Tomato disease-resistant gene mutant, and use thereof in prevention and treatment of tobrfv

Abstract

The present invention belongs to the technical field of biological prevention and treatment for viral diseases. Disclosed in the present invention are a tomato disease-resistant gene mutant, and the use thereof in the prevention and treatment of ToBRFV. It is found in the present invention that mutating the nucleotide at position 1927 of the coding region sequence of tomato Tm-22 gene from G to A, or mutating the amino acid at position 643 of the LRR domain of a protein that is encoded by tomato Tm-22 gene from glycine to arginine can remarkably reduce the accumulation level of ToBRFV capsid protein (CP). The gene (named Tm-22-Mut5) can serve as a novel ToBRFV resistant gene, and also retains the resistance to TMV, ToMV and ToMMV. The Tm-22-Mut5 and a pre-screened Tm-22-Mut3-1 mutant (tyrosine at position 767 of the LRR domain thereof is mutated to phenylalanine) undergo combinatorial mutagenesis to obtain a mutant Tm-22-Mut6. Analysis shows that the Tm-22-Mut6 can remarkably reduce the accumulation level of the ToBRFV capsid protein. Compared with the pFGCTm-22-Mut3-1 mutant obtained by screening in the previous research and the newly obtained mutant Tm-22-Mut5, the Tm-22-Mut6 has further improved resistance to ToBRFV.

Description

Tomato disease resistance gene mutant and application thereof in prevention and treatment of ToBRFV TECHNICAL FIELD

[0001] The present application relates to the technical field of biological control of viral diseases, in particular to a tomato disease resistance gene mutant and application thereof in prevention and treatment of ToBRFV. BACKGROUND

[0002] Tomato brown rugose fruit virus (ToBRFV) is a newly discovered virus, and the main symptoms of virus infection of tomato leaves are mottling, dark green protrusions, narrow leaves, yellow and necrotic leaf veins, reduced number of flowers and fruits, yellow or brown spots on fruits, small and wrinkled fruits, and even fruit stalk necrosis, resulting in a significant decrease in fruit yield and commodity value. ToBRFV has a strong infection force, and there is currently no effective measure to control the infection of ToBRFV on plants.

[0003] According to the gene-for-gene hypothesis, only when the disease resistance gene R of a plant encounters the avirulence gene Avr of a pathogen, the plant can exhibit disease resistance (Van der Biezen & Jones, 1998). The Tm-2 2 gene of tomato is a disease resistance gene belonging to the NBS-LRR family, and the Tm-2 2 gene has certain resistance to tobacco mosaic viruses (TMV), tomato mosaic virus (ToMV) and tomato mosaic mosaic virus (ToMMV) in the genus of tobacco mosaic viruses, but ToBRFV in the genus of tobacco mosaic viruses completely breaks the resistance of Tm-2 2 gene in tomato. 2 Currently, tomato varieties containing Tm-2

[0004] By mutating the Tm-2 2 gene, it is possible to obtain a mutant with ToBRFV resistance, but since the full-length ORF of Tm-2 2 gene is 2586 bp, encoding 861 amino acids, there are countless possibilities for mutation of nucleotides or amino acids, and the performance after mutation is unpredictable, and even the original resistance of Tm-2 2 gene may be changed. Therefore, it is still a technical difficulty to screen a Tm-2 2 gene mutant with ToBRFV resistance and maintaining the original virus resistance. SUMMARY

[0005] In view of the above prior art, the present application provides a tomato disease resistance gene mutant and application thereof in prevention and treatment of ToBRFV.

[0006] To achieve the above object, the present application adopts the following technical solutions:

[0007] In the first aspect of the present application, a tomato disease resistance gene mutant is provided, wherein the tomato disease resistance gene mutant is Tm-2 2 The nucleotide sequence of the coding region of the Tm-2

[0008] gene is mutated at the positions shown in (1) or (2) as follows: 2 (1) the 1927th nucleotide of the coding region sequence of the Tm-2

[0009] gene is mutated; 2 (2) the 1927th nucleotide, the 2300th nucleotide and the 2301th nucleotide of the coding region sequence of the Tm-2

[0010] gene are simultaneously mutated. Preferably, the nucleotide sequence of the tomato disease resistance gene mutant is shown in SEQ ID NO. 1 or SEQ ID NO. 3. Specifically, if the mutation shown in (1) occurs, the 1927th nucleotide of the coding region sequence of the Tm-2 2 gene is mutated from G to A, and the tomato disease resistance gene mutant is named as Tm-2 2 -Mut5, and the nucleotide sequence thereof is shown in SEQ ID NO. 1; if the mutation shown in (2) occurs, the 1927th nucleotide of the coding region sequence of the Tm-2 2 gene is mutated from G to A, the 2300th nucleotide is mutated from A to G, and the 2301th nucleotide is mutated from C to G, and the tomato disease resistance gene mutant is named as Tm-2 2 -Mut6, and the nucleotide sequence thereof is shown in SEQ ID NO. 3.

[0011] In the second aspect of the present application, a protein encoded by the tomato disease resistance gene mutant is provided.

[0012] Compared with the protein encoded by the wild type Tm-2 2 gene, the 643th amino acid of the protein encoded by the tomato disease resistance gene mutant is mutated; or the 643th amino acid and the 767th amino acid are simultaneously mutated.

[0013] Specifically, the 643th glycine is mutated to arginine or other amino acids, such as alanine, valine, leucine, isoleucine, proline, serine, threonine, methionine, tyrosine, aspartic acid, glutamic acid, lysine, tryptophan, histidine, phenylalanine, cysteine, asparagine or glutamine, etc.

[0014] Or, the 643rd glycine is mutated to arginine or other amino acids, and the 767th tyrosine is mutated to phenylalanine or other amino acids.

[0015] Preferably, the amino acid sequence of the protein is shown in SEQ ID NO. 2 or SEQ ID NO. 4. Specifically, the Tm-2 2 The amino acid sequence of Mut5 is shown in SEQ ID NO. 2; the Tm-2 2 The amino acid sequence of Mut6 is shown in SEQ ID NO. 4.

[0016] The mutant Tm-2 2 Mut5 is a mutant of the Tm-2 2 gene encoding protein in which the 643rd glycine (G) is mutated to arginine (R). The mutant Tm-2 2 Mut6 is a mutant of the Tm-2 2 gene encoding protein in which the 643rd glycine (G) is mutated to arginine (R), and the 767th tyrosine (Y) is mutated to tryptophan (W).

[0017] In a third aspect of the present application, the above-mentioned anti-tomato disease gene mutant is used in (1) or (2) as follows:

[0018] (1) To prevent and control tomato brown rugose fruit virus;

[0019] (2) To cultivate a plant variety resistant to tomato brown rugose fruit virus.

[0020] Preferably, the plant variety is tomato, pepper, tobacco, etc.

[0021] In a fourth aspect of the present application, the protein encoded by the above-mentioned tomato disease resistance gene mutant is used in (1) or (2) as follows:

[0022] (1) To prevent and control tomato brown rugose fruit virus;

[0023] (2) To prepare a product for preventing and controlling tomato brown rugose fruit virus.

[0024] In a fifth aspect of the present application, a method for improving the resistance of a plant to ToBRFV is provided, comprising the following steps:

[0025] The 643rd amino acid of the Tm-2 2 gene encoding protein is mutated to an amino acid other than glycine;

[0026] Or, the 643rd amino acid of the Tm-2 2The 643th amino acid of the protein encoded by the gene is mutated to an amino acid other than glycine, and the 767th amino acid is mutated to an amino acid other than tyrosine.

[0027] Preferably, the plant Tm-2 2 The 643th amino acid of the protein encoded by the gene is mutated to arginine; or the plant Tm-2 2 The 643th amino acid of the protein encoded by the gene is mutated to arginine, and the 767th amino acid is mutated to phenylalanine.

[0028] Advantages of the present application:

[0029] (1) The present application first found that the 1927th nucleotide in the coding region sequence of tomato Tm-2 2 gene is mutated from G to A; or the 643th amino acid of the protein encoded by the tomato Tm-2 2 gene is mutated from glycine to arginine, which can significantly reduce the accumulation of ToBRFV coat protein (CP), and can be used as a new ToBRFV resistance gene while retaining resistance to TMV, ToMV and ToMMV.

[0030] (2) The present application combines mutations at different sites in the coding region sequence of Tm-2 2 gene to obtain mutants Tm-2 2 -Mut6, and found that Tm-2 2 -Mut6 can significantly reduce the accumulation of ToBRFV coat protein (CP), compared with the previously screened mutants pFGC Tm-2 2 -Mut3-1 and the newly obtained mutant pFGC Tm-2 2 -Mut5, its resistance to ToBRFV is further improved. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1: Mutants that can react with ToBRFV MP to induce cell necrosis are screened, and the action site is determined.

[0032] Figure 2: Tm-2 2 -Mut5 can react with ToBRFV MP and TMV, ToMV and ToMMV MP to induce cell necrosis; wherein, the left figure: compared with wild type Tm-2 2 , Tm-2 2 -Mut5 can produce hypersensitive necrosis reaction with ToBRFV MP; the right figure: Tm-2 2 -Mut5 can also recognize the MP of TMV, ToMV and ToMMV. Western blot detection was performed 4 days after inoculation.

[0033] Figure 3: Tm-2 2 Mut5 significantly reduced ToBRFV as well as TMV, ToMV and ToMMV accumulation.

[0034] Figure 4: Tm-2 2 and different Tm-2 2 Mutants reacted with ToBRFV MP elicited cell necrosis intensity.

[0035] Figure 5: Tm-2 2 and different Tm-2 2 Mutants effect on ToBRFV accumulation. Western blot was performed 4 days post inoculation. DETAILED DESCRIPTION

[0036] It should be noted that the following detailed description is illustrative only, and is intended to provide further description in addition to the foregoing description of the application. As used herein, except as otherwise expressly defined herein, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0037] As mentioned before, ToBRFV completely broke the Tm-2 2 resistance on tomato, and currently tomato varieties containing Tm-2 2 gene are susceptible to ToBRFV. By mutating Tm-2 2 gene, it is possible to obtain mutants with ToBRFV resistance, however, due to the fact that the ORF of Tm-2 2 gene is 2586 bp in length, there are 4 different mutation directions for each nucleotide, plus the coding relationship between nucleotide sequence and amino acid sequence, therefore, there are infinite mutation possibilities for Tm-2 2 gene, it is extremely difficult to find meaningful Tm-2 2 gene mutants from the numerous mutation possibilities.

[0038] The inventors have been studying Tm-2 2 gene mutants for many years, and found 4 Tm-2 2 gene mutants with ToBRFV resistance, and compared with Tm-2 2 gene sequence with accession number AF536201.1 in NCBI, Tm-2 2 -Mut1 has 3 nucleotide mutations in the coding region of Tm-2 2 gene, the mutations are A138G, T418C, A1425G, and the corresponding amino acid mutations are R46R, C140R, S475S. Tm-2 2 -Mut2 has 3 nucleotide mutations in the coding region of Tm-2 2One nucleotide mutation occurs in the coding region of the gene, which is A1062G, and the corresponding amino acid mutation is I354M. 2 Tm-2 of Mut3-1 2 Two nucleotide mutations occur in the coding region of the gene, which are A2300G and C2301G, and the corresponding amino acid mutation is Y767W. 2 Tm-2 of Mut4 2 Three nucleotide mutations occur in the coding region of the gene, which are A1062G, A2300G and C2301G, and the corresponding amino acid mutations are I354M and Y767W.

[0039] However, the number of the above-mentioned mutants cannot meet the actual production needs, and Tm-2 2 The anti-ToBRFV effect of the gene mutant also needs to be further improved.

[0040] Therefore, the present application further screens and investigates Tm-2 2 Gene mutant, a new ToBRFV-resistant mutant plasmid is found, and its sequence is compared with the Tm-2 2 Gene sequence with the accession number AF536201.1 in NCBI, and it is found that three nucleotide mutations occur in the mutant, which are A521G, G924A and G1927A, and the corresponding amino acid mutations are Q174R, L308L and G643R. It is found through verification that the nucleotide mutation that can recognize ToBRFV MP to produce hypersensitivity reaction is G1927A, and the corresponding amino acid mutation is G643R.

[0041] Subsequently, G1927A is used as a mutation site to construct a new mutant plasmid, which is named pFGCTm-2 2 Mut5. pFGCTm-2 2 Tm-2 in Mut5 2 The nucleotide sequence of the coding region of the Tm-2

[0042] To further enhance the resistance to ToBRFV, Tm-2 2 Mut3-1 and Tm-2 2 Mut5 are combined to obtain Tm-2 2 Mutant plasmid pFGCTm-2 2 Mut6.

[0043] The sequence of the Tm-2 2 Gene in NCBI with the accession number AF536201.1 is compared, and Tm-22 The coding region of Mut6 has three nucleotide mutations, mutation G1927A, corresponding to amino acid mutation G643R; mutation A2300G, C2301G, corresponding to amino acid mutation Y767W.

[0044] pFGCTm-2 2 Tm-2 in Mut6 2 The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO. 3; the amino acid sequence encoded thereby is shown in SEQ ID NO. 4.

[0045] The mutant plasmid pFGCTm-2 2 Mut6 is co-expressed with ToBRFV, and it is found that Tm-2 2 Mut6 can significantly reduce the accumulation of ToBRFV coat protein (CP), and the mutant pFGCTm-2 2 Mut3-1 and the newly obtained mutant pFGCTm-2 2 Mut5 has further improved resistance to ToBRFV, and has a synergistic effect.

[0046] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in conjunction with specific examples.

[0047] The test materials used in the embodiments of the present application are all conventional test materials in the art and can be purchased through commercial channels. The experimental methods not specified in detail are carried out according to conventional test methods or according to the operation instructions recommended by the suppliers. The Tm-2 2 The accession number of the gene in NCBI is AF536201.1. The accession number of ToBRFV-SD isolate used in the present application in NCBI is MT018320; the accession number of TMV in NCBI is MH595920; the accession number of ToMMV in NCBI is MW37351; the accession number of ToMV in GenBank is KY967221.1.

[0048] Example 1: Tm-2 2 Construction and screening of gene mutant library

[0049] 1, Tm-2 2 Construction of gene mutant library:

[0050] Tm-2 2 gene mutant library, specifically as follows:

[0051] Firstly, 50 μL of reaction system was configured, which contained: buffer 15 μL, error-prone special 2.5 mM dNTP 5 μL, 10 μM forward primer (5'-ttacaattaccatggatggctgaaattcttcttacatc-3') 1 μL, 10 μM reverse primer (5'-actcacctaggatcctcatttactcagctttttaagccg-3') 1 μL, 20 mM MnCl2 2.5 μL, 5 U / μL DNA polymerase 0.3 μL, 30 ng / μL template (wild type plasmid pFGCTm-2 2 ) 0.5 μL, double distilled water 24.7 μL.

[0052] Then the reaction was carried out, and the reaction procedure was as follows: 94 ℃ pre-denaturation for 2 min, 94 ℃ denaturation for 15 s, 55 ℃ annealing for 8 s, 72 ℃ extension for 2 min 35 s, 35 cycles, and 72 ℃ post-extension for 2 min. The amplified fragment was cloned into the binary expression vector pFGC5941 by homologous recombination, and then transformed into E. coli DH5α competent cells. The plasmid was extracted from the cells, and the plasmid with correct size was screened to obtain 1800 Tm-2 2 mutant plasmids.

[0053] 2, screening Tm-2 2 mutants that react with ToBRFV MP to produce hypersensitive cell necrosis

[0054] MP was amplified by general PCR in the infectious clone pCBToBRFV (the construction of the infectious clone pCBToBRFV is described in the reference literature Yan ZY, Ma HY, Wang L, Tettey C, Zhao MS, Geng C, Tian YP, and Li XD. Identification of genetic determinants of tomato brown rugose fruit virus that enable infection of plants harbouring the Tm-2 2 resistance gene. Molecular Plant Pathology. 2021, 11, (22): 1347-1357), and the amplified product was cloned into the pCam-35S binary expression vector between the 35S promoter and the NOS terminator by homologous recombination to obtain pCamToBRFV-MP. The sequence of MP is the sequence encoded by ToBRFV-SD isolate (NCBI accession number MT018320).

[0055] The obtained 1800 Tm-2 2 The mutant plasmid and the pCamToBRFV-MP plasmid expressing ToBRFV MP were respectively transformed into the competent Agrobacterium GV3101. The Agrobacterium carrying the Tm-2 2 The OD of the Agrobacterium carrying the mutant plasmid and the Agrobacterium carrying the pCamToBRFV-MP plasmid was adjusted to 0.5, and then both were mixed at a volume ratio of 1:1. The mixed Agrobacterium was injected into the leaves of N. benthamiana, and after 2 days of inoculation, the leaf necrosis in the inoculation area was observed. 600 The OD of the Agrobacterium carrying the mutant plasmid and the Agrobacterium carrying the pCamToBRFV-MP plasmid was adjusted to 0.5, and then both were mixed at a volume ratio of 1:1. The mixed Agrobacterium was injected into the leaves of N. benthamiana, and after 2 days of inoculation, the leaf necrosis in the inoculation area was observed.

[0056] It was found that 1800 Tm-2 2 One mutant in the mutant plasmid can react with ToBRFV MP to induce cell necrosis. The mutant plasmid that triggers cell necrosis was sequenced. The sequencing results showed that the coding region of the mutant had 3 nucleotide mutations, and the mutations were A521G, G924A, and G1927A, corresponding to amino acid mutations Q174R, L308L, and G643R. Analysis determined that the action site G643R enabled the mutant to recognize ToBRFV MP to trigger hypersensitivity (Figure 1).

[0057] Example 2: Tm-2 2 Construction of Mut5 mutant and study of disease resistance

[0058] 1. Tm-2 2 Construction of Mut5 mutant plasmid:

[0059] The following primers were used to amplify the Tm-2 2 nucleotide mutation at position 1927 of the gene.

[0060] Primer pair 1-Tm-2 2 G1927A-F: gattatagacaagcatgtaacagttgcttttct;

[0061] Primer pair 1-Tm-2 2 G1927A-R: tgcttgtctataatctctataacaaagatgtctcaaa.

[0062] First, configure a 50 μL mutant PCR reaction system, which contains: buffer 25 μL, 10 mM dNTP 1 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, 1 U / μL DNA high-fidelity polymerase 1 μL, 30 ng / μL pFGCTm-2 2 0.5 μL, double distilled water 20.5 μL.

[0063] Subsequently, a mutation PCR reaction was performed, and the reaction procedure was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 35 s, 15 cycles, 48℃ annealing for 30 s, and 72℃ post-extension for 5 min. The amplified product was transferred into E. coli DH5a competent cells, plasmids were extracted therefrom, plasmids with correct plasmid sizes were screened, and a single-site mutant plasmid (Tm-2 2 Mut5 mutant plasmid) was constructed.

[0064] Mutant Tm-2 2 The nucleotide mutations of Mut5 occurred were G1927A, and the corresponding amino acid mutation was G643R.

[0065] 2, Tm-2 2 Mut5 mutant resistance research:

[0066] The pFGC Tm-2 2 Mut5 mutant plasmid was constructed, and the pFGC Tm-2 2 Mut5 was co-expressed with ToBRFV MP. Specifically, the OD 2 of Agrobacterium carrying the Tm-2 2 mutant plasmid (or pFGC Tm-2 600 Mut5) and Agrobacterium carrying pCamToBRFV-MP was adjusted to 0.5, and then the two were mixed at a volume ratio of 1:1. The mixed Agrobacterium was injected into N. benthamiana leaves, and after 2 days of inoculation, the leaf necrosis in the inoculation area was observed.

[0067] The pFGC Tm-2 2 Mut5 was obtained by the same method, and the pFGC Tm-2 2 Mut5 was co-expressed with plasmids expressing TMV MP, ToMV MP, and ToMMV MP, respectively.

[0068] The phenotype observation results showed that Tm-2 2 Mut5 did not react with ToBRFV MP, while Tm-2 2 Mut5 reacted with ToBRFV MP to induce cell necrosis (Fig. 2A). In addition, the co-expression experiment results showed that Tm-2 2 Mut5 could also react with ToMV and ToMMV MP to induce cell necrosis (Fig. 2B). The above results showed that Tm-2 2 Mut5 could mediate resistance to ToBRFV while retaining resistance to TMV, ToMV, and ToMMV.

[0069] The pFGC Tm-2 2The infectious clone pCBToBRFV was transformed into Agrobacterium GV3101 competent cells. The cells carrying pFGCTm-2 were then... 2 Agrobacterium-1, pFGC5941, and pFGCTm-2 2 OD of Agrobacterium and pCBToBRFV 600 Adjust to 0.5, then carry pFGCTm-2 2 -Mut5 Agrobacterium, pFGCTm-2 2 Agrobacterium and Agrobacterium pFGC5941 were mixed with Agrobacterium carrying pCBToBRFV at a 1:1 volume ratio. The mixed Agrobacterium was injected into tobacco leaves. Four days after inoculation, total protein was extracted from the inoculated area. Coat protein (CP) was detected by Western blot (Figure 3).

[0070] Using the same method described above, pFGCTm-2 2 -Mut5, empty vector pFGC5941, pFGCTm-2 2 Co-expression with infectious clones of TMV, ToMV, and ToMMV was performed, respectively. The construction of the TMV infectious clone is described in the reference: Yan ZY, Ma HY, Wang L, Tettey C, Zhao MS, Geng C, Tian YP, and Li XD. Identification of genetic determinants of tomato brown rugose fruit virus that enable infection of plants harbouring the Tm-2 2Molecular Plant Pathology. 2021, 11, (22): 1347-1357; The construction of ToMV infectious clone is to amplify the full length of ToMV by primers PCB301-ToMV-F: TTTCATTTGGAGAGGGTATTTATTATTACAACAATTACC, PCB301-ToMV-R: GATATAAGTACAGACTGGGCCCCTACCGGGGGTTCCGG, and clone into the 35S promoter and NOS terminator of binary expression vector pCB301; The construction of ToMMV infectious clone is according to the reference Tettey Carlos, Yan, ZY, Ma, HY, Zhao MS, Geng C, Tian YP, Li XD. Tomato mottle mosaic virus: characterization, resistance gene effectiveness, and quintuplex RT-PCR detection system. Journal of Integrative Agriculture. 2022, 21, (9): 2641-2651. The accumulation of coat protein (CP) is detected by Western blot.

[0071] The results are shown in Figure 3, and the results show that: compared with the control (empty vector pFGC5941, wild type pFGCTm-2 2 ), Tm-2 2 -Mut5 can significantly reduce the accumulation of ToBRFV coat protein (CP). In addition, the results of co-expression experiment show that Tm-2 2 -Mut5 can also significantly reduce the accumulation of TMV, ToMV and ToMMV.

[0072] Example 3: Construction and disease resistance of Tm-2 2 -Mut6 mutant

[0073] 1. Construction of Tm-2 2 -Mut6 mutant

[0074] The following primers are used to amplify the mutant Tm-2 2 -Mut5 at position 767 amino acid mutation by directional mutation method.

[0075] Primer pair 2-Tm-2 2-Y767W-F: tagcctggtttagtgtagaccgttatatactggc;

[0076] Primer pair 2-Tm-2 2 -Y767W-R: actaaaccaggctagagtaagcttgatgagattt.

[0077] First, 50 μL of a mutant PCR reaction system was configured, which contained: buffer 25 μL, 10 mM dNTP 1 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, 1 U / μL DNA high-fidelity polymerase 1 μL, 30 ng / μL pFGC Tm-2 2 0.5 μL, double-distilled water 20.5 μL.

[0078] Then, the mutant PCR reaction was carried out, and the reaction program was as follows: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 15 s, 55 °C annealing for 15 s, 72 °C extension for 2 min 35 s, 15 cycles, 48 °C annealing for 30 s, and 72 °C post-extension for 5 min. The amplified product was transferred into E. coli DH5α competent cells, plasmids were extracted therefrom, plasmids with correct sizes were screened, and Tm-2 2 -Mut6 mutant.

[0079] Tm-2 2 was amplified by using the above primer directional mutation method. 2 -Mut3-1 mutant plasmid) was constructed by using the same method.

[0080] 2, Tm-2 2 -Mut6 mutant.

[0081] pFGC Tm-2 2 and pFGC Tm-2 2 -Mut6, pFGC Tm-2 2 -Mut5, pFGC Tm-2 2 -Mut3-1 was co-expressed with ToBRFV MP. Specifically, Agrobacterium carrying Tm-2 2 mutant plasmid (or pFGC Tm-2 2 ) and Agrobacterium carrying pCamToBRFV-MP were adjusted to an OD 600 of 0.5, and then mixed in a volume ratio of 1:1. The mixed Agrobacterium was injected into N. benthamiana leaves, and after 2 days of inoculation, the leaf necrosis in the inoculation area was observed.

[0082] Phenotypic observation results are shown in Figure 4. Tm-2 2 It does not react with ToBRFV MP; pFGCTm-2 2 -Mut6、pFGCTm-2 2 -Mut5、pFGCTm-2 2 Mut3-1 reacts with ToBRFV MP to induce cell necrosis; mutant Tm-2 2 The necrosis reaction induced by Mut6 and ToBRFV MP is more significant than that induced by Tm-2. 2 -Mut5、Tm-2 2 -Mut3-1 is obvious.

[0083] The obtained pFGCTm-2 2 -Mut6、pFGCTm-2 2 -Mut5、pFGCTm-2 2 -Mut3-1 Wild-type pFGCTm-2 2 The infectious clone pCBToBRFV was transformed into Agrobacterium GV3101 competent cells. The cells carrying pFGCTm-2 were then... 2 -Agrobacterium tumefaciens of Mut6, pFGCTm-2 2 -Mut5 Agrobacterium, pFGCTm-2 2 Agrobacterium-1-Mut3-1, pFGCTm-2 2 The OD600 of Agrobacterium and pCBToBRFV was adjusted to 0.5, and then pFGCTm-2 was carried. 2 Mutant Agrobacterium and pFGCTm-2 2 Agrobacterium and Agrobacterium carrying pCBToBRFV were mixed at a 1:1 volume ratio. The mixed Agrobacterium was injected into tobacco leaves, and total protein was extracted from the inoculated area 4 days after inoculation. The accumulation of coat protein (CP) was detected by Western blot.

[0084] The results are shown in Figure 5. The results indicate that on day 4 post-inoculation, compared with the control (wild-type pFGCTm-2) 2 Compared to Tm-2 2 -Mut3-1、Tm-2 2 -Mut5、Tm-2 2 -Mut6 significantly reduces the accumulation of ToBRFV capsid protein (CP). Tm-2 2 -Mut6 compared to Tm-2 2 -Mut5、Tm-2 2 Mut3-1 has a lower viral load. We believe Tm-2... 2Mut6 is more advantageous than Tm-2 2 Mut5, Tm-2 2 Mut3-1 enhances the recognition of ToBRFV MP, and in practical production, Tm-2 2 Mut6 is more advantageous than Tm-2

[0085] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Various modifications and changes can be made by those skilled in the art based on the spirit and principles of the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A mutant of the disease resistance gene of tomato, characterized in that, The tomato disease resistance gene mutant is a Tm-2 2 The nucleotide sequence of the coding region of the gene is mutated at a nucleotide position indicated in (1) or (2) as follows: (1) Tm-2 2 a mutation is made at nucleotide 1927 of the coding region sequence of the gene; (2) Tm-2 2 The 1927th nucleotide, the 2300th nucleotide and the 2301th nucleotide of the coding region sequence of the gene are simultaneously mutated.

2. The tomato disease resistance gene mutant according to claim 1, characterized in that, The nucleotide sequence of the tomato disease resistance gene mutant is shown in SEQ ID NO. 1 or SEQ ID NO.

3.

3. The protein encoded by the tomato disease resistance gene mutant of claim 1 or 2.

4. The protein of claim 3, wherein The amino acid at position 643 of the protein is mutated; or the amino acids at positions 643 and 767 are simultaneously mutated.

5. The protein of claim 4, wherein The amino acid sequence of the protein is shown in SEQ ID NO. 2 or SEQ ID NO.

4.

6. The tomato disease resistance gene mutant of claim 1 or 2 for use in (1) or (2) as follows: (1) preventing tomato brown rugose fruit virus; or (2) cultivating a plant variety resistant to tomato brown rugose fruit virus.

7. Use according to claim 6, characterized in that, The plant variety is tomato, pepper or tobacco.

8. The protein encoded by the tomato disease resistance gene mutant of any one of claims 3-5 for use in (1) or (2) as follows: (1) preventing tomato brown rugose fruit virus; or (2) preparing a product for preventing tomato brown rugose fruit virus.

9. A method of increasing resistance of a plant to ToBRFV, characterized in that, comprising the following steps: Plants Tm-2 2 the amino acid at position 643 of the encoded protein is mutated to an amino acid other than glycine; Alternatively, the plant Tm-2 2 the amino acid at position 643 of the encoded protein is mutated to an amino acid other than glycine, and the amino acid at position 767 is mutated to an amino acid other than tyrosine.

10. The method of claim 9, wherein, The plant Tm-2 2 gene encodes a protein with a mutation of the amino acid at position 643 to arginine; or 2 the plant Tm-2 gene encodes a protein with a mutation of the amino acid at position 643 to arginine and a mutation of the amino acid at position 767 to phenylalanine.

Images