. Therefore, split intein-mediated protein trans-splicing with triple AAV vectors may not be adapted for therapeutic applications.Thus, there remains a need to develop new strategies to efficiently deliver CEP290 gene in cells to efficiently express the full-length protein for therapeutic applications.In the last years several new inteins have been engineered based on consensus design (Stevens et al., J Am Chem Soc. 2016 Feb 24;138(7):2162-5; Stevens, Sekar, Gramespacher, Cowbum, & Muir, J Am Chem Soc. 2018 Sep 19; 140(37): 11791-11799) and shown to have superior properties than naturally occurring inteins.SUMMARYIn the present application, the inventors showed for the first time that split intein-mediated protein trans-splicing with only two fragments can be used to efficiently reconstitute CEP290 protein encoded by CEP 290 gene in a cell. In particular, they determined the specific split positions that allow to efficiently reconstitute CEP290 protein with only two fragments.CEP290 reconstitution with split inteins represents an efficient strategy to treat CEP290- associated disease such as Leber congenital amaurosis. The use of only two split-inteins to reconstitute CEP290 protein, in particular in combination with degrons, instead of three fragments would make it possible to prevent the risk that trans-splicing events occur between the first and third fragments and the potential associated toxicity in vivo.The present disclosure relates to a combination of polynucleotides for use in the treatment of CEP290-associated disease, preferably CEP290-associated ciliopathy, more preferably selected from the group consisting of: Leber congenital amaurosis, Bardet-Biedl syndrome, Joubert syndrome, Meckel syndrome, and Senior-Loken syndrome, again more preferably Leber congenital amaurosis, in a subject in need thereof wherein the combination comprises: i) a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’ : a N-terminal fragment of CEP290 protein and N-split intein, fused directly or indirectly via a linker,ii) a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ : a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein expression of first and second polynucleotides in said subject generates CEP290 by protein splicing.In a preferred embodiment, the N-terminal fragment of CEP290 protein up to residue 1174 and the C-terminal fragment of CEP290 protein from residue 1175 respectively, the N-terminal fragment of CEP290 protein up to residue 1193 and the C-terminal fragment of CEP290 protein from residue 1194 respectively, the N-terminal fragment of CEP290 protein up to residue 1212 and the C-terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15.In a preferred embodiment, said CEP290 protein is human CEP290 protein, preferably comprising or consisting of SEQ ID NO: 15 or any functional variant thereof having at least 90% identity to SEQ ID NO: 15.In a particular embodiment, the first and second fusion proteins according to the present disclosure comprises amino acid sequences selected from any one of the following pairs: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, or SEQ ID NO: 20 and 21, or any functional variant thereof, preferably having at least 90 % identity to any one of sequences SEQ ID NO: 16-21.In a particular embodiment, the first amino acid of C-terminal fragment of CEP290 protein is an amino acid that facilitates the trans-splicing activity, preferably selected from the group consisting of: cysteine, serine and threonine.In a more particular embodiment, said N-split intein is a N-Cfa-intein of SEQ ID NO: 1 or any functional variant thereof having at least 90% identity to SEQ ID NO: 1; and said C-split intein is a C-Cfa intein of SEQ ID NO: 2 or any functional variant thereof having at least 90% identity to SEQ ID NO: 2, preferably wherein amino acid residues 20 to 22 of SEQ ID NO: 2 are GEP, more preferably C-Cfamut intein of SEQ ID NO: 13 or any functional variant thereof having at least 90% identity to SEQ ID NO: 13. In a preferred embodiment, the first amino acid of C- terminal fragment of CEP290 protein is a cysteine.In another specific embodiment, said N-split intein is a N-Nrdj 1 -intein of SEQ ID NO: 11 or any functional variant thereof having at least 90% identity to SEQ ID NO: 11; and said C-split intein is a C-Nrdj l intein of SEQ ID NO: 12 or any functional variant thereof having at least90% identity to SEQ ID NO: 12. In a preferred embodiment, the first amino acid of C-terminal fragment of CEP290 protein is a serine.In a more preferred embodiment, the first and second fusion proteins according to the present disclosure comprise amino acid sequences selected from any one of the following pairs: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33, or any functional variant thereof, preferably having at least 90 % identity to any one of sequences SEQ ID NO: 22-33.In a particular embodiment, the first fusion protein or second fusion protein may further comprise a degron, preferably selected from the group consisting of: SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof having at least 90% identity to any one of sequences SEQ ID NO: 34 to 64 or SEQ ID NO: 82, more preferably the first fusion protein further comprises a degron located at the 3 ’end of the N-split-intein, and / or the second fusion protein further comprises a degron located at 5’end of the C-split-intein, fused directly or indirectly via a linker.According to the present disclosure, each polynucleotide of the combination further comprises some regulatory elements, for example, promoters, transcription termination sequences, translation termination sequences, introns, enhancers, signal peptides, and polyadenylation elements, preferably a promoter selected from the group consisting of: Cytomegalovirus (CMV) promoter (GenBank Accession number: AF396260.1, bp 150-812, last updated on August 13, 2001), chimeric reduced version of the CMV and chicken beta-actin (CEB A) promoter (GenBank Accession number: AF396260.1, bp 160-526, last updated on August 13, 2001; GenBank Accession number: X00182.1, bp 268-571, last updated on November 14, 2006), human phosphoglycerate kinase (hPGK) promoter (GenBank Accession number: AH002938.2, bp 2-516, last updated on August 01, 2016), chimeric CMV enhanced and human phosphoglycerate kinase (ePGK) promoter (GenBank Accession number: AF396260.1, pb 160- 500, last updated on August 13, 2001; GenBank Accession number AH002938.2, bp 2-516, last updated on August 01, 2016), photoreceptor-specific, human rhodopsin kinase (hGRKl) promoter, rod specific IRBP promoter, cone-specific human cone arrestin (hCAR) promoter, VMD2 (vitelliform macular dystrophy / Best disease) promoter and EFl alpha promoter.Preferably each polynucleotide is comprised within an expression vector, preferably a viral vector, preferably an adeno associated viral (AAV) vector, preferably said AAV vectorcomprises capsid protein of AAV selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 or RhlO, preferably AAV2, AAV8 or AAV5.In a preferred embodiment, said combination is administered in subject by a parenteral route, more preferably by intravenous, intraarterial, intramuscular, intranasal, intraocular, intravitreal, suprachoroidal or subretinal route.The present disclosure also relates to a kit comprising: i) a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’ : a N-terminal fragment of CEP290 protein and N-split intein, fused directly or indirectly via a linker, ii) a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ : a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively, or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, and SEQ ID NO: 20 and 21, or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, more preferably wherein the first and second fusion proteins comprises amino acid sequences selected from any one of the following pairs: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33 or any functional variant thereof, preferably having at least 90 % identity to any one of sequences SEQ ID NO: 22-33.LEGEND FIGURESFigure 1: Splicing efficiency of CEP290 protein at position 1174, 1193, 1212 monitored by Western blot: CEP290 protein was first split at position 1174, 1193 or 1212 and the N-terminal fragment (residues 1-1174 or 1-1193 or 1-1212) recombinantly fused to N-inteins, and the C- terminal fragment (residues 1175-2479, 1194-2479 or 1213-2479) to the C-inteins. Cultured HEK293 cells were co-transfected with equimolar amounts of plasmids encoding for the N and C -terminal fragments and splicing efficiency monitored by Western blotting. HEK293 cells transfected with a full-length CEP290 protein serve as control. Split position is numbered according to CEP290 human amino acid sequence (SEQ ID NO: 15).Figure 2: CEP290 protein was split at position 1212 and the N-terminal fragment (residues 1- 1212) was recombinantly fused to Cfa or Nrdj l N-inteins, and the C-terminal fragment (residues 1213-2479) to the Cfa-Cmut or Nrdj l C-inteins. Cultured HEK293 cells were cotransfected with equimolar amounts of plasmids encoding for the N and C-terminal fragments and splicing efficiency monitored by Western blotting. HEK293 cells transfected with a full- length CEP290 protein serve as control. Split position is numbered according to CEP290 human amino acid sequence (SEQ ID NO: 15).Figure 3: Ciliogenesis assay. KO ARPE-19 cells (clone AR45) were transfected with a single plasmid encoding for the full-length CEP290, as a control, or co-transfected with both intein fragments (split position 1174) with the transfection agent Polyethylenimine (PEI). The addition of the transfection agent PEI affects ciliogenesis, so this agent was also included in the WT and KO untransfected controls. 48h later cells were analyzed by confocal microscopy using an antibody against cilia (ARL13B) and an antibody against the flag tag (M2) to detect CEP290. The % of cells with cilia were quantified.Figure 4: Ciliogenesis assay. KO ARPE-19 cells (clones AR45 and AR65) were transfected with a single plasmid encoding for the full-length CEP290 (FL), as a control, or co-transfected with both intein fragments (split position 1174, PTS- 1174) with the transfection agent PEI. The addition of the transfection agent PEI affects ciliogenesis, so it was also included in the WT and KO untransfected controls. 48h later, cells were analyzed by confocal microscopy using an antibody against cilia (ARL13B) and an antibody against the flag tag (M2) to detect CEP290. The % of cells with cilia were quantified. 4-6 experimental replicas are represented in the graph. Error bars correspond to SD. Statistical test: One-way ANOVA with Dunnetf s test for multiple comparison analysis, using KO as control group. ***, P<0.0005; ****, P<0.0001Figure 5: Ciliogenesis assay. WT and KO ARPE-19 cells (clone AR45) were transfected with a pUC scramble plasmid as negative control. KO ARPE-19 cells were also transfected either with single plasmid encoding for the full-length CEP290 (FL) as a positive control, or single plasmids encoding for fragments corresponding to 1174-CfaN, CfaCmut-1175, 1212-CfaN and CfaCmut-1213. KO ARPE-19 cells were co-transfected with both intein fragments corresponding either to split position 1174 (PTS-1174) or 1212 (PTS-1212). 48h later, cells were analyzed by confocal microscopy using an antibody against cilia (ARL13B) and an antibody against the flag tag (M2) to detect CEP290. The % of cells with cilia were quantified. 3-4 experimental replicas are represented in the graph. Error bars correspond to SD. Statistical test: One-way ANOVA with Dunnett' s test for multiple comparison analysis, using KO + pUC as control group. *, P<0.05; **, P<0.005 ****, P<0.0001Figure 6: Splicing of CEP290 protein at split position 1174 monitored by Western blot in vivo. CEP290 protein was split at split position 1174 and the corresponding AAV were produced. Wild type mice were injected subretinal with both AAVs. After one month the animals were euthanized and the retina was analyzed by Western blot.Figure 7: Splicing of CEP290 protein at split position 1174 monitored by Western blot in vivo with different AAVs. CEP290 protein was split at split position 1174 and the corresponding AAVs were produced, containing different regulatory elements. Nrl KO mice were co-injected subretinally with both AAVs. After one month the animals were euthanized and the retina was analyzed by Western blot (top). Intensities of bands corresponding to CEP290 were quantified and normalized based on the intensities of the beta-tubulin band, (bottom)Figure 8: In vivo retinal localization of spliced CEP290 protein at split position 1174 monitored by immunohistochemistry. CEP290 protein was split at split position 1174 and the corresponding AAVs were produced, containing different regulatory elements. Nrl KO mice were co-injected subretinally with both AAVs. After one month the animals were euthanized and the eye was processed for immunohistochemistry. Retinal tissue sections were immunolabelled with antibodies specifically recognizing the spliced CEP290 (anti-HA) or the total CEP290, including endogenous protein (anti-CEP290). Scale bar corresponds to 20 pm.Figure 9: Mean photopic b-wave amplitudes at 1 and 2 months post-injection in mice treated with C2N-32+C2C-32. Cep290Rdl6 / Rdl6;Nrl- / - mice were subretinally injected either with vehicle or with a combination of AAVs expressing C2N-32+C2C-32. PhotopicERGs were recorded 1 and 2 months following subretinal injection, mean b-wave amplitudes per group are shown. Error bars correspond to SD.Figure 10: Mean photopic a- and b-wave amplitudes at 1 and 2 months post-injection in mice treated with C2N-47+C2C-47. Cep290Rdl6 / Rdl6;Nrl- / - mice were subretinally injected either with vehicle or with a combination of AAVs expressing C2N-47+C2C-47. Photopic ERGs were recorded 1 and 2 months following subretinal injection, mean a- and b- wave amplitudes per group are shown. Error bars correspond to SD.DETAILED DESCRIPTIONCombination of polynucleotides encoding first and second fusion proteinsThe limited cargo capacity of the AAV vectors precludes its use for delivering large genes such as CEP290 gene in gene therapy. To deliver CEP290 gene in patients, the inventors took the advantage of the intrinsic ability of split inteins to mediate protein trans-splicing to reconstitute large centrosomal protein 290 (CEP290) encoded by large CEP290 gene following their fragmentation into two split-intein flanked polypeptides. In particular, they determined the split positions that allow to efficiently reconstitute CEP290 protein with only two split-intein fragments.The present disclosure relates to a combination of polynucleotides comprising: i) a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’ : a N-terminal fragment of centrosomal protein 290 (CEP290) and N-split intein, fused directly or indirectly via a linker, ii) a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of centrosomal protein 290 protein (CEP290), fused directly or indirectly via a linker, wherein expression of first and second polynucleotides in a cell generates full length CEP290 by protein splicing.According to the present disclosure, the combination of polynucleotides comprises a first polynucleotide encoding a first fusion protein and a second polynucleotide encoding a second fusion protein.According to the present disclosure, by the term “combination” is meant that the first and second polynucleotides according to the present disclosure can be formulated in a single or as separate formulations.According to the present disclosure, the term “nucleic acid sequence”, “nucleic acid molecule”, “nucleotide sequence” or “polynucleotide” may be used interchangeably to refer to any molecule composed of or comprising monomeric nucleotides. Polynucleotide may be DNA or RNA.Herein, the terms "peptide", "oligopeptide", "polypeptide" and "protein" are employed interchangeably and refer to a chain of amino acids linked by peptide bonds, regardless of the number of amino acids forming said chain.The term "amino acid" refers to naturally occurring and unnatural amino acids (also referred to herein as "non-naturally occurring amino acids"), e.g., amino acid analogues and amino acid mimetics that function similarly to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. Amino acid analogues refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, e.g., an alpha carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogues can have modified R groups (e.g., norleucine) or modified peptide backbones but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function similarly to a naturally occurring amino acid. The terms "amino acid" and "amino acid residue" are used interchangeably throughout.The term "fusion protein" as used herein refers to a recombinant protein comprising two or more protein domains from at least two different proteins linked, preferably covalently. Said fusion protein is obtained or obtainable by genetic fusion, for example by genetic fusion of at least two gene fragments encoding separate domains of distinct proteins. In preferred embodiments, a fusion protein is a single chain polypeptide which may be fully encoded by a nucleic acid sequence and includes at least two protein domains directly covalently linked by peptidic bond or optionally covalently linked via a peptidic linker.According to the present disclosure, said first fusion protein comprises a N-terminal fragment of CEP290 protein and N-split intein, fused directly or indirectly via a linker and said second fusion protein comprises a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker.The term "linker" as used herein, refers to a chemical group or a molecule linking two adjacent molecules or moieties. In some embodiments, the polynucleotide encodes a linker selected from the group consisting of a (GGS)n , a (GGGGS)n (SEQ ID NO: 78), a (G)n , an (EAAAK)n (SEQ ID NO: 79), a XTEN-based linker, or an (XP)n motif , or a combination of any of these, wherein n is independently an integer between 1 and 50. In other embodiments, a linker is not used. Instead, e.g., the polynucleotide sequences comprise nucleic acids encoding a first and second protein domains and further comprise additional nucleic acids in at least one of their ends that make the function of linker.According to the present disclosure, the expression of first and second polynucleotides encoding said first and second fusion proteins in a cell generates CEP290 protein by protein splicing.The term “protein trans-splicing” or “protein splicing” refers to the excision of a split-intein from a larger precursor polypeptide through the cleavage of two peptide bonds and, the concomitant ligation of the flanking protein fragments, also called exteins through the formation of a new peptide bond to form a mature protein and the free intein (Shah NH and Muir TW, Chem Sci. 2014; 5(1): 446-461. 2013).As used herein, the term “intein” refers to a protein that is capable of ligating the flanking sequences (exteins) into a new protein.As used herein, the term “split-inteins” or “trans-splicing inteins” means naturally occurring or engineered constructed protein fragments (i.e., N-intein and C-intein) which bind to form a catalytically competent enzyme capable of catalyzing a protein splicing reaction that excises the N- and C-intein sequences and joins flanking sequences (N- and C-exteins) with a peptide bond.As used herein, the term “peptide bond” refers to covalent chemical bond -CO-NH- formed between two molecules when the carboxy part of one molecule (carboxy component, C-component or C-terminal component) reacts with the amino part of another molecule (amino component, N-component or N-terminal component).According to the present disclosure, the term “N-split intein”, “N-intein”, or “N-terminal split intein” refers to any N-terminal amino acid sequence of a split intein that is capable of associating with a C-terminal amino acid sequence of said split intein to form a functional split intein that is capable of catalyzing a protein splicing reaction that excises the N- and C-intein sequences and joins flanking sequences (N- and C-exteins) with a peptide bond.According to the present disclosure, the term “C-intein”, “C-split intein” or “C-terminal split intein” refers to any C-terminal amino acid sequence of a split intein that is capable of associating with a N-terminal amino acid sequence of said split intein to form a functional split intein that is capable of catalyzing a protein splicing reaction that excises the N and C-intein sequences and joins flanking sequences (N- and C-exteins) with a peptide bond.In a particular embodiment, said N- and C-split inteins according to the present disclosure comprised in the first and second fusion proteins respectively can derive from the catalytic subunit of DNA polymerase III (DriaE) gene from different organisms such as cyanobacteria including Nostoc punctiforme (Npu), Synechocystis sp. Strain PCC6803 (Ssp), Fischerella sp. PCC 9605, Scytonema tolypothrichoides, Cyanobacteria bacterium SW 9 47-5, Nodularia spumigena, Nostoc flagelliforme, Crocosphaera watsonii WH 8502, Chroococcidiopsis cubana CCALA 043, or Trichodesuium erythraeum; preferably from Npu or Ssp.In another particular embodiment, the N- and C-split inteins can derive from the DnaB gene from Cyanobacteria including R. marinus (Rma), Synechocystis sp. PC6803 (Ssp), Porphyra purpurea chloroplast (Ppu), or can derive from gp41-l, gp41-8, NrdJ-1, or IMPDH-1, preferably Nrdj-1 (Carvajal- Vallejos P. et al. J Biol Chem. 2012 Aug 17; 287(34): 28686- 28696).In a preferred embodiment, N- and / or C- split inteins according to the present disclosure comprised in the first and second fusion proteins respectively can be engineered N- and / or C- split inteins. Said engineered N- and / or C- split inteins can be engineered by introducing mutations in natural N- and / or C- split intein sequences, in particular to enhance protein splicing activity.In a preferred embodiment, the N-split intein and / or C-split intein sequences comprised in the first and second fusion proteins respectively comprise or consist of amino acid sequences selected from any of N- and C-split inteins listed in Table 1 below:Table 1: Examples of pairs of N- and C-split inteins that can be used according to the present disclosure.Amino acids in bold can be replaced by GEP amino acids to improve extein tolerance.In a particular embodiment, the N- and C-split inteins comprised in the first and second fusion proteins respectively according to the present disclosure are N- and C-split inteins comprising or consisting of amino acid sequences of SEQ ID No: 1 (Cfa-N split intein) and SEQ ID No: 2 (Cfa-C-split intein), SEQ ID No: 3 (Npu-N) and 4 (Npu-C), SEQ ID No: 5 (Cat-N) and 6 (Cat- C), SEQ ID No: 7 (Gp41-N) and 8 (Gp41-C), SEQ ID No: 9 (ConN) and 10 (ConC) or SEQ ID No: 11 (Nrdj 1-N) and 12 (Nrdj 1-C) or any functional variant(s) thereof, preferably SEQ ID No: 1 (Cfa-N split intein) and SEQ ID No: 2 (Cfa-C-split intein) or SEQ ID No: 11 (Nrdj 1-N) and 12 (Nrdj 1-C) or any functional variant(s) thereof.As used herein, the term "variant" or “functional variant” refers to a polypeptide sequence that is derived from N- and / or C-split inteins as described above and comprises an alteration, i.e., a substitution, insertion, and / or deletion, at one or more positions, but retain the capacity when bound to form a functional enzyme to catalyze a protein splicing reaction that excises the N and C-intein sequences and joins flanking sequences (N- and C-exteins) with a peptide bond.The variant may be obtained by various techniques well known in the art. Examples of techniques for altering the nucleotide sequence encoding the native protein, include, but are not limited to, site-directed mutagenesis, random mutagenesis and synthetic oligonucleotide construction.The protein splicing efficiency of N- and / or C-split intein functional variants may be assessed for instance by measuring the protein reconstitution efficiency in a cell. In particular, the protein reconstitution efficiency can be measured by expressing in a cell a combination of polynucleotides, said first polynucleotide encodes a N-terminal fragment of a reporter protein (e.g., GFP) fused to N-split intein and a second polynucleotide encodes a C-terminal fragment of said gene reporter fused to the C-split intein. The reconstitution efficiency of the reporter protein can then be monitored by determining the level of expression of reconstituted protein.The expression level of reconstituted protein may be determined by any suitable methods known by skilled persons. The quantity of the protein may be measured, for example, by semi- quantitative Western blots, enzyme-labelled and mediated immunoassays, such as ELISAs, biotin / avidin type assays, radioimmunoassay, immunoelectrophoresis, mass spectrometry, or immunoprecipitation or by protein or antibody arrays. In a particular embodiment, when saidreporter protein is a fluorescent protein, the quantity of protein may be measured by flow cytometry or fluorescence microscopy.The expression level can then be compared to a control value. According to a preferred embodiment, the term "control value " refers to the expression level of protein reconstituted with the native N- and C- split inteins in a cell expressing a combination of polynucleotides, said first polynucleotide encodes a N-terminal fragment of a reporter protein (e.g., GFP) fused to native N-split intein and a second polynucleotide encodes a C-terminal fragment of said gene reporter fused to the native C-split intein.The protein reconstitution efficiency of a functional variant is similar to that of native split intein in a cell when the expression level of said protein reconstituted with functional variants of N- and / or C-split intein(s) in a cell is similar than the control value (i.e., expression level of said protein reconstituted with native N- and C-split inteins), in particular the expression level varies by less than 40%, 30%, 20% or 10% of the control value.As used herein, the term "variant" or “functional variant” may refer to a polypeptide having an amino acid sequence having at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity any one of the N- and / or C-split intein(s) as described above, in particular in Table 1 and preferably retains protein splicing capacity of said polypeptide as described above.In a particular embodiment, said N-split intein and C-split intein according to the present disclosure comprised in the first and second fusion proteins respectively comprises or consists of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10 or SEQ ID NO: 11 and 12 or any functional variant(s) thereof, preferably having 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to any one of the amino acid sequences selected from the group consisting of SEQ ID NO: 1 to 12, preferably SEQ ID NO: 1 and 2 or SEQ ID NO: 11 and 12 or any functional variant(s) thereof, preferably having 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to any one of the amino acid sequences consisting of SEQ ID NO: 1 and 2 or 11 and 12.As used herein, the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions x 100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described below. The percent identity between two aminoacid sequences can be determined using the Needleman and Wunsch algorithm (NEEDLEMAN, and Wunsch).The percent identity between two nucleotide or amino acid sequences may also be determined using for example algorithms such as EMBOSS Needle (pair wise alignment; available at www.ebi.ac.uk, Rice et al 2000 Trends Genet 16 :276-277). For example, EMBOSS Needle may be used with a BLOSUM62 matrix, a “gap open penalty” of 10, a “gap extend penalty” of 0.5, a false “end gap penalty”, an “end gap open penalty” of 10 and an “end gap extend penalty” of 0.5. In general, the “percent identity” is a function of the number of matching positions divided by the number of positions compared and multiplied by 100. For instance, if 6 out of 10 sequence positions are identical between the two compared sequences after alignment, then the identity is 60%. The % identity is typically determined over the whole length of the query sequence on which the analysis is performed. Two molecules having the same primary amino acid sequence or nucleic acid sequence are identical irrespective of any chemical and / or biological modification.The term "variant" or “functional variant” may also refer to a polypeptide having an amino acid sequence that differs from a native sequence by less than 10, 9, 8, 7, 6, 5, 4 or 3 substitutions, insertions and / or deletions. In a preferred embodiment, the variant differs from the native sequence by one or more conservative substitutions, preferably by less than 10, 9, 8, 7, 6, 5, 4 or 3 conservative substitutions. Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), Hydroxyl or sulfur / selenium-containing amino acids (serine, cysteine, threonine, methionine), polar amino acids (glutamine and asparagine), hydrophobic amino acids (methionine, leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), hydroxyl or sulfur / selenium-containing amino acids (serine, cysteine, threonine, methionine) and small amino acids (glycine, alanine, serine and threonine).The inventors previously engineered N- and C-split intein with superior protein trans-splicing properties. They showed that Cfa-N and Cfa-C-split inteins have a higher protein splicing efficiency than Npu split inteins (WO2017 / 132582 and WO2021 / 191447).In a preferred embodiment, the N- and C-split inteins according to the present disclosure comprised in the first and second fusion proteins respectively are Cfa-N- and Cfa-C-split inteins comprising or consisting of SEQ ID NO: 1 (Cfa-N split intein :) and SEQ ID NO: 2 (Cfa-C-split intein) or any functional variants thereof, preferably having 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 1 and / or 2.In a preferred embodiment, the functional variant of Cfa N- and / or Cfa C-Split intein retain the functional splicing activity of native Cfa split intein, more preferably have a protein splicing efficiency higher than Npu split-intein.Others N- and C-split inteins with superior protein trans-splicing properties that can be used according to the present disclosure are Nrdj 1 inteins. Nrdj 1 inteins are known to have a higher protein splicing efficiency than Npu split inteins (Carvajal- Vallejos et al. J Biol Chem. 2012 Aug 17; 287(34): 28686-28696).In a preferred embodiment, the N- and C-split inteins according to the present disclosure comprised in the first and second fusion proteins respectively are Nrdj l-N- and Nrdj 1-C-split inteins comprising or consisting of SEQ ID NO: 11 (Nrdj 1-N split intein) and SEQ ID NO: 12 (Nrdj 1-C-split intein) or any functional variants thereof, preferably having 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 11 and / or 12.In a preferred embodiment, the functional variant of Nrdj 1 N- and / or Nrdj 1 C-Split intein retain the functional splicing activity of native Nrdj 1 split intein, more preferably have a protein splicing efficiency higher than Npu split-intein.The protein splicing efficiency of functional variants of split inteins (e.g., functional variants of Cfa-N- and / or Cfa- C-split inteins or Nrdj 1-N- and / or Nrdl- C-split inteins) may be assessed as described above. In a preferred embodiment, the expression level of reconstituted protein with functional variant(s) of Split inteins (e.g., functional variants of Cfa-N- and / or Cfa- C-split inteins or Nrdj 1-N- and / or Nrdl- C-split inteins) is then compared to a control value that refers to the expression level of protein reconstituted with Npu inteins.The protein reconstitution efficiency is higher than Npu split-intein in a cell when the expression level of said protein reconstituted with engineered split intein(s) (e.g., Cfa-N- and / or Cfa-C-split intein(s) or Nrdj 1-N- and / or Nrdj 1-C-split inteins) in a cell is at least 1.5-fold higher, or 2, 3, 4, 5-fold higher or even more than in a control value (e.g., with Npu intein).In a more preferred embodiment, the functional variant of Cfa N- and / or Cfa C-Split intein can also splice faster than Npu split intein, preferably at least 1.5-fold higher, or 2, 3-fold higher or even more than Npu split intein. Protein trans-splicing activity can be measured by incubating N and C-split inteins individually in splicing buffer (e.g., lOOmM sodium phosphates, 150 mMNaCl, ImM EDTA, pH 7.2) with 2 mM tris(2-carboxyethyl)phosphine (TCEP) for 15 minutes. Splicing is initiated by mixing N- and C-split inteins and quenched by the addition of 8M guanidine hydrochloride, 4% Trifluoroacetic acid TFA (3: 1 v / v). Splicing reactions progress can be monitored by RP-HPLC or SDS-PAGE. When using RP-HPLC, each individual peak is normalized against the total area of all peaks combined and reaction curves are plotted (see detailed protocol, paragraphs

[0724] -

[0731] of WO2017 / 132580 application. When using SDS-PAGE quantification of splicing product is performed by densitometry using P-tubulin as a loading control.A major caveat to splicing-based methods is that all characterized inteins exhibit a sequence preference at extein residues adjacent to the splice site. Engineered versions of naturally split inteins, in particular C-split intein comprising GEP amino acids in positions 20, 21 and 22 wherein said residue is numbered according to SEQ ID NO: 2 possess improved extein tolerance.According to the present disclosure, the C-split intein derived from the catalytic subunit of DNA polymerase III (DnaE) gene may comprise GEP amino acids in positions 20, 21 and 22 wherein said residue is numbered according to SEQ ID NO: 2 (see Stevens et al., J Am Chem Soc. 2016 Feb 24; 138(7): 2162-2165, or Fig. 7A and B, C-intein of SEQ ID NO: 5 -358 of WO2017 / 132580), in particular instead of amino acid positions indicated in bold in the Table 1.In a preferred embodiment, the C-split intein is selected from any C-split inteins disclosed in Table 2.Table 2: Engineered C-split intein with improved extein toleranceIn a preferred embodiment, C-split intein is a mutated C-split intein having GEP amino acids in positions 20, 21 and 22 wherein said residue is numbered according to SEQ ID NO: 2 or any functional variant thereof, preferably retaining the functional splicing activity of split intein as described above, and more preferably having improved extein tolerance.In a particular embodiment, the C-split intein may be functional variants of the C-split inteins as described in Table 2, preferably comprising or consisting of amino acid sequence SEQ ID NO: 13 or 14, or any functional variants thereof having 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to any one of sequences SEQ ID NO: 13 or 14 and preferably retaining the functional splicing activity of C-split intein as described above, and more preferably having improved extein tolerance.The extein tolerance can be assessed for instance in kanamycin resistance assay as described in WO2017 / 132580 p. 60, paragraphs

[0735] -

[0738] in which a nucleic acid construct coding for a fragmented aminoglycoside phosphotransferase fused to a split intein with F, G, R or E present at the position +2 of the C-extein was transformed in DH5a competent cells and cultured at various concentrations of kanamycin. The cell density at 650 nm at 24 hours end point is measured and IC50 value is determined and compared with Cfa-Cmut. A functional variant having improved extein tolerance is a C-split intein having a similar IC50 than the split intein having GEP amino acids in positions 20, 21 and 22 wherein said residue is numbered according to SEQ ID NO: 2.In a preferred embodiment, the C-split intein is Cfa-Cmut split intein comprising or consisting of SEQ ID NO: 13 or any functional variant thereof having 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 13, preferably retaining the functional splicing activity of C- split intein as described above, and more preferably having improved extein tolerance, again more preferably having a similar IC50 than Cfa-Cmut comprising or consisting of SEQ ID NO: 2. In particular the IC50 varies by less than 40%, 30%, 20% or 10% of the positive control value (i.e., IC 50 of Cfa-c-mut comprising or consisting of SEQ ID NO: 13).In a more preferred embodiment, the combination of polynucleotides according to the present disclosure comprises a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’ : a N-terminal fragment of CEP290 and Cfa N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ : a Cfa C-split intein of SEQ ID NO: 2 or a Cfa Cmut- split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290, fused directly or indirectly via a linker.In another preferred embodiment, the combination of polynucleotides according to the present disclosure comprises a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’ : a N-terminal fragment of CEP290 and Nrdj l N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ : a Nrdj l C-split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290, fused directly or indirectly via a linker.The inventors took the advantage of the intrinsic ability of split inteins as described above to mediate protein trans-splicing to reconstitute large CEP290 following their fragmentation into two split-intein flanked polypeptides.Centrosomal protein 290 (also named herein CEP290 protein), encoded by CEP 290 gene is a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP / GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N- glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Centrosomes are involved in cell division and the assembly of microtubules, which are proteins that transport materials in cells and help the cell maintain its shape. Cilia are microscopic, finger-like projections that stick out from the surface of cells. Cilia is involved in cell movement and many different chemical signaling pathways. They are also necessary for the perception of sensory input (such as vision, hearing, and smell). The CEP290 protein is likely necessary for vision by playing a role in transporting proteins within photoreceptors. Mutations in this gene have been associated with syndrome associated with abnormal cilia, also known as ciliopathies, such as Leber congenital amaurosis, Bardet-Biedl syndrome, Joubert syndrome, Meckel syndrome and senior-Loken syndrome.In a specific embodiment, CEP290 protein is a human Centrosomal protein 290 (UniProtKB accession number: 015078; updated on January 24, 2024) encoded by CEP290 gene (GENE ID: 80184, updated on January 7, 2024), also known as CT87; MKS4; POC3; rd!6; BBS14; JBTS5; LCA10; NPHP6; SLSN6; 3HllAg. According to the present disclosure, the term “Centrosomal protein 290” encompasses all known protein isoforms known of the Centrosomal protein 290.In a preferred embodiment, according to the present disclosure CEP290 protein can be a human CEP290 protein as disclosed above or any functional variant thereof.Preferably, as used herein, the term "variant" or “functional variant” refers to a polypeptide having an amino acid sequence having at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to the native sequence and retain function of said polypeptide, herein Centrosomal protein 290, preferably human CEP290 protein (SEQ ID NO: 15), in particular retain ciliogenesis function.Centrosomal protein 290 activity of the functional variant can be assessed by determining the ciliogenesis in CEP290 knock-out retinal pigment epithelia cell lines transfected with said functional variant as described in the examples 1.1.8 and 1.1.9 of the present application. For example, CEP290 knock-out retinal pigment epithelia (RPE) cell lines are transfected with a nucleic acid construct encoding said CEP290 functional variant and, after induction of ciliogenesis, the percentage of ciliated cells is determined using an anti-ARL13 antibody, for example by microscopy. The ciliogenesis function of a CEP290 functional variant is retained if, after ciliogenesis induction of RPE cells transfected with a nucleic acid construct encoding a functional variant, the percentage of ciliated cells is similar to a control condition (e.g., nucleic acid construct encoding a native CEP290 protein), in particular varies by less than 40%, 30%, 20% or preferably 10% of the positive control value (e.g. cells treated with a nucleic acid construct encoding a native CEP290 protein).In a preferred embodiment, CEP290 is a human CEP290 protein comprising or consisting of SEQ ID NO: 15 or any functional variant thereof having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to SEQ ID NO: 15.More preferably, the term "variant" or “functional variant” refers to a polypeptide having an amino acid sequence that differs from a native sequence by less than 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 25, 20, 15, 10 or 5 substitutions, insertions and / or deletions. In a preferred embodiment, the functional variant differs from the native sequence by one or more conservative substitutions, preferably by less than 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 25, 20, 15, 10 or 5 conservative substitutions.A number of different mammalians CEP290 are known including, but being not limited to, human, pig, chimpanzee, dog, cow, mouse, rabbit or rat, and can be easily found in sequence databases. The coding sequence may be easily determined by the skilled person based on the polypeptide sequence.According to a specific embodiment of the present disclosure, a polynucleotide encoding the CEP290 as described above is split into two nucleic acid sequences encoding N- and C-terminal CEP290 fragments, each fragment being fused with at least N- and C-split inteins as described above to form a first and a second fusion proteins, respectively, in such a manner that following expression of said first and second fusion proteins, a protein splicing reaction can occur in a cell and induces the excision of the N and C-split intein sequences and the ligation of CEP290 fragment flanking sequences (N- and C-terminal CEP290 fragments, also named N- and C- exteins) with a peptide bond to reconstitute the full-length of CEP290 protein as described above in a cell.According to the present disclosure, the CEP290 or any functional variant thereof as described above can be split at any positions into a N- and C-terminal CEP290 fragments. However, the inventors have shown that some specific split positions are particularly advantageous to increase the efficiency of CEP290 reconstitution. In particular, the CEP290 or any functional variant thereof as described above can be split into N- and C-terminal CEP290 fragments at the split position between amino acids 1174-1175, 1193-1194, and 1212-1213, wherein said residue is numbered according to SEQ ID NO: 15. It will be easy for a person skilled in the art to determine the split positions in CEP290 isoforms or Centrosomal protein 290 functional variants of Centrosomal protein 290, in particular by sequence alignment.In a preferred embodiment, the N-terminal fragment of CEP290 ends up to residue 1174 and the C-terminal fragment of CEP290 starts from residue 1175 respectively wherein said residue is numbered according to SEQ ID NO: 15.In another preferred embodiment, the N-terminal fragment of CEP290 ends up to residue 1193 and the C-terminal fragment of CEP290starts from residue 1194 respectively wherein said residue is numbered according to SEQ ID NO: 15.In another preferred embodiment, the N-terminal fragment of CEP290 fragment ends up to residue 1212 and the C-terminal fragment of CEP290 starts from residue 1213 respectively wherein said residue is numbered according to SEQ ID NO: 15.In a particular embodiment, the first and second fusion proteins according to the present disclosure comprise a N-terminal CEP290 fragment and a C-terminal CEP290 fragment respectively comprising or consisting of amino acid sequences selected from the Table 3, preferably from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%,90%, 95%, 98%, 99% sequence identity to any one of SEQ ID NO: 16 to 21 and preferably wherein reconstituted functional variant of CEP290 retains the function of said native CEP290, in particular ciliogenesis activity. The function of CEP290 functional variant can be assessed for example by the capacity of said variant of correcting the ciliogenesis activity in CEP290 knock-out RPE cell lines as described in the examples 1.1.8 and 1.1.9.Table 3: Examples of N-and C-terminal CEP290 fragments amino acid sequences wherein X can be a serine, a cysteine or a threonine. Highlighted amino acids in Full-length CEP290 represent preferred split positions. The first methionine of the CEP290 and N-terminal fragment sequences is indicated in the sequences listed in table 3. The first methionine can be maintained or removed in certain embodiments.During protein trans-splicing of two split-intein flanked polypeptides, the N-extein (e.g., N- terminal fragment of CEP290 protein) is transferred to the side chain of the first amino acid of the C-extein (e.g., C-terminal fragment of CEP290 protein). To facilitate trans-splicing, the first amino acid of the C-extein can be a cysteine (Cys+1), a serine (Ser+1) or a threonine (Thr+1) depending on the intein.In a specific embodiment, the first amino acid of the C-terminal fragment of CEP290 protein is selected from the group consisting of: cysteine, serine and threonine.The preferred nature of the first amino acid that facilitates trans-splicing depending on the intein can be found for example in Supplementary Table 2 of Pinto F. et al. Nat Commun. 2020 Mar23; 11(1): 1529 and a person skilled in the art would know which amino acid can preferably replace the first amino acid of the C-terminal fragment of CEP290 protein.In a particular embodiment, the split position can be specifically chosen to obtain a C-terminal fragment of CEP290 protein that naturally comprises a first amino acid that facilitates transsplicing, or if necessary, the first amino acid of the C-terminal fragment of CEP290 can be replaced by an amino acid that facilitates trans-splicing. In a particular embodiment, the first amino acid of the C-terminal fragment of CEP290 protein can be replaced by a conservative substitution that facilitates trans-splicing and maintains the function of CEP290 protein. Examples of conservative substitutions are within the groups of hydroxyl or sulfur / selenium- containing amino acids (serine, cysteine, threonine, methionine).In a specific embodiment, when the intein is Npu DnaE intein or derived protein from Npu DnaE intein such as Cfa intein, the first amino acid of the C-extein (e.g., C-terminal fragment of CEP290 protein) is preferably a cysteine.In another specific embodiment, when the intein is Nrdj l or Gp41 intein, the first amino acid of the C-extein (e.g., C-terminal fragment of CEP290 protein) is preferably a serine.In a particular embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15,1 preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21.In a more particular embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Cfa-C-split intein of SEQ ID NO: 2 or Cfa Cmut-split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, more preferably wherein the first amino acid of the C-terminal fragment of CEP290 is a cysteine.In another more particular embodiment, the combination of polynucleotides according to the present disclosure comprises:a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1 N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Nrdj 1 -C-split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, and more preferably wherein the first amino acid of the C-terminal fragment of CEP290 is a serine.In a more preferred embodiment, the combination of polynucleotides according to the present disclosure comprises polynucleotides encoding a first fusion protein and a second fusion protein comprising amino acid sequences selected from the pairs disclosed in Table 4, preferably selected from the pairs consisting of: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33, or any functional variant thereof, preferably having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 22-33.Table 4: Preferred first and second protein fusions according to the present disclosure.Cfa or Nrdj-N-Split intein and Cfa or Nrdj-C-mut-split inteins sequences are indicated in bold. The first amino acid of c-extein is underlined (cysteine and serine when C-extein is fused with Cfacmut intein and Nrdj 1 intein, respectively). In certain embodiments, the first methionine of the fusion proteins is indicated and can be maintained or removed.To prevent the accumulation of undesired starting materials and to eliminate the excised intein fragments, a degron can be fused directly or indirectly via a linker to the first and / or second fusion proteins to mediate degradation of the excised intein.A “protein degradation signal” or “degron” refers to a peptide fragment that induces degradation of the protein that contains the fragment. Protein degradation can happen through any of the many known protein degradation pathways, including but not limited to, ubiquitination, lysosomal degradation or autophagy. In a preferred embodiment, the degron targets protein to the ubiquitin-proteasome pathway. In a more preferred embodiment, the degron according to the present disclosure comprises amino acid sequence having less than 200, 190, 180, 170, 150, 130, 125, 110, 100, 95, 90, 85, 80 or 75 amino acids.In a particular embodiment, said degron is fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and second fusion proteins, respectively, preferably said degron is located at the 3’-end of the N-Split intein or at the 5’end of the C-split intein.In a particular embodiment, said degron is fused, directly or indirectly via a linker, to the N- split intein and C-split intein comprised in the first and second fusion proteins, respectively, preferably said degron is located at the 3’-end of the N-Split intein and at the 5’end of the C- split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein said first or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein or at the 5’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein said first and second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and at the 5’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ a Cfa-c-Split intein of SEQ ID NO: 2 or a Cfa Cmut-split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, and wherein said first or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein or at the 5’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa N-split intein of SEQ ID NO: 1 or anyfunctional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ a Cfa-C-Split intein of SEQ ID NO: 2 or a Cfa -Cmut-split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, and wherein said first and second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and at the 5’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1 N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ a Nrdj 1 -C-Split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, and wherein said first or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein or at the 5’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1 N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, anda second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ a Nrdj 1 -C-Split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, and wherein said first and second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and at the 5’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, and wherein said first or second fusion protein further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and secondfusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein or at the 5 ’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively; wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21 and wherein said first and second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and at the 5’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa-N-split intein of SEQ ID NO: 1 or anyfunctional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Cfa-C-split intein of SEQ ID NO: 2 or a Cfa-Cmut-split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively; wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, more preferably wherein the first amino acid of C-terminal CEP290 fragment is a cysteine and wherein said first or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein or at the 5 ’end of the C-split intein.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, anda second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Cfa-C-split intein of SEQ ID NO: 2 or a Cfa-Cmut-split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively; wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, preferably wherein the first amino acid of C- terminal CEP290 fragment is a cysteine and wherein said first and second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and at the 5’end of the C-split intein.In a particular embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1 -N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Nrdj 1 -C-Split intein of SEQ ID NO: 12 or any functional variant thereof having at least70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively; wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, preferably wherein the first amino acid of C- terminal CEP290 fragment is a serine and wherein said first or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein or at the 5 ’end of the C-split intein.In a particular embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1 N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Nrdj 1 -C-Split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively; wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, preferably wherein the first amino acid of C- terminal CEP290 fragment is a serine and wherein said first and second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and at the 5’end of the C-split intein.In a more particular embodiment, the combination of polynucleotides according to the present disclosure encode a first fusion protein and a second fusion protein comprising amino acid sequences selected from the pairs consisting of: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33; or any functional variant thereof, preferably having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 22-33 and wherein said first or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein or at the 5’end of the C-split intein.In a more particular embodiment, the combination of polynucleotides according to the present disclosure encode a first fusion protein and a second fusion protein comprising amino acid sequences selected from the pairs consisting of: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33; or any functional variant thereof, preferably having at least 70, 75, 80, 85, 90, 95,98 or 99% identity to any one of sequences SEQ ID NO: 22-33 and wherein said first and second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and at the 5 ’end of the C-split intein.According to the present disclosure, said degron can be selected as non-limiting examples in the degrons listed in Table 5 below.Table 5: Examples of degrons and corresponding sequences.In a preferred embodiment, the degron comprised in the first and / or second fusion protein according to the present disclosure can be selected from the group consisting of: CL1 (SDD1) (SEQ ID NO: 34), Degl (SEQ ID NO: 35), PEST (SEQ ID NO: 36), DD1 (SEQ ID NO: 37), DD2 (SEQ ID NO: 38), DD3 (SEQ ID NO: 39), Ml (SEQ ID NO: 40), M2 (SEQ ID NO: 41), SopE (SEQ ID NO: 42), SopEl-78 (SEQ ID NO: 43), SopE 15-78 (SEQ ID NO: 44), SopE- 15-50 (SEQ ID NO: 45), L2 (SEQ ID NO: 46), L6 (SEQ ID NO: 47), L9 (SEQ ID NO: 48), LIO (SEQ ID NO: 49), Lil (SEQ ID NO: 50), L12 (SEQ ID NO: 51), L15 (SEQ ID NO: 52), L16 (SEQ ID NO: 53), M3 (SEQ ID NO: 54), M4 (SEQ ID NO: 55), M5 (SEQ ID NO:56), V12 (SEQ ID NO: 57), DD4 (SEQ ID NO: 58), DD5 (SEQ ID NO: 59), DD6 (SEQ ID NO: 60), DD7 (SEQ ID NO: 61), T1 (SEQ ID NO: 62), T2 (SEQ ID NO: 63), T3 (SEQ ID NO: 64), and DegVl (SEQ IDI NO: 82), preferably DD1, DD3, PEST, SopE, V12, M4, L2, L9, more preferably SopE, L2, L9, M4 or VI 2 or any functional variant thereof that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), and also induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290) preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64.In a specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker,wherein said first or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and / or at the 5’end of the C-split intein, and wherein the degron comprised in the first and / or second fusion protein according to the present disclosure is selected from the group consisting of SEQ ID NO: 34-64 and SEQ ID NO: 82, preferably SEQ ID NO: 34, 36, 39, 42, 46, 48, 55 and 57, more preferably SEQ ID NO: 42, 46, 48, 55 or 57 or any functional variant thereof (e.g., that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), and also induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290 protein), preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa-N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ a Cfa-C-split intein of SEQ ID NO: 2 or a Cfa-Cmut-split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein said first and / or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and / or at the 5’end of the C-split intein, and wherein the degron comprised in the first and / or second fusion protein according to the present disclosure is selected from the group consisting of: SEQ ID NO: 34-64 and SEQ ID NO: 82, preferably SEQ ID NO: 34, 36, 39, 42, 46, 48, 55 and 57, more preferably SEQ ID NO: 42, 46, 48, 55 or 57 or any functional variant thereof (e.g., that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), andalso induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290 protein), preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1-N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ a Nrdj 1 -C-Split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein said first and / or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and / or at the 5 ’end of the C-split intein, and wherein the degron comprised in the first and / or second fusion protein according to the present disclosure is selected from the group consisting of: SEQ ID NO: 34-64 and SEQ ID NO: 82, preferably SEQ ID NO: 34, 36, 39, 42, 46, 48, 55 and 57, more preferably SEQ ID NO: 42, 46, 48, 55 or 57 or any functional variant thereof (e.g., that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), and also induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290 protein), preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the combination of polynucleotides according to the present disclosure comprises:a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, and wherein said first and / or second fusion protein further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3’-end of the N-Split intein and / or at the 5’end of the C- split intein, and wherein the degron comprised in the first and / or second fusion protein according to the present disclosure is selected from the group consisting of: SEQ ID NO: 34-64 and SEQ ID NO: 82, preferably SEQ ID NO: 34, 36, 39, 42, 46, 48, 55 and 57, more preferably SEQ ID NO: 42, 46, 48, 55 or 57 or any functional variant thereof (e.g., that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), and also induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290 protein), preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Cfa-c-Split intein of SEQ ID NO: 2 or a Cfa Cmut-split intein of SEQ ID NO: 13 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, more preferably wherein the first amino acid of the C-terminal fragment of CEP290 is a cysteine and wherein said first and / or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3’-end of the N-Split intein and / or at the 5’end of the C- split intein, and wherein the degron comprised in the first and / or second fusion protein according to the present disclosure is selected from the group consisting of: SEQ ID NO: 34-64 and SEQ ID NO: 82, preferably SEQ ID NO: 34, 36, 39, 42, 46, 48, 55 and 57, more preferably SEQ ID NO:42, 46, 48, 55 or 57 or any functional variant thereof (e.g., that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), and also induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290 protein), preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the combination of polynucleotides according to the present disclosure comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1-N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Nrdj 1 -C-Split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively; or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19 and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NO: 16 to 21, more preferably wherein the first amino acid of the C-terminal fragment of CEP290 is a serine and wherein said first and / or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, morepreferably said degron is located at the 3’-end of the N-Split intein and / or at the 5’end of the C- split intein, and wherein the degron comprised in the first and / or second fusion protein according to the present disclosure is selected from the group consisting of: SEQ ID NO: 34-64 and SEQ ID NO: 82, preferably SEQ ID NO: 34, 36, 39, 42, 46, 48, 55 and 57, more preferably SEQ ID NO: 42, 46, 48, 55 or 57 or any functional variant thereof (e.g., that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), and also induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290 protein), preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the combination of polynucleotides according to the present disclosure encode a first fusion protein and a second fusion protein comprising amino acid sequences selected from the pairs consisting of: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33; or any functional variant thereof, preferably having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 22-33 and wherein said first and / or second fusion proteins further comprises a degron, preferably fused directly or indirectly via a linker to the N-split intein or C-split intein comprised in the first and / or second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and / or at the 5’end of the C-split intein, and wherein the degron comprised in the first and / or second fusion protein according to the present disclosure is selected from the group consisting of: SEQ ID NO: 34-64 and SEQ ID NO: 82, preferably SEQ ID NO: 34, 36, 39, 42, 46, 48, 55 and 57, more preferably SEQ ID NO: 42, 46, 48, 55 or 57 or any functional variant thereof (e.g., that induces degradation of the fusion protein comprising the protein of interest, the intein and the degron (i.e., starting material), and also induces degradation of the excised intein fused to the degron, preferably while maintaining the reconstitution of the protein of interest (i.e., CEP290 protein), preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID Nos: 34 to 64 and SEQ ID NO: 82.The functional variant of the degron as described above induces degradation of the excised intein that is fused to the degron, and also of the starting material fusion protein comprising theprotein of interest, the intein and the degron and preferably does not interfere with the reconstitution of the protein of interest (i.e., CEP290 protein).The degradation of the starting material consisting of the fusion protein comprising the protein of interest, the intein and the degron and the degradation of the excised intein that is fused to the degron can be tested according to Example 3 of WO2021181447, in particularly said degron is fused to a first fusion protein comprising a N-Split intein and a N-terminal fragment of a protein, said degron being fused to the 3’ end of N-Split intein and / or to a second fusion protein comprising a C-Split intein and a C-terminal fragment of a protein, said degron being fused to the 5 ’-end of the C-Split intein of a protein. The polynucleotides encoding said first and second protein is transfected in a cell, and the amount of starting material and excised intein is determined for example by Western blot. The degron induces degradation of starting material (i.e., the fusion protein comprising the protein of interest, the intein and the degron) and excised intein(s) when the amount of the starting material and excised intein is lower than the starting material and excised intein amount in a cell transfected with fusion proteins without degrons, preferably when the amount of intein is at least 1.2, 1.3, 1.4, 1.5, 1.8 or 2.0 fold lower than the starting material and intein amount in a cell transfected with fusion proteins without degrons. The expression level of reconstituted protein may be determined by any suitable methods known by skilled persons. The quantity of the reconstituted protein may be measured, for example, by semi-quantitative Western blots, enzyme-labelled and mediated immunoassays, such as ELISAs, biotin / avidin type assays, radioimmunoassay, immunoelectrophoresis, mass spectrometry, or immunoprecipitation or by protein or antibody arrays.In some embodiments, each first and second polynucleotides according to the present disclosure encoding the first and second fusion proteins, respectively, as described above may be a nucleic acid construct.In a particular embodiment said first and second polynucleotides may be an optimized sequence encoding the first and second fusion proteins. The term "codon optimized" means that a codon that expresses a bias for human (i.e. is common in human genes but uncommon in other mammalian genes or non-mammalian genes) is changed to a synonymous codon (a codon that codes for the same amino acid) that does not express a bias for human. Thus, the change in codon does not result in any amino acid change in the encoded protein.The term “nucleic acid construct” as used herein refers to a man-made nucleic acid molecule resulting from the use of recombinant DNA technology. A nucleic acid construct is a nucleicacid molecule, either single- or double-stranded, which has been modified to contain segments of nucleic acids sequences, which are combined and juxtaposed in a manner, which would not otherwise exist in nature. A nucleic acid construct usually is a “vector”, i.e., a nucleic acid molecule which is used to deliver exogenously created DNA into a host cell.Said nucleic acid construct comprises one or more control sequence required for expression of said coding sequence. Generally, the nucleic acid construct comprises a coding sequence and regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence that are required for expression of the selected gene product. Thus, a nucleic acid construct typically comprises a promoter sequence, a coding sequence and a 3' untranslated region that usually contains a polyadenylation site and / or transcription terminator. In a preferred embodiment, said polyadenylation site is a bovine growth hormone polyadenylation signal (bGH), SV401atepA, SV40flpA and / or a synthetic polyadenylation signal (SynpA), preferably bovine growth hormone polyadenylation signal (bGH) or a synthetic polyadenylation signal (SynpA)Nucleic acid construct may also comprise additional regulatory elements such as, for example, enhancer sequences, a polylinker sequence facilitating the insertion of a DNA fragment within a vector and / or splicing signal sequences.According to a preferred embodiment, said nucleic acid construct may comprise a SV40 intron.In one embodiment, the polynucleotide or nucleic acid construct according to the present disclosure comprises a promoter. Said promoter initiates transgene expression upon introduction into a host cell.In a preferred embodiment, the promoter according to the present disclosure can be selected from the group consisting of Cytomegalovirus (CMV) promoter, chimeric reduced version of the CMV and chicken beta-actin (CEBA) promoter, human phosphoglycerate kinase (hPGK) promoter, chimeric CMV enhanced and human phosphoglycerate kinase (ePGK) promoter, photoreceptor-specific, human rhodopsin kinase (hGRKl) promoter, rod specific IRBP promoter, cone specific human cone arrestin (hCAR) promoter, VMD2 (vitelliform macular dystrophy / Best disease) promoter, and EFl alpha promoter, preferably human rhodopsin kinase (hGRKl) promoter. However, any suitable promoter known in art may be used.As used herein, the term "promoter" refers to a regulatory element that directs the transcription of a nucleic acid to which it is operably linked. A promoter can regulate both rate and efficiencyof transcription of an operably linked nucleic acid. A promoter may also be operably linked to other regulatory elements which enhance ("enhancers") or repress ("repressors") promoterdependent transcription of a nucleic acid. These regulatory elements include, without limitation, transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter, including e.g., attenuators, enhancers, and silencers. The promoter is located near the transcription start site of the gene or coding sequence to which it is operably linked, on the same strand and upstream of the DNA sequence (towards the 5' region of the sense strand). A promoter can be about 100-3000 base pairs long. Positions in a promoter are designated relative to the transcriptional start site for a particular gene (i.e., positions upstream are negative numbers counting back from -1, for example -100 is a position 100 base pairs upstream).As used herein, the term “operably linked” refers to a linkage of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically but not necessarily contiguous; where it is necessary to join two protein encoding regions, they are contiguous and in reading frame.In a preferred embodiment, each polynucleotide or nucleic acid construct according to the present disclosure may be comprised in an expression vector.As used herein, the term "expression vector" refers to a nucleic acid molecule used as a vehicle to transfer genetic material, and in particular to deliver a nucleic acid into a host cell, either in vitro or in vivo. Expression vector also refers to a nucleic acid molecule capable of effecting expression of a gene (transgene) in host cells or host organisms compatible with such sequences. Expression vectors typically include at least suitable transcription regulatory sequences and optionally 3 ’-transcription termination signals.Additional factors necessary or helpful in effecting expression may also be present, such as expression enhancer elements able to respond to a precise inductive signal (endogenous or chimeric transcription factors) or specific for certain cells, organs or tissues. Vectors include, but are not limited to, plasmids, phasmids, cosmids, transposable elements, viruses, and artificial chromosomes (e.g., YACs).Preferably, the vectors of the disclosure are vectors suitable for use in gene or cell therapy, and in particular is suitable to target retinal or hair cells.In some embodiments, the expression vector is a viral vector, such as vectors derived from Moloney murine leukemia virus vectors (MoMLV), MSCV, SFFV, MPSV or SNV, lentiviral vectors (e.g. derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), adenoviral (Ad) vectors, adeno-associated viral (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papilloma virus vectors, Epstein-Barr virus, herpes virus vectors, vaccinia virus vectors, Harvey murine sarcoma virus vectors, murine mammary tumor virus vectors, Rous sarcoma virus vectors.As is known in the art, depending on the specific viral vector considered for use, suitable sequences should be introduced in the vector of the disclosure for obtaining a functional viral vector, such as AAV ITRs for an AAV vector, or LTRs for lentiviral vectors. In a particular embodiment, said vector is an AAV vector.AAV has arisen considerable interest as a potential vector for human gene therapy. Among the favorable properties of the virus are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that can be infected. The AAV genome is composed of a linear, single-stranded DNA molecule which contains 4681 bases (Berns and Bohenzky, 1987, Advances in Virus Research (Academic Press, Inc.) 32:243-307). The genome includes inverted terminal repeats (ITRs) at each end, which function in cis as origins of DNA replication and as packaging signals for the virus. The ITRs are approximately 145 bp in length. The internal non-repeated portion of the genome includes two large open reading frames, known as the AAV rep and cap genes, respectively. These genes code for the viral proteins involved in replication and packaging of the virion. In particular, at least four viral proteins are synthesized from the AAV rep gene, Rep 78, Rep 68, Rep 52 and Rep 40, named according to their apparent molecular weight. The AAV cap gene encodes at least three proteins, VP1, VP2 and VP3. For a detailed description of the AAV genome, see, e.g., Muzyczka, N. 1992 Current Topics in Microbiol, and Immunol. 158:97- 129.Thus, in one embodiment, the polynucleotides, nucleic acid constructs or expression vectors according to the present disclosure thereof further comprises a 5’ITR and a 3TTR sequences, preferably a 5’ITR and a 3’ ITR sequences of an adeno-associated virus.As used herein the term “inverted terminal repeat (ITR)” refers to a nucleotide sequence located at the 5’-end (5’ITR) and a nucleotide sequence located at the 3’-end (3’ITR) of a virus, that contain palindromic sequences and that can fold over to form T-shaped hairpin structures that function as primers during initiation of DNA replication. They are also needed for viral genome integration into the host genome; for the rescue from the host genome; and for the encapsidation of viral nucleic acid into mature virions. The ITRs are required in cis for the vector genome replication and its packaging into viral particles.In one embodiment, the polynucleotides, nucleic acid constructs or expression vectors comprising nucleic acid sequences encoding the first and second fusion proteins according to the present disclosure further comprises a 5’ITR and a 3’ITR of an AAV, preferably of a serotype AAV2.The polynucleotides, nucleic acid constructs or expression vectors comprising nucleic acid sequences encoding the first and second fusion proteins as described above may be packaged into a virus capsid to generate a "viral particle", also named “viral vector particle”. In a particular embodiment, the polynucleotides, nucleic acid constructs or expression vectors comprising nucleic acid sequences encoding the first and second fusion proteins according to the present disclosure is packaged into an AAV-derived capsids to generate an "adeno- associated viral particles" or "AAV particles". The present disclosure relates to viral particles comprising polynucleotides, nucleic acid constructs or expression vectors comprising nucleic acid sequences encoding the first and second fusion proteins according to the present disclosure and preferably comprising capsid proteins of adeno-associated virus.The construction of recombinant AAV viral particles is generally known in the art and has been described for instance in US 5,173,414 and US5,139,941; WO 92 / 01070, WO 93 / 03769, Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J. (1992) Current Opinion in Biotechnology 3:533- 539; Muzyczka, N. (1992) Current Topics in Microbiol, and Immunol. 158:97-129; and Kotin, R. M. (1994) Human Gene Therapy 5:793-801.Thus, in AAV viral particle according to the present disclosure, the polynucleotides, nucleic acid constructs or expression vectors comprising nucleic acid sequences encoding the first and second fusion proteins as described above including ITR(s) of a given AAV serotype can be packaged, for example, into: a) a viral particle constituted of capsid proteins derived from the same or different AAV serotype [e.g. AAV2 ITRs and AAV5 capsid proteins; AAV2 ITRs andAAV8 capsid proteins; AAV2 ITRs and Anc80 capsid proteins; AAV2 ITRs and AAV9 capsid proteins]; b) a mosaic viral particle constituted of a mixture of capsid proteins from different AAV serotypes or mutants [e.g. AAV2 ITRs with AAV1 and AAV5 capsid proteins]; c) a chimeric viral particle constituted of capsid proteins that have been truncated by domain swapping between different AAV serotypes or variants [e.g. AAV2 ITRs with AAV5 capsid proteins with AAV3 domains].The skilled person will appreciate that the AAV viral particle for use according to the present disclosure may comprise capsid proteins from any AAV serotype including AAV1, AAV2, AAV3 (including types 3 A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, synthetic AAV variants such as NP40, NP59, NP84 (Paulk et al. Mol then 2018.26(l):289-303), LK03 (Wang L et al. Mol Then 2015. 23(12): 1877-87), AAV3-ST (Vercauteren et al. Mol Then 2016.24(6): 1042-1049), Anc80 (Zinn E et al., Cell Rep. 2015;12(6): 1056-68), AAVrhlO and any other AAV serotype now known or later discovered.Thus, in a further aspect, the present disclosure relates to a viral particle comprising the polynucleotides, nucleic acid constructs or expression vectors comprising nucleic acid sequences encoding the first and second fusion proteins as described above and preferably comprising capsid proteins of adeno-associated virus such as capsid proteins from AAV9 and AAV-PHP.B, AAV2, AAV8 and AAV5.Therapeutic useAccording to the present disclosure, the combination of polynucleotides, nucleic acid constructs, expression vectors or viral particles comprising nucleic acid sequences encoding the first and second fusion proteins as described above is administered in a subject in need thereof for use in gene therapy, preferably for the treatment of CEP290-associated disease.As used herein, "gene therapy" refers to the administration of a gene-therapy vector to treat a disease caused by a change in the subject DNA sequence, in particular a disease caused by a mutation in at least one gene (i.e., genetic disease) such as CEP290 into a subject in need thereof.As used herein, the term "treatment", "treat" or "treating" refers to any act intended to improve the health status of patients such as therapy, prevention, prophylaxis and retardation of the disease. In certain embodiments, such term refers to the amelioration or eradication of a disease or symptoms associated with a disease. According to the present disclosure, examples ofsymptoms associated with CEP290-associated disease are symptoms associated with cilia defects, in particular vision and brain abnormalities.The term “subject” or “patient” as used herein, refers to mammals. Mammalian species that can benefit from the disclosed methods of treatment include, but are not limited to, humans, nonhuman primates such as apes, chimpanzees, monkeys, and orangutans, domesticated animals, including dogs and cats, as well as livestock such as horses, cattle, pigs, sheep, and goats, or other mammalian species including, without limitation, mice, rats, guinea pigs, rabbits, hamsters, and the like. In particular embodiment, said subject is a human patient.The combination of polynucleotides, nucleic acid constructs, expression vectors or viral particles comprising nucleic acid sequences encoding the first and second fusion proteins according to the present disclosure will be typically included in a pharmaceutical composition or medicament, optionally in combination with a pharmaceutical carrier, diluent and / or adjuvant. Such composition or medicinal product comprises the product of the disclosure in an effective amount, sufficient to provide a desired therapeutic effect, and a pharmaceutically acceptable carrier or excipient.As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency or recognized pharmacopeia such as European Pharmacopeia, for use in animals and / or humans. The term "excipient" refers to a diluent, adjuvant, carrier, or vehicle with which the therapeutic agent is administered. As is well known in the art, pharmaceutically acceptable excipients are relatively inert substances that facilitate the administration of a pharmacologically effective substance and can be supplied as liquid solutions or suspensions, as emulsions, or as solid forms suitable for dissolution or suspension in liquid prior to use. For example, an excipient can give form or consistency, or act as a diluent. Suitable excipients include but are not limited to stabilizing agents, wetting and emulsifying agents, salts for varying osmolality, encapsulating agents, pH buffering substances, and buffers.In one embodiment, the pharmaceutical composition is a parenteral pharmaceutical composition, including a composition suitable for intravenous, intraarterial, intramuscular, intranasal, intraocular, intravitreal, suprachoroidal or subretinal administration. These pharmaceutical compositions are exemplary only and do not limit the pharmaceutical compositions suitable for other parenteral and non-parenteral administration routes. The pharmaceutical compositions described herein can be packaged in single unit dosage or in multidosage forms.In particular, Leber congenital amaurosis symptom is severe visual impairment beginning near birth or shortly afterward, Bardet-Biedl syndromeCEP290 gene encodes a centrosomal protein that plays an important role in centrosome and cilia development. This gene is vital in the formation of the primary cilium, a small antennalike projections of the cell membrane that plays an important role in the photoreceptors at the back of the retina and in the kidney, brain, and many other organs of the body.Many variants in the CEP290 gene have been found to cause several diseases associated with abnormal cilia, also known as ciliopathies, such as Leber congenital amaurosis, Bardet-Biedl syndrome, Joubert syndrome, Meckel syndrome, and Senior-Loken syndrome.A ciliopathy is any genetic disorder that affects the cellular cilia or the cilia anchoring structures, the basal bodies, or ciliary function. Primary cilia are important in guiding the process of development, so abnormal ciliary function while an embryo is developing can lead to a set of malformations that can occur regardless of the particular genetic problem. The similarity of the clinical features of these developmental disorders means that they form a recognizable cluster of syndromes, loosely attributed to abnormal ciliary function and hence called ciliopathies.Leber congenital amaurosis is an eye disorder that primarily affects the retina, which is the specialized tissue at the back of the eye that detects light and color. People with this disorder typically have severe visual impairment beginning near birth or shortly afterward.Bardet-Biedl syndrome is a disorder that affects many parts of the body. The signs and symptoms of this condition vary among affected individuals, even among members of the same family. Obesity can be another characteristic feature of Bardet-Biedl syndrome. Other major signs and symptoms of Bardet-Biedl syndrome can include the presence of extra fingers or toes (polydactyly), intellectual disability or learning problems, and abnormalities of the genitalia. Additional features of Bardet-Biedl syndrome can include impaired speech, delayed development of motor skills such as standing and walking, behavioral problems such as emotional immaturity and inappropriate outbursts, and clumsiness or poor coordination.Joubert syndrome is a disorder that affects many parts of the body. The signs and symptoms of this condition vary among affected individuals, even among members of the same family. Most infants with Joubert syndrome have low muscle tone (hypotonia) in infancy, which contributes to difficulty coordinating movements (ataxia) in early childhood. Other characteristic features of the condition include episodes of unusually fast (hyperpnea) or slow (apnea) breathing ininfancy, and abnormal eye movements (ocular motor apraxia). Most affected individuals have delayed development and intellectual disability, which can range from mild to severe. Distinctive facial features can also occur in Joubert syndrome; these include a broad forehead, arched eyebrows, droopy eyelids (ptosis), widely spaced eyes (hypertelorism), low-set ears, and a triangle-shaped mouth.Meckel syndrome is a disorder with severe signs and symptoms that affect many parts of the body. The most common features are enlarged kidneys with numerous fluid-filled cysts; an occipital encephalocele, which is a sac-like protrusion of the brain through an opening at the back of the skull; and the presence of extra fingers and toes (polydactyly). Most affected individuals also have a buildup of scar tissue (fibrosis) in the liver.Senior-Loken syndrome is a rare disorder characterized by the combination of two specific features: a kidney condition called nephronophthisis and an eye condition known as Leber congenital amaurosis.In a more preferred embodiment, the present disclosure relates to the combination of polynucleotides, nucleic acid constructs, expression vectors or viral particles comprising nucleic acid sequences encoding the first and second fusion proteins as described above or pharmaceutical composition thereof for use in the treatment of a CEP290-associated disease, preferably CEP290- associated ciliopathy, more preferably selected from the group consisting of: Leber congenital amaurosis, Bardet-Biedl syndrome, Joubert syndrome, Meckel syndrome, and Senior-Loken syndrome, again more preferably Leber congenital amaurosis.The present disclosure also relates to the use of the combination of polynucleotides, nucleic acid constructs, expression vectors or viral particles comprising nucleic acid sequences encoding the first and second fusion proteins as described above or pharmaceutical composition thereof for the manufacture of a medicament for treating a CEP290 associated disease.The disclosure also provides a method for treating a CEP290-associated disease as described above in a patient in need thereof comprising administering to said patient a therapeutically effective amount of the polynucleotides, nucleic acid constructs, expression vectors or viral particles comprising nucleic acid sequences encoding the first and second fusion proteins as described above or pharmaceutical composition thereof.As used herein a "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary to achieve the desired therapeutic result. The therapeuticallyeffective amount of the products of the disclosure may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the product or pharmaceutical composition to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also typically one in which any toxic or detrimental effect of the product or pharmaceutical composition is outweighed by the therapeutically beneficial effects. According to the present disclosure, a therapeutically effective amount allows to reduce for example deafness, retinal degeneration and improve vestibular function.According to the present disclosure, said combination of polynucleotides can be administered into the subject in a single formulation or as separate formulations simultaneously, sequentially or separately. Such administration encompasses co-administration of the first and second polynucleotides in a substantially simultaneous manner, such as in a single formulation having a fixed ratio of the polynucleotides or in separate formulations for each polynucleotide. In addition, such administration also encompasses the use of each polynucleotide in a sequential or separate manner, either at approximately the same time or at different times. Regardless of whether the polynucleotides are administered as a single formulation or in separate formulations, the first and second polynucleotides are administered to the same subject as part of the same course of therapy. In any case, the treatment regimen will provide beneficial effects in treating the diseases described herein.In one embodiment, the combination of polynucleotides, nucleic acid constructs, expression vectors or viral particles comprising nucleic acid sequences encoding the first and second fusion proteins according to the present disclosure for its therapeutic use is administered to the subject or patient by a parenteral route, in particularly by intravenous, intraarterial, intramuscular, intranasal, intraocular, intravitreal, suprachoroidal or subretinal route.The amount of product of the disclosure that is administered to the subject or patient may vary depending on the particular circumstances of the individual subject or patient including, age, sex, and weight of the individual; the nature and stage of the disease, the aggressiveness of the disease; the route of administration; and / or concomitant medication that has been prescribed to the subject or patient. Dosage regimens may be adjusted to provide the optimum therapeutic response.For any particular subject, specific dosage regimens may be adjusted over time according to the individual needs and the professional judgment of the person administering or supervising the administration of the compositions. The dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected by medical practitioners.KitIn another aspect, the disclosure further relates to a kit, preferably for use in the treatment of CEP290-associated disease as described above, preferably CEP290- associated ciliopathy, more preferably selected from the group consisting of Leber congenital amaurosis, Bardet-Biedl syndrome, Joubert syndrome, Meckel syndrome, and Senior-Loken syndrome, again more preferably Leber congenital amaurosis, said kit comprising a combination of polynucleotides as described above, comprising: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, optionally wherein said first and / or second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3’-end of the N-Split intein and / or at the 5’end of the C-split intein, again more preferably selected from the group consisting of SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof that induces degradation of the protein that contains the fragment, preferably having at least at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the kit comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3 ’ : Cfa C-split intein of SEQ ID NO: 2 or Cfa Cmut-split intein of SEQ ID NO: 13 or anyfunctional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, and optionally wherein said first and / or second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3’-end of the N-Split intein and / or at the 5’end of the C-split intein, again more preferably selected from the group consisting of SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof that induces degradation of the protein that contains the fragment, preferably having at least at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the kit comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1 -N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’ : Nrdj 1 -C-split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, and optionally wherein said first and / or second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3’-end of the N-Split intein and / or at the 5’end of the C-split intein, again more preferably selected from the group consisting of SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof that induces degradation of the protein that contains the fragment, preferably having at least at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the kit comprises:a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein, N-split intein, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively, or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, and SEQ ID NO: 20 and 21, or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NOs: 16 to 21 and optionally wherein said first and / or second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3’-end of the N-Split intein and / or at the 5’end of the C- split intein, again more preferably selected from the group consisting of SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof that induces degradation of the protein that contains the fragment, preferably having at least at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the kit comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Cfa N-split intein of SEQ ID NO: 1 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 1, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Cfa C-split intein of SEQ ID NO: 2 or CfaCmut-split intein of SEQ ID NO: 13 or anyfunctional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 2 or 13 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively, or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, and SEQ ID NO: 20 and 21, or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NOs: 16 to 21, more preferably wherein the first amino acid of the C- terminal CEP290 fragment is a cysteine and optionally wherein said first and / or second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N- split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and / or at the 5 ’end of the C-split intein, again more preferably selected from the group consisting of SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof that induces degradation of the protein that contains the fragment, preferably having at least at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.In a more specific embodiment, the kit comprises: a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’: a N- terminal fragment of CEP290 protein and Nrdj 1 -N-split intein of SEQ ID NO: 11 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 11, fused directly or indirectly via a linker, and a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a Nrdj 1 -C-split intein of SEQ ID NO: 12 or any functional variant thereof having at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to SEQ ID NO: 12 and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker,wherein the first and second fusion proteins comprise:- the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively,- the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively, or- the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively, wherein said residue is numbered according to SEQ ID NO: 15, preferably the N-terminal CEP290 fragment and the C-terminal CEP290 fragment respectively comprise or consist of amino acid sequences selected from the pairs consisting of: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, and SEQ ID NO: 20 and 21, or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity to any one of sequences SEQ ID NOs: 16 to 21, more preferably wherein the first amino acid of the C- terminal CEP290 fragment is a serine and optionally wherein said first and / or second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N- split intein and / or C-split intein comprised in the first and second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and / or at the 5 ’end of the C-split intein, again more preferably selected from the group consisting of SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof that induces degradation of the protein that contains the fragment, preferably having at least at least 70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.In a more preferred embodiment, the kit comprises a combination of polynucleotides encoding a first fusion protein and a second fusion protein comprising amino acid sequences selected from the groups of pairs consisting of: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33, or any functional variant thereof, preferably having at least 80%, 85%, 90%, 95%, 98%, 99% identity to any one of sequences SEQ ID NO: 22-33, and optionally wherein said first and / or second fusion proteins further comprise a degron, preferably fused directly or indirectly via a linker to the N-split intein and / or C-split intein comprised in the first and / or second fusion proteins, respectively, more preferably said degron is located at the 3 ’-end of the N-Split intein and / or at the 5 ’end of the C-split intein, again more preferably selected from the group consisting of SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof that induces degradation of the protein that contains the fragment, preferably having at least at least70, 75, 80, 85, 90, 95, 98 or 99% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.The kit may include instructions or packaging materials that describe how to administer the polynucleotides contained within the kit to a patient.Containers of the kit can be of any suitable material, e.g., glass, plastic, metal, etc., and of any suitable size, shape, or configuration. In certain embodiments, the kits may include one or more ampoules or syringes that contain the products of the invention in a suitable liquid or solution form.The following examples are provided by way of illustration, and they are not intended to be limiting of the present invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.EXAMPLES1. Example 11.1 Materials and Methods1.1.1 Materials:Oligonucleotides were purchased from Eurofins genomics. Synthetic genes were purchased from GENEWIZ. Pfu Ultra fusion polymerase for cloning and all restriction enzymes were purchased from Thermo Fisher Scientific. High-competency cells used for cloning were generated from XLIO-Gold chemically competent E. coli. HEK293T and ARPE-19 cells were purchased from ATCC. DNA purification kits were purchased from Thermo Fisher Scientific. All plasmids were sequenced by Macrogen. Luria Bertani (LB) media, and all buffering salts were purchased from Thermo Fisher Scientific. Coomassie brilliant blue, NH4HCO3, DTT, formic acid, fetal bovine serum and asolectin from soybean were purchased from Sigma- Aldrich. Acetonitrile (ACN) was purchased from Carlo-Erba. EDTA-free complete protease inhibitors were purchased from Roche. Lipofectamine 2000 transfection reagent, DMEM high glucose GlutaMAX supplement, RPMI 1640 medium GlutaMAX supplement, RIPA lysis and extraction buffer, BCA protein assay kit, MES-SDS running buffer, pre-stained protein ladder and SDS-PAGE (Bis-tris and Tris-acetate gels) were purchased from Thermo Fisher Scientific. The primary antibodies used were anti-flag tag mouse monoclonal antibody (Sigma), anti- CEP290 rabbit polyclonal antibody (Alomone) and anti-tubulin rabbit polyclonal antibody (Thermo Fisher Scientific). The secondary goat anti-mouse IgG (H+L) highly cross-adsorbedAlexa fluor plus 488 antibody, secondary goat anti-rabbit IgG (H+L) antibody highly crossadsorbed Alexa fluor 633 antibody, and 4',6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI, D1306) were purchased from Thermo Fisher Scientific. Dodecyl maltoside (D310) and cholesteryl hemisuccinate (CH210) solution were purchased from Anatrace. Trypsin was purchased from Promega.1.1.2 Equipment:Gels and Western-blots were imaged with a LI-COR Odyssey Infrared Imager. Cell lysis was carried out using a SFX550 Branson sonicator.1.1.3 Cloning of Recombinant DNA Synthetic genes to prepare constructs CEP290-l-1193-CfaN-3FT (SEQ ID NO: 67), CEP290- 1194-2479-CfaCmut-3FT (SEQ ID NO: 68) were purchased and introduced into plasmid expression vectors using Kpnl and Notl restriction enzymes.Constructs CEP290-l-1174-CfaN-3FT (SEQ ID NO: 65), CEP290-1175-2279-CfaCmut-3FT (SEQ ID NO: 66), CEP290-l-1212-CfaN-3FT (SEQ ID NO: 69), CEP290- 1213-2479- CfaCmut-3FT (SEQ ID NO: 70), CEP290-l-1193-Nrdj l-N-3FT (SEQ ID NO: 73), CEP290- 1194-2479-Nrdj l-C-3FT (SEQ ID NO: 74), CEP290-l-1174-Nrdj l-N-3FT (SEQ ID NO: 71), CEP290-1175-2479-Nrdj l-C-3FT (SEQ ID NO: 72), CEP290-l-1212-Nrdj 1-N-3FT (SEQ ID NO: 75), CEP290-1213-2479-Nrdj 1-C-3FT (SEQ ID NO: 76), CEP290-3FT (SEQ ID NO: 77) were prepared by restriction enzymes free cloning. The identity of all recombinant plasmids was confirmed through sequencing and the corresponding protein sequences are reported in Table 6.Table 6: Protein sequences of constructs used in the examples. (1) Said residues are numbered according to SEQ ID NO: 15 (full-length CEP290)1.1.4 Transfection of intein plasmids in HEK293T cells: HEK293T cells were maintained in DMEM with 10% FBS and antibiotics at 37°C in a 5% CO2 atmosphere. Cells were co-transfected at around 80% confluence using Lipofectamine 2000 and 1 pg of each plasmid in 6-well plate format. For the experiments where the plasmid encoded the full-length gene was used, a scramble plasmid was co-transfected with the full-length plasmid to achieve the same amount of DNA transfected when two intein plasmid were used.Cells were harvested after 48 h post-transfection and levels of protein were analyzed by Western blot.1.1.5 Western blot analysis:CEP290 transfected cells (HEK293T) were lysed in 0,1% n-Dodecyl-P-D-Maltopyranoside (D310S) and 1% cholesteryl hemisuccinate (CH210) solution in 25 mM Tris-HCl pH=7.5 and 150 mM NaCl supplemented with protease inhibitors and 1 mM phenylmethyl sulfonyl. After lysis, CEP290 samples were quantified by BCA protein assay kit. Samples with 25 pg of total protein were denatured at 37°C for 5 minutes in IX Laemmli sample buffer containing 2.5 mg / ml of asolectin. Lysates were separated by 3-8% Tris-acetate SDS-PAGE gels for 1.5 h at 150V. The antibodies used for immuno-blotting were either anti-flag tag to detect the CEP290 protein and anti-P-tubulin as loading control. The quantification of CEP290 bands detected by Western blot was performed using LLCOR Odyssey Infrared Imager.1.1.6 CEP290 KO model generationFor the generation of ARPE-19 CEP290 Knockout (KO) cell line models, an ATUM NickaseNinja All-in-One construct (ATUM) was designed to target CEP290 gene through the CRISPR gene editing technology. The plasmid contains a Cas9N nickase mutant (Cas9-D10A) which causes single strand breaks by using 2 tandem gRNAs to further enhance specificity. Based on prediction scores from the CRISPR gRNA Design tool (ATUM), the selected tandem gRNAs were separated by 20nt and located within CEP290 exon 31 (NM_025114.4), thus targeting a sequence region present in all the CEP290 described transcript variants (gRNAs for Hs: 12:88,483,081-88,483,135). Finally, the construct also contained a reporter gene (GFP) for easy identification of transfected cells.ARPE-19 cells were transfected with the designed CEP290-targeted ATUM NickaseNinja All- in-One plasmid using Lipofectamine 2000, following the manufacturer’s instructions (Invitrogen). 48h post-transfection, GFP+cells were collected and individually seeded into 96- well plates with lOOpL DMEM / F12 complete media using a SORTER FUSION II (BD Biosciences) for clonal expansion.1.1.7 Clonal screeningA total of 67 ARPE-19 GFP+clones properly grew and expanded. Each clone was divided into 2 wells of a 6-well plate: one well was collected with PBS IX and pelleted for protein extraction, whereas the other well was collected using Trypsin and frozen in 500pL freezing media (FBSwith 10% DMSO) for liquid N2 long storage. Pelleted cells were lysed using SpliceBio Lysis Buffer (lOpL / mL D310-CH210, ImM PMSF and IX PI Complete, in PBS1X) and sonicated, and clonal screening was performed by WB using 1 : 1000 anti-CEP290 (ab85728, Abeam). No CEP290 expression was detected in hTERT RPE-1 R15 clone and in 5 different ARPE-19 clones (ARI 7, AR21, AR27, AR45 and AR65). In order to confirm the induced DNA mutations in CEP290, gDNA extraction was performed for the 5 clones from a total of l,5xl06cells using PureLink Genomic DNAMini Kit (Invitrogen) and following manufacturer’s instructions. Then, PCR amplification and Sanger sequencing of CEP290 exon 31 was carried out using flanking primers to genotype the CRISPR editing region (5’ GCACAGTCTGATGAAAAGTCG 3’ (SEQ ID NO: 80) and 5’ CCTTTGGTATCCTTTAAAGTGCT 3’ (SEQ ID NO: 81)).1.1.8 Cilia formation assayCilia formation assays were performed in clones R15 (hTERT RPE-1 (GM)) and ARI 7, AR21, AR27, AR45 and AR65 clones together with hTERT RPE-1 and ARPE-19 cells as positive control, to study the reduction of ciliogenesis in the KO models. For this purpose, 105cells per well from each cell line were seeded and cultured in 12-well plate over a glass coverslip for 24h with DMEM / F12 complete media, followed by a serum starvation incubation with DMEM / F12 without FBS for 48h to induce ciliogenesis. Then, immunocytochemistry (ICC) assays were performed to immunolabel cilia to determine the percentage of ciliated cells. Briefly, cells were rinsed twice with PBS IX, fixed 15min with 4% PFA (Sigma), washed 3x5min with PBS IX and then incubated Ih at RT in Blocking Buffer (PBS IX, 2% BSA, 0.1 % Triton-X-100). Primary and secondary antibodies were incubated 2h and Ih, respectively, both at room temperature (RT) in Blocking Buffer. Anti-PCNT (ab28144, Abeam) was used at 1 : 1000 to immunolabel the basal body of cilia, and anti-ARL13B (17711-1-AP, Proteintech) at 1 : 100 marked the cilia body. Secondary antibodies of use were 1 : 1000 Goat anti -Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 (A-11001, Invitrogen) and 1 : 1000 Goat anti -Rabbit IgG (H+L) Highly Cross- Adsorbed Secondary Antibody, Alexa Fluor™ 633 (A-21071, Invitrogen). Washes with PBS IX (3x5min) were performed before and after incubation with secondary antibodies, then an incubation with 1 :2000 DAPI (0.5 pg / ml) (Thermo Fisher Scientific) in PBS IX was performed for 15min. Finally, coverslips were carefully removed from the wells with the help of thin tweezers and mounted using ProLong™ Glass Antifade Mountant (Invitrogen), placing the coverslip on top of the slides with the cells facing down. After an over-night curation, slides were analyzed using a Leica Thunder 3D Live Cell microscope. Images were processed using Fiji Imaged software for manual cell counting.Cells presenting a discrete PCNT immunolabelling but with no visible cilia marked with ARL13B were considered as non-ciliated, whereas those that presented a clear cilia body were counted as ciliated cells. Data showed a high reduction of ciliated cells for all clones, being AR45 and AR65 the most affected clones, thus further used for in vitro functional studies.1.1.9 Ciliogenesis recovery assaySimilarly, ciliogenesis recovery was assessed using ARPE-19 CEP290 KO clones AR45 and AR65 by transfecting CEP290 expressing plasmids and performing ICC for cilia immunodetection. CEP290 FLAG-tagged constructs contained either the full-length sequence orN-terminal and C-terminal splitted sequences at amino-acid site 1174-1175 or 1212-1213 for protein trans-splicing. In brief, 24h after seeding cells in DMEM7 / F12 media with 10% FBS, transfection of CEP290 vectors was performed using PEI (Img / mL) and 500ng total DNA, at a 1 :3 ratio (pg DNA : pg PEI). After 4h of incubation, media was changed with fresh warm DMEM / F12 complete media and incubated over-night at 37°C and 5% CO2. 24h posttransfection, cells were washed with PBS1X and fresh warm DMEM / F12 media without FBS was added to induce cilia formation through serum starvation for 48h. Then, cells were fixed in 4% formaldehyde for 15 min at room temperature, washed, and ICC was performed following the same protocol as described for the cilia formation assay, except with different primary antibodies: ANTI-FLAG® M2 antibody (F1804-200UG, Sigma- Aldrich) at 1 : 1000 was used to immunolabel exogenous CEP290 expression, and anti-ARL13B (17711-1-AP, Proteintech) at 1 : 100 for cilia body detection. In this case, four different immunolabelled cell populations were manually counted using Fiji Imaged software, either presenting: i) discrete ARL13B immunolabelling but with no visible cilia and no M2-specific detection (non-ciliated, no CEP290); ii) clear ARL13B cilium (ciliated, no CEP290); iii) discrete ARL13B immunolabelling and M2-specific detection (non-ciliated, CEP290); iv) clear ARL13B cilium and M2-specific detection (ciliated, CEP290).1.2.Results and discussionIn the last years several new inteins have been engineered based on consensus design (Stevens et al., 2016; Stevens, Sekar, Gramespacher, Cowburn, & Muir, 2018) and shown to have superior properties than naturally occurring inteins. One of these inteins, termed Cfa, have faster kinetics, higher expression levels and high tolerance to extreme conditions such as high temperature and concentration of denaturing agents. Interestingly, Cfa variants with degrees of homology from 90% or higher display similar properties. A major caveat to splicing-basedmethods is that all characterized inteins exhibit a sequence preference at extein residues adjacent to the splice site. Deviation from this preferred sequence context leads to a marked reduction in splicing activity, limiting the applicability of protein trans-splicing (PTS)-based methods. Recently engineered versions of naturally split inteins that possess greatly improved extein tolerance have been developed (Stevens et al., 2017). This intein is termed Cfamut.In order to demonstrate that Cfamut allow the reconstitution of proteins such as CEP290, via protein trans-splicing for gene therapy application, a study using different split sites was performed. CEP290 is a large protein, which is mutated in Leber congenital amaurosis. Reconstitution of CEP290 has been proposed as a viable strategy to treat the disease. Several approaches based on AAV gene therapy are currently being explored to reconstitute it. Due to its large size CEP290 gene cannot be encapsulated into a single AAV, and so different strategies have been proposed to reconstitute the function of this protein inside the target cells.1.2.1 Splicing efficiency of CEP290 protein at position 1174, 1193 and 1212Constructs were cloned and tested as shown above. Specifically, CEP290-(l-1174)-CfaN, CfaCmut- CEP290 (1175-2479) constructs were used to evaluate splicing CEP290 at position 1174 (SEQ ID NO: 65 and 66), CEP290 (l-1193)-CfaN and CfaCmut- CEP290( 1194-2479) to evaluate splitting CEP290 at position 1193 (SEQ ID NO: 67 and 68), and CEP290 (1-1212)- CfaN, CfaCmut-CEP290(1213-2479) and CEP290 (l-1212)-Nrdj 1-N, Nrdj l-C-CEP290(1213- 2479) constructs were used to evaluate splicing CEP290 at position 1212 (SEQ ID NO: 69 and 70). Sites were selected based on the topological structure of CEP290 and taking into consideration the presence of folded domains. Sites were selected outside of well-defined folded domains. Briefly, constructs were co-transfected into HEK293 cells as well as full-length CEP290 (SEQ ID NO: 77) was transfected to serve as control. Cells were lysed and protein reconstitution yields determined by Western Blot to compare the yields of reconstituted protein versus the full-length protein. Results show that the yield for these three sites are comparable to the protein obtained only with the full-length protein (Figure 1 and 2).1.2.3 Ciliogenesis assayKO ARPE-19 cells (clone AR45) were co-transfected with both intein fragments (CEP290-(l- 1174)-CfaN, CfaCmut- CEP290 (1175-2479)) with the transfection agent PEI. KO ARPE-19 cells (clone AR45) were transfected with a single plasmid encoding the full-length CEP290, as a control. Since the addition of the transfection agent PEI affects ciliogenesis, this agent was also included in the WT and KO untransfected controls.48h later, cells were analyzed by confocal microscopy using an antibody against cilia (ARL13B) and an antibody against the flag tag (M2) to detect CEP290. The % of cells with cilia were quantified (Figure 3). As shown in Figure 3, clear ARL13B cilia body and M2-specific detection is observed in KO ARPE-19 cells co-transfected with CEP290-(l-1174)-CfaN, and CfaCmut- CEP290 (1175-2479) constructs (KO-PTS-1174). Co-transfection CEP290-(l- 1174)-CfaN, and CfaCmut- CEP290 (1175-2479) constructs allows to induce ciliogenesis and increase the percentage of cells with cilia.In another experiment, ciliogenesis recovery was assessed using ARPE-19 CEP290 KO clones AR45 and AR65 by transfecting CEP290-expressing plasmids and performing ICC of cilia. KO clones were either co-transfected with plasmids expressing both CEP290 fragments with split inteins (CEP290-(l-1174)-CfaN, CfaCmut-CEP290(1175-2479), or transfected with a single plasmid expressing the full-length sequence as a control, using PEI as a transfection reagent. 48h later, cells were fixed and immunolabelled with anti-flag (M2) antibody to detect CEP290, and anti-ARL13B to detect cilia. Several replicas of the experiment were performed and are represented in Figure 4.As shown in Figure 4, co-transfection of CEP290-(l-l 174)-CfaN and CfaCmut-CEP290(1175- 2479) constructs induced ciliogenesis, significantly increasing the percentage of cells with cilia.In a separate experiment, the capacity of CEP290 fragments with split inteins to restore cilia was evaluated with CEP290-(l-1212)-CfaN, and CfaCmut-CEP290 (1213-2479). ARPE-19 CEP290 KO cells from clone AR45 were transfected using PEI as a transfection reagent, either with a single plasmid expressing the full-length CEP290 sequence (positive control), pUC (negative control), CEP290-(l-l 174)-CfaN, CfaCmut-CEP290(l 175-2479), CEP290-(l- 1212)-CfaN, CfaCmut-CEP290 (1213-2479), or co-transfected with CEP290-(l-l 174)-CfaN plus CfaCmut-CEP290(l 175-2479) or CEP290-(l-1212)-CfaN plus CfaCmut-CEP290(1213- 2479). 24h after transfection, media was changed to DMEM / F12 without FBS to promote ciliogenesis. 48h later, cells were fixed and immunolabelled with anti-flag (M2) antibody to detect CEP290, and anti-ARL13B to detect cilia.As shown in Figure 5, transfection with constructs expressing CEP290 fragments with split inteins was unable to restore cilia formation. Ciliogenesis was only restored through co- transfection of either CEP290-(l-1174)-CfaN and CfaCmut-CEP290(l 175-2479), or CEP290- (l-1212)-CfaN and CfaCmut-CEP290(1213-2479). Ciliogenesis recovery levels were similar in both co-transfection conditions.2. Example 2: In vivo expression and efficacy2.1 Materials & methods2.1.1 AnimalsAdult male and female C57BL / 6J (WT), Nr - (B6;129-NrltmlAsw / J) and Cep290rdl6 / rdl6,-Nrl / ~, (B6.Cg-Ce / ?290rrf76 / Boc;B6;129-NrltmlAsw / J) mice (Mus musculus) sourced from Jackson laboratories were used during in vivo studies. All procedures applied to mice were approved by the local institutional animal care and use committee and were conducted in accordance with the Association for Research in Vision and Ophthalmology’s (ARVO’s) Statement for the Use of Animals in Ophthalmic and Vision Research.2.1.2 Test article preparation and handlingCEP290 protein was split at position 1174 (CEP290 (1-1174)-CfaN and CfaCmut- CEP290( 1175-2479)) and the corresponding AAVs were produced and administered to mice as described below. AAV test article (TA) formulations were prepared fresh on the day of dosing and were kept on ice during procedures. Dosing solutions were formulated by diluting TAs with formulation buffer (balanced salt solution [BSS] and pluronic F68 0.001%) in a sterile hood using RNase / DNase-free pipette tips. TAs were diluted to achieve a dose within the range of IxlO9- 5xl09total viral genomes per eye in 1 pL.2.1.3 Subretinal injection procedureTAs were administered via subretinal injection to young adult mice, ranging 45-60 days of age for expression studies and 14-16 days for efficacy studies, at the time of injection. Animals were given buprenorphine 0.01-0.05 mg / kg subcutaneously (SQ), and a cocktail of 1.0% tropicamide HC1 and 2.5% phenylephrine HC1 (Tropi-Phen) topically to dilate and proptose the eyes. Mice were then anaesthetized for the surgical procedure with a ketamine / xylazine cocktail (80-90 / 10- 20 mg / kg) administered intraperitoneally (IP), and 1 drop of 0.5% proparacaine HC1 was applied onto the eyes. The cornea was kept moistened using topical eyewash (BSS), and body temperature was maintained using a heated surgical table and hot pads. A small pilot hole using the tip of a 30G beveled needle was done, and the SR injection was performed with a 34G needle attached to a 10 pL syringe. Following injection, animals underwent optical coherence tomography (OCT) imaging to confirm successful SR dosing. If the injection was deemed suboptimal or not successful, the animal was euthanized and replaced. Following the procedure,1 drop of ofloxacin or neomycin polymyxin B sulfates gramicidin ophthalmic solution was applied, followed by eye lubricant. Mice were given atipamezole intramuscularly (IM) to reverse the xylazine effects (0.1-1.0 mg / kg) and were then returned to their cage and allowed to recover normally.2.1.4 Full field electroretinography (ERG)ERGs were measured 1 and 2 months after subretinal injection. Animals were sedated with a ketamine / xylazine cocktail (40-50 / 5-10, mg / kg IP). Acocktail of 1% tropicamide HC1 and 2.5% phenylephrine hydrochloride was applied topically to dilate the eyes. Once complete pupil dilation was confirmed, animals were placed on ERG device (Diagnosys ERG system), 0.5% proparacaine and eye lubricant were applied to the eyes followed by placement of electrodes and reference leads. Specifically, a warm water blanket was placed under the animals to maintain body temperature, and contact lens leads were placed on the eyes. A reference subcutaneous lead was placed in the head and a ground lead was placed near the tail of the animal.Before ERGs are recorded, pupil dilatation will be checked to ensure full dilation. Animals will first be positioned on the ERG machine, then 0.5% proparacaine and eye lubricant will be applied to the eyes, followed by the electrode contact and reference leads. Animals will be placed on a warm water blanket to control body temperature and contact lens leads will be placed on the eyes. A reference subcutaneous lead will be placed in the head and a ground lead placed near the tail of the animal. Light adapted ERG recordings were performed at increasing light exposure intensities, in the range of 1-1000 cd s m'2, with constant 30 cd m'2white on white background light.2.1.5 Ocular tissue sample handling and processingAfter one to two months following subretinal injection, the animals were euthanized. Immediately following euthanasia, eyes designated for protein analysis by Western Blot were enucleated and placed into a 24 well dish containing ice-cold PBS. Under a dissecting scope, using forceps and curved scissors, all extraneous muscles and connective tissue were gently removed from the back of the eye. Using forceps, scissors, or a #11 blade, a hole was made in the margin between the cornea and sclera. Then, while pinching the cornea with forceps, curved scissors were used to gently cut away the cornea. The anterior segment components (cornea, lens) were discarded. The neurosensory retina (NSR) was gently detached from the RPE / choroid / sclera (RCS) and collected into a pre-weighed 1.5 mL nuclease-free tube. Theremaining RPE / choroid / sclera was then collected into a pre-weighed 1.5 mL nuclease-free tube. The tubes were immediately re-weighed and snap frozen in liquid nitrogen. Tubes were stored at approximately -80°C until further processing.Eyes designated for immunohistochemistry (IHC) were enucleated, the superior surface was marked with a tissue marker (silver Sharpie) on the scleral surface, a slit across the front of the cornea from limbus to limbus was made (ensuring no damage is caused to the ocular structures), and each globe was placed into 1.5 mL of freshly prepared 4% formaldehyde (FA) in IX PBS for 5 minutes at room temperature in separately labeled vials. The cornea and lens were dissected away, taking care not to damage the ciliary body, and the resulting eyecups were returned to the corresponding 4% FA vials for 10-12 minutes at RT. The eyecups were then transferred into 0.1M phosphate buffer (PB), washed for 5 minutes, and brought through a sequential sucrose gradient (10-30%, 1 hour each at 4°C, ensuring that the eyes sink to the bottom in each step of sucrose gradient). Eyes were kept in 30% sucrose overnight at 4°C. Eyes were placed into a separate cryostat mold with OCT embedding matrix and the tissue equilibrated for 5 minutes. Eyecup orientation within the mold was corrected as needed, and the mold was slowly frozen by placing the mold on a prechilled ceramic tile on dry ice. Eyes were embedded such that superior faced left and inferior faced right, with the ON pointing towards the person embedding. The block face was marked in the upper right comer to denote how the block should be oriented in the cryostat to achieve sagittal sections. Blocks were stored at -80°C until further processing.2.1.6 Western Blot analysis of ocular tissuesRetinal samples (NSR) were lysed in 0.1% sodium dodecyl sulfate (SDS), 1% Triton x-100, 5 mM EDTA, 2.5% glycerol, 50mM Tris-HCl pH=6.8 and 100 mM NaCl buffer solution supplemented with 1 mM phenylmethyl sulfonylfluoride. Samples were homogenized for 60 s using a plastic pellet and then incubated for Ih at 4°C. Lysates were centrifuged for 5 min at 13,000 g, 4°C. Supernatants were collected and transferred to the new tube. Protein concentration was quantified in supernatants by BCA method. 60 pg of total protein were denatured at 37°C for 10 min in IX Laemmli sample buffer containing 2.5 mg / ml of asolectin. Lysates were loaded in a 3-8% Tris-Acetate SDS-PAGE gel and separated for IhlO min at 150V. Proteins were transferred to a PVDF membrane for 16h, 5 V at 4°C using a wet transfer method. PVDF membranes were immunoblotted with following antibodies: anti-HA tag (C29F4, Cell Signaling) to detect the reconstituted CEP290 protein, and anti-P-tubulin (Thermo FisherScientific) as loading control. PVDF membranes were scanned on LI-COR Odyssey Infrared Imager and band intensities were quantified.2.1.7 Immunohistochemistry (IHC) and microscopy of ocular tissuesOCT-embedded tissue blocks were placed in a cryostat and oriented in a way to produce sagittal section of the eye globe. 12-16 pm thick sections were collected and placed on SuperFrost Plus™ Gold slides. Sections were then incubated with primary antibodies for 2h at RT followed by 16h at 4°C. The primary antibodies corresponded to rat anti -HA (3F10, Sigma) to detect the CEP290 protein expressed by the AAVs, and rabbit anti-CEP290 (Absource), to detect total CEP290 in the tissue (including endogenous CEP290). Then, sections were washed in PBS and incubated in secondary antibodies conjugated to fluorophores (donkey anti -rat IgG Alexa Fluor 488 and Goat anti-rabbit Alexa Fluor 568) for Ih at RT. Slides were subsequently washed, mounted and stored until microscopy analysis. Images were captured on a Leica Stellaris 8 confocal microscope.2.2 Results and discussionCEP290 protein was split at split position 1174 (CEP290 (1-1174)-CfaN and CfaCmut- CEP290 (1175-2479)) and the corresponding AAVs were produced. Both AAVs were injected subretinally into wild-type mice. After one month the animals were euthanized and protein reconstitution yields in retina were analyzed by Western blot (Figure 6).In another experiment, CEP290 protein was split at split position 1174 (CEP290 (1-1174)-CfaN and CfaCmut- CEP290(l 175-2479)) and several variants of AAVs containing different regulatory sequences were manufactured. Specifically, the different regulatory sequences included a miniSV40 SD / SA intron placed between the promoter and the Kozak sequence, and either synthetic or bovine growth hormone polyA sequences placed downstream from the coding sequence. In each case, AAVs expressing the N- and C- fragments were co-injected subretinally into wild-type mice. After one month, the animals were euthanized and protein reconstitution yields in retina were analyzed by Western blot using optimized transfer and detection techniques (Figure 7).All 4 combinations of AAVs (C2N-31+C2C-31 (GRK1 promoter-Kozak sequence- [CEP290 (l-1174)-CfaN or CfaCmut- CEP290(l 175-2479)]- bGH polyA), C2N-47+C2C-47 (GRK1 promoter-Kozak sequence- [CEP290 (1-1174)-CfaN or CfaCmut- CEP290( 1175-2479)]- bGH polyA), C2N-2+C2C-7 (GRK1 promoter-Kozak sequence- [CEP290 (l-1174)-CfaN orCfaCmut- CEP290(l 175-2479)]- synthetic poly A) and C2N-32+C2C-32 (GRK1 promoter- Mini Sv40 intron-Kozak sequence- [CEP290 (1-1174)-CfaN or CfaCmut- CEP290(1175- 2479)]- bGH poly A) produced CEP290 protein in the retina when injected in the subretinal space of mice (Figure 7). The combination showing the highest expression levels was C2N- 47+C2C-47.Retinal sections of mice treated with C2N-31+C2C-31 and C2N-47+C2C-47 were immunostained with antibodies to HA to detect localization of PTS CEP290, and to CEP290 to detect endogenous protein. HA immunolabelling was clearly detected in injected areas, and colocalized with CEP290 to the photoreceptor connecting cilia. Virtually all CEP290-positive cilia were also positive for HA staining, indicating that expression of reconstituted CEP290 was robust and localized correctly. In untreated areas, CEP290 immunolabelling was still detected in the cilia, whereas HA immunostaining was not observed. This was observed both in retinas treated with C2N-31+C2C31 (Figure 8).To determine the efficacy of CEP290 reconstituted by protein trans-splicing, corresponding AAVs were delivered into the subretinal space of Cep290Rdl6 / Rdl6;Nrl- / - mice. This mouse strain constitutes a relevant model of CEP290-associated retinal dystrophy. Light-adapted (photopic) ERGs were measured 1 and 2 months after injections. Results for two AAV candidates are shown in Figure 9, corresponding to C2N-32+C2C-32 and C2N-47+C2C-47. Mean amplitudes corresponding to a- (Figure 10, panel A) and b-waves (Figures 9 and 10, panel B) were plotted as bar graphs. Analysis of retinal function by ERG revealed a significant improvement of a- and b-wave amplitudes in mutant mice treated with vectors expressing CEP290. Specifically, mice treated with C2N-32+C2C-32 showed a clear trend in improvement of the b-wave amplitude compared to vehicle-treated mutant mice (Figure 9), whereas mice treated with C2N-47+C2C-47 showed significant improvements in a-wave and b-wave amplitudes (Figure 10).Overall, results demonstrate that the expression and reconstitution of CEP290 mediated by split inteins improves retinal function in a mouse model of CEP290-associated retinal dystrophy. This suggests that in vivo reconstitution of CEP290 by split inteins can successfully be used in the treatment of human subjects, when delivered by adeno associated virus vectors.

Claims

CLAIMS1. A combination of polynucleotides for use in the treatment of CEP290-associated disease in a subject in need thereof wherein the combination comprises:(i) a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’ : a N-terminal fragment of CEP290 protein or any functional variant thereof and N-split intein, fused directly or indirectly via a linker,(ii) a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein or any functional variant thereof, fused directly or indirectly via a linker, wherein expression of first and second polynucleotides in said subject generates CEP290 protein by protein splicing.

2. The combination for use according to claim 1 wherein the first and second fusion proteins comprise: the N-terminal fragment of CEP290 protein up to residue 1174 and the C- terminal fragment of CEP290 protein from residue 1175 respectively, the N-terminal fragment of CEP290 protein up to residue 1193 and the C- terminal fragment of CEP290 protein from residue 1194 respectively, the N-terminal fragment of CEP290 protein up to residue 1212 and the C- terminal fragment of CEP290 protein from residue 1213 respectively. wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the first and second fusion proteins comprises amino acid sequences selected from any one of the following pairs: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 90 % identity to any one of sequences SEQ ID NO: 16- 21.

3. The combination for use according to claim 1 or 2 wherein said CEP290 protein is human CEP290 protein, preferably comprising or consisting of SEQ ID NO: 15 or any functional variant thereof having at least 90% identity to SEQ ID NO: 15.

4. The combination of polynucleotides for use according to any one of claims 1 to 3 wherein the first amino acid of said C-terminal fragment of CEP290 protein is anamino acid that facilitates the trans-splicing activity, preferably selected from the group consisting of: cysteine, serine and threonine.

5. The combination of polynucleotides for use according to any one of claims 1 to 4 wherein said N-split intein is a N-Cfa-intein of SEQ ID NO: 1 or any functional variant thereof having at least 90% identity to SEQ ID NO: 1; and said C-split intein is a C-Cfa intein of SEQ ID NO: 2 or any functional variant thereof having at least 90% identity to SEQ ID NO: 2, preferably wherein amino acid residues 20 to 22 of SEQ ID NO: 2 are GEP, more preferably wherein said C-split intein is C-Cfamut intein of SEQ ID NO: 13 or any functional variant thereof having at least 90% identity to SEQ ID NO: 13 and preferably wherein said first amino acid of said C- terminal fragment of CEP290 protein is a cysteine.

6. The combination of polynucleotides for use according to any one of claims 1 to 3 wherein said N-split intein is a N-Nrdj 1 -intein of SEQ ID NO: 11 or any functional variant thereof having at least 90% identity to SEQ ID NO: 11; and said C-split intein is a C-Nrdj 1 intein of SEQ ID NO: 12 or any functional variant thereof having at least 90% identity to SEQ ID NO: 12, and preferably wherein said first amino acid of said C-terminal fragment of CEP290 protein is a serine.

7. The combination for use according to any one of claims 1 to 6 wherein the first and second fusion proteins comprise amino acid sequences selected from any one of the following pairs: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29, SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33 or any functional variant thereof, preferably having at least 90 % identity to any one of sequences SEQ ID NO: 22-33.

8. The combination for use according to any one of claims 1 to 7 wherein the first fusion protein and / or second fusion protein further comprises a degron, preferably wherein: i) the first fusion protein further comprises a degron located at the 3 ’end of the N-split-intein, and / or ii) the second fusion protein further comprises a degron located at 5 ’end of the C-split-intein.

9. The combination for use of claim 8 wherein said degron is selected from the group consisting of: SEQ ID NO: 34 to 64 and SEQ ID NO: 82 or any functional variant thereof having at least 90% identity to any one of sequences SEQ ID NO: 34 to 64 and SEQ ID NO: 82.

10. The combination for use according to any one of claims 1 to 9, wherein each polynucleotide further comprises a promoter selected from the group consisting of: Cytomegalovirus (CMV) promoter, chimeric reduced version of the CMV and chicken beta-actin (CEBA) promoter, human phosphoglycerate kinase (hPGK) promoter, chimeric CMV enhanced and human phosphoglycerate kinase (ePGK) promoter, photoreceptor-specific, human rhodopsin kinase (hGRKl) promoter, rod specific IRBP promoter, cone specific human cone arrestin (hCAR) promoter, VMD2 (vitelliform macular dystrophy / Best disease) promoter, and EFl alpha promoter.

11. The combination for use according to any one of claims 1 to 10, comprising expression vectors comprising polynucleotides as defined in claims 1 to lOpreferably wherein said expression vector is a viral vector, preferably an adeno associated viral (AAV) vector, more preferably said AAV vector comprises capsid protein of AAV selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 or rhlO.

12. The combination for use according to any one of claims 1 to 11 wherein said CEP290-associated disease is a CEP290-associated ciliopathy, preferably selected from the group consisting of: Leber congenital amaurosis, Bardet-Biedl syndrome, Joubert syndrome, Meckel syndrome, and Senior-Loken syndrome, more preferably wherein said combination is administered in subject by a parenteral route, more preferably by intravenous, intraarterial, intramuscular, intranasal, intraocular, intravitreal, suprachoroidal or subretinal route.

13. A kit comprising:- a first polynucleotide encoding a first fusion protein comprising from 5’ to 3’ : a N-terminal fragment of CEP290 protein and N-split intein, fused directly or indirectly via a linker,- a second polynucleotide encoding a second fusion protein comprising from 5’ to 3’: a C-split intein and a C-terminal fragment of CEP290 protein, fused directly or indirectly via a linker, wherein the first and second fusion proteins comprise: the N-terminal fragment of CEP290 protein up to residue 1174 and the C-terminal fragment of CEP290 protein from residue 1175 respectively, the N-terminal fragment of CEP290 protein up to residue 1193 and the C-terminal fragment of CEP290 protein from residue 1194 respectively, the N-terminal fragment of CEP290 protein up to residue 1212 and the C-terminal fragment of CEP290 protein from residue 1213 respectively. wherein said residue is numbered according to SEQ ID NO: 15, preferably wherein the first and second fusion proteins comprises amino acid sequences selected from any one of the following pairs: SEQ ID NO: 16 and 17, SEQ ID NO: 18 and 19, and SEQ ID NO: 20 and 21 or any functional variant thereof, preferably having at least 90 % identity to any one of sequences SEQ ID NO: 16- 21.

14. The kit of claim 13 wherein said N-split intein is a N-Cfa-intein of SEQ ID NO: 1 or any functional variant thereof having at least 90% identity to SEQ ID NO: 1; and said C-split intein is a C-Cfa intein of SEQ ID NO: 2 or any functional variant thereof having at least 90% identity to SEQ ID NO: 2, preferably wherein amino acid residues 20 to 22 of SEQ ID NO: 2 are GEP, more preferably wherein said C- split intein is C-Cfamut intein of SEQ ID NO: 13 or any functional variant thereof having at least 90% identity to SEQ ID NO: 13 and preferably wherein said first amino acid of said C-terminal fragment of CEP290 protein is a cysteine or wherein said N-split intein is a N-Nrdj 1 -intein of SEQ ID NO: 11 or any functional variant thereof having at least 90% identity to SEQ ID NO: 11; and said C-split intein is a C-Nrdj 1 intein of SEQ ID NO: 12 or any functional variant thereof having at least 90% identity to SEQ ID NO: 12, and preferably wherein said first amino acid of said C-terminal fragment of CEP290 protein is a serine.

15. The kit of claim 13 or 14 wherein the first and second fusion proteins comprises amino acid sequences selected from any one of the following pairs: SEQ ID NO: 22 and 23, SEQ ID NO: 24 and 25, SEQ ID NO: 26 and 27, SEQ ID NO: 28 and 29,SEQ ID NO: 30 and 31, and SEQ ID NO: 32 and 33, or any functional variant thereof, preferably having at least 90 % identity to any one of sequences SEQ ID NO: 22- 33.

Images