A SNP molecular marker associated with beef cattle body weight and its application
By discovering and utilizing SNP molecular markers in the beef cattle genome, combined with PCR-RFLP technology, the problems of long cycle and high cost in the selection of beef cattle weight traits in traditional breeding methods have been solved, realizing efficient identification of individual growth potential and early breeding of beef cattle.
Patent Information
- Application Number
- CN202511543410.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-28
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2045-10-28
AI Technical Summary
Traditional breeding methods are time-consuming and costly in selecting beef cattle for weight traits, making it difficult to screen individuals with excellent growth performance in the early stages. The limited availability of existing molecular markers also hinders efficient breeding.
A molecular marker was developed for an SNP located at position 71001780 on chromosome 17 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3. The genotype of individual beef cattle was detected by PCR-RFLP technology, and the genotype was identified by digesting the PCR product with Ale I restriction endonuclease.
It enables accurate and efficient identification of the growth potential of individual beef cattle, shortens the breeding cycle, reduces costs, and improves breeding efficiency, allowing for the selection of beef cattle with excellent weight traits in early selection and breeding programs.
Smart Images

Figure CN121023045B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic breeding technology, and in particular to a SNP molecular marker related to the weight of beef cattle and its application. Background Technology
[0002] Body weight (growth performance) is one of the important economic traits in beef cattle production, directly affecting meat yield and breeding efficiency. Traditional breeding mainly relies on the measurement of phenotypic indicators such as body weight and offspring testing, which is time-consuming, costly, and makes it difficult to select individuals with excellent growth performance in a timely manner. With the development of molecular biology, marker-assisted selection (MAS) can predict the growth potential of beef cattle based on genotype in the early growth stage, thereby accelerating the breeding process.
[0003] Single nucleotide polymorphisms (SNPs) are third-generation molecular markers that refer to polymorphisms caused by variations in a single nucleotide in the genomic DNA sequence. SNP markers are abundant, genetically stable, and widely distributed in animal genomes, and are easily detected using automated high-throughput techniques, thus holding great promise for applications in quantitative trait genetics research and molecular breeding in animals. Currently, genome-wide association studies (GWAS) can be used to screen for genetic variation sites associated with complex traits across the entire genome. However, in the area of body weight traits in beef cattle, existing molecular markers are limited, and new, reliable genetic markers need to be developed for early prediction of beef cattle growth performance and to guide breeding practices. Summary of the Invention
[0004] To address the aforementioned problems, this invention provides a SNP molecular marker related to beef cattle body weight and its application. The SNP molecular marker provided by this invention can accurately and efficiently identify the growth potential of individual beef cattle, and has significant value in early selection and breeding programs for beef cattle.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] This invention provides a SNP molecular marker related to the body weight of beef cattle, wherein the SNP molecular marker contains an SNP site; the SNP site is located on chromosome 17 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 71001780, and exhibits G / A polymorphism; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein R is A or G.
[0007] This invention provides a primer pair for detecting the SNP molecular marker described in the above technical solution, consisting of an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.
[0008] This invention provides a kit for detecting the SNP molecular markers described in the above-mentioned technical solutions, characterized in that it includes the primer pairs and Ale I restriction endonuclease described in the above-mentioned technical solutions.
[0009] Preferably, the kit further includes one or more reagents selected from the following: buffer, dNTP mixture, and DNA polymerase required for the PCR reaction.
[0010] This invention provides the application of products that detect the SNP molecular marker genotypes described in the above technical solution in identifying the weight of beef cattle or in selecting high-weight beef cattle, wherein beef cattle with the SNP molecular marker genotype AA have a higher weight than beef cattle with the genotypes GG or GA.
[0011] Preferably, the product includes the primer pair or the reagent kit described in the above technical solution.
[0012] Preferably, the beef cattle include West China cattle and / or Angus cattle.
[0013] This invention provides a method for determining the weight of beef cattle, comprising the following steps:
[0014] Using the genomic DNA of the cattle to be tested as a template, PCR amplification was performed using the primer pairs described in the above technical solution to obtain the amplification product;
[0015] The amplification product was digested with Ale I restriction endonuclease, and the results were used for identification.
[0016] If the enzyme digestion product is a single band, then the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested is AA;
[0017] If the enzyme digestion product consists of two bands, then the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested is GG;
[0018] If the enzyme digestion product has three bands, then the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested is GA;
[0019] The beef cattle with the SNP molecular marker genotype AA had a higher body weight than beef cattle with the genotypes GG or GA.
[0020] This invention provides a method for breeding high-weight beef cattle, comprising: using the method described in the above technical solution to detect the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested, retaining beef cattle with genotype AA and / or GA to breed offspring, and screening beef cattle with genotype AA from the offspring.
[0021] Preferably, the beef cattle include West China cattle and / or Angus cattle.
[0022] Beneficial effects:
[0023] This invention provides a SNP molecular marker associated with the body weight of beef cattle. The SNP molecular marker contains an SNP locus located on chromosome 17 of the bovine reference genome (GCF_002263795.2_Bos_taurus.ARS-UCD1.3) at position 71001780, exhibiting G / A polymorphism. This invention utilizes a beef cattle promoter breeding chip to conduct a GWAS study on a beef cattle population, discovering an SNP locus highly associated with the body weight trait. This locus is located on chromosome 17 of the bovine reference genome (GCF_002263795.2_Bos_taurus.ARS-UCD1.3) at position 71001780, exhibiting G / A polymorphism. The upstream and downstream nucleotide sequences are shown in SEQ ID NO.1. Beef cattle with the genotype AA at this SNP locus have higher body weights than those with the genotypes GG or GA, indicating that the A allele is a superior allele associated with higher body weight. The SNP molecular markers provided by this invention can accurately and efficiently identify the growth potential of individual beef cattle, which is of great value in early selection and breeding programs for beef cattle.
[0024] The present invention further develops a specific detection method and detection kit for this SNP site. By digesting the amplification product with Ale I enzyme, the weight of beef cattle can be identified based on the digestion results, providing a new molecular marker tool for beef cattle breeding and improving breeding efficiency. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0026] Figure 1 Manhattan plot for genome-wide association analysis of body weight traits in beef cattle;
[0027] Figure 2 QQ plot of GWAS results for body weight traits in beef cattle;
[0028] Figure 3 Box plot of the distribution of body weight phenotypes in individuals with different genotypes at the SNP locus Chr17:71001780;
[0029] Figure 4 Electrophoresis image of PCR products before enzyme digestion;
[0030] Figure 5 This is an electrophoresis image of the PCR products after Ale I digestion. Detailed Implementation
[0031] This invention provides a SNP molecular marker associated with the body weight of beef cattle, wherein the SNP molecular marker contains an SNP site; the SNP site is located on chromosome 17 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 71001780, and exhibits G / A polymorphism; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and is as follows:
[0032] 5'-CTGATGCTGGGGTCCTGAGATTTGCAACAAACAAGGCTGCGACGTGCAACACAAAAAAACAACAAAACAAGGAGGGAACAATCTGGACAAAACAAAACCACAAAACAAAACAACAACGTGAGCCACTTCTTTCTTCAAATTGAAAGATGAGTCCCTGGTCACTCCATTCAAAATGTTAGAAATGACTGGCTTTGAAC TTGAAATCCCTCTGACAAAGAGGGTTTCAGCATCCTCACTGACRTGCTGCACTCCAACAAAGATGACCTCAGCATCGCCATCGTCCTCATCTCTGGATTTGGACCCTGCGGTCTTTTCCGGGTTGTGGTCGTGCTTGTGCTTCCTCACACGGGAAGAAACAACAAGATGGGCCATTTTACA-3'; wherein the SNP site is in SEQ. In ID NO. 1, 241 bp is represented by the degenerate base R, that is, R is A or G.
[0033] The SNP molecular marker provided by this invention is a molecular marker highly correlated with body weight trait. Beef cattle with the genotype AA at the SNP locus have a higher body weight than those with the genotypes GG or GA, meaning the A allele is a superior allele associated with higher body weight. Using the SNP molecular marker provided by this invention, the growth potential of individual beef cattle can be accurately and efficiently identified, which is of great value in early selection and breeding programs. This SNP molecular marker can also be used to construct molecularly assisted evaluation models for beef cattle body weight traits. By detecting the genotype at this locus in breeding cattle or candidate breeding individuals, their adult body weight or growth rate can be predicted, thereby facilitating early selection. Using the SNP molecular marker of this invention for marker-assisted breeding of beef cattle has advantages such as early screening, accuracy, efficiency, and low cost, and can accelerate the breeding of beef cattle with superior body weight traits.
[0034] This invention provides a primer pair for detecting the SNP molecular markers described in the above-mentioned technical solutions, consisting of an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3. The primer pair provided by this invention can specifically amplify nucleotide sequences containing the SNP molecular markers described in the above-mentioned technical solutions. Based on the genotype of the amplified product (i.e., the genotype at the SNP site or the genotype at the R position in the sequence shown in SEQ ID NO.1), the adult weight of beef cattle can be identified or assessed. Beef cattle with the AA genotype have a higher weight than beef cattle with the GG or GA genotypes, which can accelerate the breeding of beef cattle with excellent weight traits.
[0035] This invention provides a kit for detecting the SNP molecular markers described in the above-mentioned technical solutions, comprising the primer pairs and Ale I restriction endonuclease described in the above-mentioned technical solutions.
[0036] In one embodiment, the kit also includes one or more reagents from the following: buffer, dNTP mixture, and DNA polymerase required for PCR reaction.
[0037] This invention also discovered that SNP mutations in the SNP molecular marker alter the unique Ale I restriction site in the PCR product sequence (SEQ ID NO.1). The recognition site "CACNNNNGTG" (where N is any base) present in the wild-type beef cattle sequence is disrupted by the G→A mutation. Based on this characteristic, a PCR-RFLP-based genotyping method was developed: by digesting the PCR product with Ale I, different genotypes of beef cattle can be easily and quickly distinguished. Specifically, the PCR product of the AA genotype is not digested, the PCR product of the GG genotype is completely digested, and the heterozygous GA genotype shows a unique electrophoretic band after partial digestion, thus clearly identifying the genotype. This molecular detection method can significantly shorten the beef cattle breeding cycle, reduce breeding costs, and can be combined with traditional breeding techniques, showing promising application prospects.
[0038] Based on the above advantages, the present invention provides the application of products that detect the SNP molecular marker genotypes described in the above technical solution in identifying the weight of beef cattle or in selecting high-weight beef cattle, wherein beef cattle with the SNP molecular marker genotype AA have a higher weight than beef cattle with the genotypes GG or GA.
[0039] In one embodiment, the product includes the primer pair or the reagent kit described in the above technical solution.
[0040] In one implementation, the beef cattle include West China cattle and / or Angus cattle.
[0041] This invention provides a method for determining the weight of beef cattle, comprising the following steps:
[0042] Using the genomic DNA of the cattle to be tested as a template, PCR amplification was performed using the primer pairs described in the above technical solution to obtain the amplification product;
[0043] The amplification product was digested with Ale I restriction endonuclease, and the results were used for identification.
[0044] If the enzyme digestion product is a single band, then the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested is AA;
[0045] If the enzyme digestion product consists of two bands, then the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested is GG;
[0046] If the enzyme digestion product has three bands, then the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested is GA;
[0047] Beef cattle with the genotype AA (as indicated by the SNP molecular marker) have a higher body weight than beef cattle with the genotypes GG or GA. In one embodiment, the beef cattle include West China cattle and / or Angus cattle.
[0048] The detection method provided by this invention can predict the adult weight potential of beef cattle during their juvenile stage by detecting the genotype of the SNP molecular marker. It can be used for selecting breeding bulls and screening replacement heifers, improving the accuracy and efficiency of breeding selection. The method provided by this invention has the advantages of high specificity, simplicity, speed, and low cost, making it very suitable for genotyping large numbers of individual beef cattle.
[0049] Based on the above advantages, this invention provides a method for breeding high-weight beef cattle, comprising: detecting the genotype of the SNP molecular marker described in the above technical solution in the beef cattle to be tested using the method described above; retaining beef cattle with genotypes of AA and / or GA to breed offspring; and selecting beef cattle with genotype AA from the offspring. As one embodiment, the beef cattle include West China cattle and / or Angus cattle.
[0050] To further illustrate the present invention, the following detailed description, in conjunction with embodiments and accompanying drawings, describes a SNP molecular marker related to the body weight of beef cattle and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.
[0051] Example 1: Screening for molecular markers associated with adult body weight in beef cattle
[0052] (1) Body weight data of 56 adult Huaxi cattle and 50 adult Angus cattle were collected as phenotypic data to test whether their distribution conformed to a normal distribution for subsequent trait association analysis. Approximately 10 ml of blood was collected from each cattle via the tail vein, and DNA was extracted using the phenol-chloroform extraction method. The obtained DNA samples were fragmented using the beef cattle promoter breeding chip in Chinese patent CN118853911B and hybridized with biotin-labeled probes. The hybridization products of biotin-labeled genomic DNA were enriched using streptavidin-coated magnetic beads, eluted, and amplified a second time before sequencing using the BGI T7 platform. After the data was processed, the raw data (Raw reads) were filtered using Fastp software to remove low-quality fragments and obtain filtered fastq format files (Clean reads).
[0053] (2) Based on the fastq file obtained in (1), the sequencing clean reads were aligned to the beef cattle reference genome (ARS-UCD1.3) using the MEM function of BWA software (Version: 0.7.17), and the repeats introduced during library construction and sequencing were marked by picard software (Version: 3.0). After alignment, the bam file of the sorted samples was obtained.
[0054] (3) Use the HaplotypeCaller function in GATK software (Version: 4.0) to detect variant sites in the bam file of each sample generated in (2), generate the gVCF file of each sample, and then use the CombineGVCF function and GenotypeGVCF function of GATK software to obtain the variant detection and genotyping results of all samples.
[0055] (4) Use the FilterVcf function of picard (Version: 1.1) software to perform quality control on the genotyping results of each locus for each sample. When the genotyping quality value (GQ) is less than 15, the genotyping result of that locus for that sample is considered unqualified and is redefined as missing. SNP quality control is performed according to the hard filtering parameters recommended by GATK software, and a high-quality SNP VCF file containing the genotyping results of all samples is obtained. SNP quality control parameters: -filter "QD<2.0"&&-filter "QUAL<30.0"&&-filter "SOR>3.0"&&-filter "FS>60.0"&&-filter "MQ<40.0"&&-filter "MQRankSum<-12.5"&&-filter "ReadPosRankSum<-8.0".
[0056] (5) Use Plink software (Version: 1.9) to extract the genotyping results of all 52 beef cattle from the results in (4), and use vcf2hmp software (Version: 1.0) to convert the VCF format files into haplotype files.
[0057] (6) Using the SUPER model in the GAPIT package (Version: 3.0) of R software (Version: 4.3.3), phenotypic association analysis was performed on the beef cattle weight data obtained in (1) and the haplotype data obtained in (5). Manhattan plots and QQ plots were plotted using the ggplot2 package (Version: 3.5.0) for visualization of the analysis results. Figure 1 and Figure 2 Extract those with p-values less than 10. -6 Loci were marked as those significantly associated with the phenotype, and their location information was recorded. Haplotypes were then extracted from the haplotype files extracted in (5). Figure 1 It is evident that a significant association signal peak (threshold line indicating significance level) appears on chromosome 17, indicating a genetic variation significantly associated with the weight trait near Chr17:7100-1780. Figure 2As can be seen, most points are distributed along the diagonal, indicating that there is no systematic bias in the overall distribution; however, points that deviate significantly (above the diagonal) can be seen at the tail, representing the presence of highly significant SNP sites, including key sites on chromosome 17.
[0058] (7) The weight phenotype data obtained in (1) were regrouped according to the genotype data in the haplotype file obtained in (6) using R software (Version: 4.3.3), and significance tests were performed using ANOVA. Box plots were plotted using the ggplot2 package (Version: 3.5.0) to visualize the results. The key locus Chr17:71001780 was extracted. The results are shown in […]. Figure 3 and Tables 1-2, where, Figure 3 A summary chart of 56 adult Huaxi cattle and 50 adult Angus cattle, * indicates P <0.05, ns indicates P >0.05, the middle horizontal line in the box plot for each genotype represents the median, not the average weight.
[0059] Table 1. Summary of genotypes and body weights at the Chr17:71001780 locus in 56 Huaxi cattle.
[0060]
[0061] Table 2. Summary of genotypes and body weights of 50 Anglo-Chinese cattle at the Chr17:71001780 locus.
[0062]
[0063] Note: In Tables 1 and 2, different lowercase letters indicate significant differences between different groups, while the same lowercase letter indicates no significant differences between different groups. The same applies to the following tables.
[0064] The results showed that the mean and median body weight of individuals with the AA genotype were higher than those with the GA and GG genotypes. Statistical analysis revealed significant differences in body weight between individuals with the AA and GG genotypes, and between individuals with the AA and GA genotypes, while there was no significant difference between individuals with the GG and GA genotypes. This indicates that the A allele has a positive impact on body weight traits, and homozygous AA individuals exhibit a greater weight gain; that is, beef cattle with the AA genotype have significantly higher body weights than beef cattle with the GA or GG genotypes. This genotype can serve as a potential genotype for screening beef cattle body weight traits.
[0065] Example 2: Molecular detection method for SNP sites (PCR-RFLP)
[0066] This embodiment provides a method for detecting the genotype at the Chr17:71001780 locus based on PCR-RFLP technology. This method utilizes specific primer pairs designed in this invention to amplify genomic fragments containing the target locus, then digests the products with restriction endonucleases and analyzes them by gel electrophoresis to identify the genotype. The specific steps are as follows:
[0067] 1. PCR Amplification Primer Design: Based on the bovine genome reference sequence, primer binding sites were selected upstream and downstream of the target SNP site. Primer pairs were designed to make the amplification product approximately 380 bp in length. The designed primer sequences are as follows:
[0068] Forward primer: 5'-CTGATGCTGGGGTCCTGA-3', SEQ ID NO.2;
[0069] Reverse primer: 5'-TGTAAAATGGCCCATCTTGTTGTTTC-3', SEQ ID NO.3.
[0070] The primers were verified by specific BLAST alignment to amplify only the target region.
[0071] 2. PCR Amplification Conditions: PCR amplification was performed using genomic DNA from the individual beef cattle to be tested as a template. The PCR reaction system and PCR procedure are shown below:
[0072] PCR reaction system: Green Taq Mix (Novizan) 25 μL, forward primer (10 μM) 2 μL, reverse primer (10 μM) 2 μL, template 2 μL, ddH2O to make up to 50 μL.
[0073] PCR program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 40 s, 15 cycles; 72℃ final extension for 5 min.
[0074] The amplification product was verified to be approximately 380 bp in size by 2% agarose gel electrophoresis, with no non-specific amplification bands. Figure 4 As shown, M represents lane marker (DL500, purchased from Takara Bio), and S1~S9 represent lanes containing the sample to be tested.
[0075] 3. Restriction Enzyme Digestion and Genotyping: The purified PCR amplified product was then used for restriction enzyme digestion analysis. Ale I restriction enzyme was selected for the digestion reaction (the recognition sequence of Ale I is 5'-CACNNNNGTG-3'). The digestion system was set to 20 µL, containing 10 µL of PCR product, 5 µL of 1× suitable digestion buffer, and 5 U of Ale I enzyme. The reaction was carried out at 37°C for 1 h, followed by enzyme inactivation at 65°C for 10 min. Because the SNP mutation identified in this invention disrupts the Ale I recognition site, PCR products from different genotypes exhibit different fragment patterns after digestion.
[0076] If the individual being tested has the GG genotype, its PCR product sequence contains a complete Ale I restriction site. After Ale I digestion, it will be cleaved into two DNA fragments of specific lengths (approximately 240 bp and 140 bp fragments in this example, totaling 380 bp). If the individual has the AA genotype, the PCR product sequence lacks this restriction site due to a G→A mutation, and Ale I cannot cleave the product. After digestion, it will still retain an intact fragment of approximately 380 bp. If the individual has the GA genotype, one allele is GG (which can be cleaved), and the other is AA (which cannot be cleaved). After digestion, three fragments will be produced: an uncut 380 bp fragment, and two fragments of approximately 140 bp and 240 bp produced by digestion.
[0077] 4. Electrophoresis Detection: The enzyme digestion products were separated by 2.0% agarose gel electrophoresis at 125 V for approximately 20-30 minutes. Results were recorded under UV light. The electrophoretic patterns of different genotypes were interpreted as follows: GG genotype samples showed two clear bands (the 380 bp band disappeared, and bands of approximately 240 bp and 140 bp appeared); AA genotype showed a single band (380 bp uncut band); GA heterozygous genotype showed three bands (380 bp uncut band, 240 bp and 140 bp enzyme-digested bands). Overall, the electrophoretic fingerprints produced by different genotypes were clearly distinguishable, such as... Figure 5 As shown, lane M represents a marker (DL1000, purchased from Takara Bio), and lane W represents a PCR product without sample template (considered as a negative control).
[0078] 5. Result Determination: The genotype of the tested individuals is determined based on the electrophoretic band pattern. Combined with the trait association effect discovered in this invention, breeding value can be further inferred: Individuals with the AA genotype carry a favorable allele and are expected to have a higher body weight phenotype under the same feeding conditions; individuals with the GG genotype and heterozygous individuals with the GA genotype lack this favorable allele and are expected to have relatively lower growth performance. Based on these results, individuals with the AA genotype can be selected for breeding in the population to improve the average body weight of the next generation.
[0079] Example 3: Application of Molecular Marker-Assisted Breeding
[0080] Taking candidate bulls from a beef cattle breeding farm as an example: blood samples were taken from each candidate bull at 6 months of age, genomic DNA was extracted, and the genotype at the Chr17:71001780 locus was detected according to the method described in Example 2. The results are shown in Tables 3 and 4.
[0081] Table 3. Summary of genotypes and body weights at the Chr17:71001780 locus in the offspring of 102 Huaxi cattle.
[0082]
[0083] Table 4. Summary of genotypes and body weights at the Chr17:71001780 locus in 113 Angus cattle offspring.
[0084]
[0085] Based on the test results, bulls with the AA genotype are marked as preferred individuals, and these bulls are expected to have higher adult weights. Bulls with the AA genotype can be prioritized for breeding, and mating trials will be conducted to evaluate the growth performance of their offspring. Bulls with the GG genotype can be downgraded to commercial beef cattle or culled, to avoid the impact of their allele disadvantage on offspring growth. Similarly, this marker can be applied to select replacement heifers carrying the superior allele (A) for breeding the next generation. By introducing the molecular marker detection step of this invention into the breeding program, gene-level performance prediction and selection can be performed in the early stages of animal development, significantly improving the efficiency of breeding progress. After several generations of selection, the frequency of favorable alleles in the population will gradually increase, thereby improving the overall growth rate and weight traits of the beef cattle population. The technology described in this invention provides a beneficial supplement and support to traditional breeding methods.
[0086] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of products containing SNP molecular marker genotypes in identifying the weight of beef cattle or selecting high-weight beef cattle, wherein the SNP molecular marker contains an SNP locus; the SNP locus is located on chromosome 17 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 71001780, and exhibits G / A polymorphism; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where R represents A or G; beef cattle with the SNP molecular marker genotype AA have a higher weight than beef cattle with the genotype GG or GA; the beef cattle are West China cattle and / or Angus cattle.
2. The application according to claim 1, characterized in that, The product includes a kit; the kit includes a primer pair and an Ale I restriction endonuclease; the primer pair consists of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.
3.
3. The application according to claim 2, characterized in that, The kit also includes one or more of the following reagents: buffer, dNTP mixture, and DNA polymerase required for PCR reaction.
4. A method for determining the weight of beef cattle, characterized in that, Includes the following steps: Using the genomic DNA of the cattle to be tested as a template, PCR amplification was performed using primer pairs to obtain amplification products; the primer pairs consist of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; The amplification product was digested with Ale I restriction endonuclease, and the results were used for identification. If the enzyme digestion product is a single band, then the genotype of the SNP molecular marker in the beef cattle to be tested is AA; If the enzyme digestion product shows two bands, then the genotype of the SNP molecular marker in the beef cattle being tested is GG. If the enzyme digestion product shows three bands, then the genotype of the SNP molecular marker in the beef cattle being tested is GA; The SNP molecular marker contains an SNP site; the SNP site is located on chromosome 17 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 71001780, and exhibits G / A polymorphism; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where R represents A or G; The beef cattle with the genotype AA of the SNP molecular marker had a higher body weight than beef cattle with the genotypes GG or GA; the beef cattle were West China cattle and / or Angus cattle.
5. A method for breeding high-weight beef cattle, characterized in that, include: The method described in claim 4 is used to detect the genotype of SNP molecular markers in the beef cattle to be tested. Beef cattle with genotypes AA and / or GA are retained for breeding, and beef cattle with genotype AA are selected from the offspring. The SNP molecular marker contains an SNP locus. The SNP locus is located on chromosome 17 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 71001780, and exhibits G / A polymorphism. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where R represents A or G. The beef cattle are West China cattle and / or Angus cattle.
Citation Information
Patent Citations
A beef cattle promoter breeding chip and its application
CN118853911B