Respiratory adenovirus nucleic acid detection kit

Abstract

The invention discloses a respiratory adenovirus nucleic acid detection kit, which comprises: an adenovirus specific primer pair containing a T7 promoter, the nucleotide sequence of which is as shown in SEQ ID NO.1-2; synchronous detection of 14 serotypes of B / C / E subgenus is realized through degenerate primers (SEQ ID NO: 1-2) of a target pIII protein gene conserved region; a double-probe bridging chromatography technology (a CES / LES probe is bridged with RNA and a color development system through a 4-5T joint) is adopted, and the sensitivity reaches 100 copies / mL; a three-line test strip (ADV-T line / internal reference-T line / C line coated specific probe) is matched, and visual interpretation is performed within 5 minutes. The total detection time is 40 min, RNA products are naturally degraded to prevent pollution, special instruments and equipment are not needed, and influenza virus nucleic acid detection can be easily popularized to basic-level and remote rural medical institutions.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of virus detection, in particular to a respiratory adenovirus nucleic acid detection kit. BACKGROUND

[0002] Adenovirus (AdV) is a non-enveloped double-stranded DNA virus, which has 56 serotypes, divided into seven subgroups A-G, among which the main ones causing respiratory tract infection are B subgroup (3, 7, 11, 14, 16, 21, 50, 55 type), C subgroup (1, 2, 5, 6, 57 type) and E subgroup (4 type), B subgroup infection has become an important factor of acute respiratory infection. Human adenovirus respiratory tract infection is prevalent worldwide and can occur throughout the year, and in China, it is common in winter and spring in the north and in spring and summer in the south, with a common incubation period of 3-8 days, the strongest infectivity being at the end of the incubation period to the acute stage, mainly showing latent infection, acute upper and lower respiratory tract infection, and a few can develop into severe pneumonia, and even death. Adenovirus pneumonia accounts for about 4%-10% of community-acquired pneumonia, and severe pneumonia is more common in type 3 and type 7. The typical symptoms of adenovirus infection of the respiratory tract are cough, nasal congestion and pharyngitis, accompanied by fever, chills, headache and muscle pain, etc., and it mainly infects children aged 6 months to 5 years, accounting for 5% to 20% of children's respiratory tract infections, with an incubation period of about a week. Adenovirus can also cause urinary tract and gastrointestinal infections in addition to respiratory tract infections, and the symptoms are similar to those of other pathogenic microorganisms, making it difficult to diagnose based on clinical manifestations, and it is very necessary to conduct laboratory diagnosis to confirm.

[0003] There are many laboratory diagnostic methods for AdV infection, which can generally be divided into laboratory isolation and culture, immunological detection, and molecular biological diagnosis. Isolation and culture is the most traditional method. While reliable, it is time-consuming and has low sensitivity; it cannot meet emergency needs and is prone to missed detection in low-load samples, thus limiting its effective clinical application. Immunological detection mainly includes immunofluorescence, enzyme-linked immunosorbent assay (ELISA), and colloidal gold assay. Immunological detection methods have moderate specificity and sensitivity, are simple and rapid, and are commonly used in clinical practice, but suffer from persistent false negative and false positive problems. Molecular biological methods mainly involve fluorescent PCR, which has high sensitivity and specificity, offering significant advantages in shortening the detection window and improving pathogen detection rates. However, PCR requires specific hardware, including dedicated PCR diagnostic laboratories and expensive equipment, hindering its widespread application in some community and remote hospitals. Additionally, isothermal amplification techniques are used for detection, with representative methods including loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and helicase-dependent amplification (HDA). LAMP and RPA offer advantages such as fast detection speed, high sensitivity, and no need for thermal cycling, making them suitable for on-site testing. However, their primer designs are complex, prone to non-specific amplification, and pose potential contamination risks. HDA technology, with its advantages of isothermal activity, high specificity, and resistance to inhibitors, has unique value in on-site testing and complex sample analysis, but its high enzyme cost, long reaction time, and lower sensitivity compared to fluorescent PCR limit its application in some scenarios.

[0004] Therefore, developing a respiratory adenovirus nucleic acid detection kit that is highly specific, sensitive, easy to operate, rapid, and inexpensive has become an urgent technical problem to be solved. Summary of the Invention

[0005] The purpose of this invention is to provide a respiratory adenovirus nucleic acid detection kit that is highly specific, has high detection sensitivity, and is simple and rapid to operate.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a respiratory adenovirus nucleic acid detection kit, the kit comprising: Adenovirus-specific primer pairs containing the T7 promoter, with nucleotide sequences shown in SEQ ID NO.1-2.

[0007] Furthermore, the kit also includes: a human 18S rRNA internal reference primer pair, the nucleotide sequence of which is shown in SEQ ID NO. 3-4.

[0008] Furthermore, the kit also includes: Detection solutions: containing 5'-thiol-modified colloidal gold-labeled probes, adenovirus-specific CES / LES probe sets, and human internal reference gene-specific CES / LES probe sets; And test strips, including: a nitrocellulose membrane and ADV-T line, internal reference-T line and C line coated thereon, wherein the ADV-T line is coated with an adenovirus-specific probe, the internal reference-T line is coated with a human internal reference probe and the C line is coated with a universal quality control probe.

[0009] Furthermore, the nucleotide sequence of the colloidal gold-labeled probe containing 5'-mercapto-modified nucleotides is shown in SEQ ID NO:10.

[0010] Furthermore, the adenovirus-specific CES probe set comprises SEQ ID NO:5 (ADV CES1) and SEQ ID NO:6 (ADV CES2). The adenovirus-specific LES probe set includes SEQ ID NO:7 (ADV LES1), SEQ ID NO:8 (ADV LES2), and SEQ ID NO:9 (ADV LES3).

[0011] The sequences described in SEQ ID NO:5-9 are optimal sequences, exhibiting high specificity and sensitivity. Furthermore, the nucleotide sequence of the adenovirus-specific probe is shown in SEQ ID NO.11, the nucleotide sequence of the human internal reference probe is shown in SEQ ID NO.12, and the nucleotide sequence of the universal quality control probe is shown in SEQ ID NO.13.

[0012] Furthermore, the kit also includes an amplification reaction solution containing Tris-HCl buffer (pH 8.0), MgCl2, KCl, DMSO, DTT, and dNTPs / NTPs.

[0013] Furthermore, the respiratory adenovirus nucleic acid detection kit can cover the following adenovirus subgenus and serotypes associated with respiratory infections: Subgenus B: Types 3, 7, 11, 14, 16, 21, 50, and 55; Subgenus C: Type 1, Type 2, Type 5, Type 6, Type 57; Subgenus E: Type 4.

[0014] The subgenus classification is based on the International Committee on Taxonomy of Viruses (ICTV) standards and covers more than 90% of respiratory adenovirus infection cases worldwide. One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: 1. This invention provides a respiratory adenovirus nucleic acid detection kit with innovative target selection and design: Gene region: Highly conserved fragments are screened from the conserved region of the pIII protein (Protein III, also known as ciliated protein) gene of adenovirus. Ten candidate sequences are tested to determine the optimal target location, covering the common conserved region of 56 serotypes in subgenus B / C / E, avoiding non-specific amplification (such as in human genomes). The patented sequence of this invention exhibits higher detection sensitivity, broader subtype coverage, and superior overall performance when detecting different adenovirus subtypes. The primer positions of this invention ensure that the sensitivity for all target serotypes remains stably at 100 copies / mL.

[0015] 2. The respiratory adenovirus nucleic acid detection kit provided by this invention has ultra-high sensitivity (breaking the detection limit): the lowest detection limit is 100 copies / mL, which is 10 times higher than the conventional kits on the market (1000 copies / mL).

[0016] The CES probe binds to the amplified RNA product at one end, and anchors to the NC membrane-coated probe at the other end via a complementary sequence, forming a fixed complex (the two parts are linked by 4-5 T links). The LES probe binds to the amplified RNA product at one end, and connects to the colloidal gold probe via a complementary sequence at the other end, triggering a colorimetric signal. Both CES and LES probes must match simultaneously for color development to occur. This dual verification ensures specificity; failure to hybridize with either probe will result in no color development.

[0017] Dual-probe bridging design (CES / LES): Achieve 5x signal amplification by combining multiple probes in parallel (e.g., ADV CES1-2 + LES1-3).

[0018] 4-5T adapter optimization: To ensure efficient binding of RNA products and probes, the multi-T adapter design ensures that the functional regions of each probe complement each other, enabling accurate hybridization and capture of the target, forming a specific hybridization complex and improving the hybridization efficiency of each probe.

[0019] 3. The respiratory adenovirus nucleic acid detection kit provided by this invention has strong specificity (zero cross-reactivity): CES / LES probes must match simultaneously for color development; failure of either probe results in no signal. Degenerate primer design: targets the conserved region of the pIII protein gene, avoiding binding to non-target sequences. It exhibits no cross-reactivity with 31 pathogens, including influenza virus, mycoplasma, and streptococci; effectively excluding non-respiratory adenoviruses (such as AdV40 / 41).

[0020] 4. Contamination prevention and reliability (reducing false positives): RNA products are easily degraded. The amplification product of this application is RNA, which degrades rapidly in the natural environment, thus preventing contamination. Furthermore, the pre-hybridization step is performed in a closed tube, avoiding aerosol contamination. The false positive rate is <0.5% (clinically validated), significantly superior to the colloidal gold immunoassay (>15%).

[0021] 5. Broad coverage (multi-serotype detection): Covers 14 serotypes in subgenera B / C / E, including AdV3 (associated with severe pneumonia) and AdV4 (associated with cluster outbreaks). 100% detection rate of 21 clinical strains (AdV1 / 2 / 3 / 4 / 5 / 7 / 55). Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a schematic diagram illustrating the principle of isothermal RNA amplification.

[0024] Figure 2 This is a diagram illustrating the color development principle of the test strips.

[0025] Figure 3 This is a schematic diagram of the test strip.

[0026] Figure 4 This is a schematic diagram of the test results. Detailed Implementation

[0027] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0028] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0029] The overall concept of this invention is as follows: To achieve the above objectives, the present invention provides an adenovirus nucleic acid kit, comprising: 1. Amplification reaction solution: Contains 40 mM Tris-HCl (pH 8.0), 12 mM MgCl2, 70 mM KCl, 15% DMSO, 5 mM DTT, 1 mM of each dNTP, 2 mM of each NTP, and 0.2 µM of each amplification primer. The amplification primers include two sets: adenovirus and human internal reference gene. Specifically: (1) Primers for amplification of adenovirus (a conserved region sequence of the pIII protein (also known as ciliated protein) of adenovirus): Adenovirus-R primer: 5' TAATACGACTCACTATAGGGAGA cccagggccttgtaaacgta-3' (underlined portion is the T7 polymerase promoter sequence) (SEQ ID NO.1); Adenovirus-F primer: 5'ACCACCGTCAGTGAAAACGT3' (SEQ ID NO.2); (4) Primers for amplifying the internal reference gene (a conserved region of human 18S rRNA): Internal reference - R primer: 5' TAATACGACTCACTATAGGGAGA CACCAGACTTGCCCTCCA3' (underlined part is the T7 polymerase promoter sequence) (SEQ ID NO.3); Internal control-F primer: 5'CAGCAGCCGCGGTAATTC3' (SEQ ID NO.4); Because adenoviruses exhibit significant differences in gene sequences among different serotypes within the same genus, this invention requires primers designed to amplify the nucleic acids of all common subtypes and prevalent strains. The R primers for adenovirus amplification are designed with degenerate bases to ensure full coverage of these prevalent strains. The 5' end of the R primers in both primer pairs incorporates the T7 RNA polymerase promoter sequence.

[0030] 2. Amplification enzymes: There are three types: reverse transcriptase (such as AMV or M-MLV), T7 RNA polymerase, and RnaseH.

[0031] 3. Cell lysis buffer: can lyse cells and release nucleic acids.

[0032] 4. Detection solution: Contains colloidal gold particle-labeled nucleic acid probes (gold probes) and specific probe salt solutions for each indicator. There are two types of specific probes for each indicator: the CES series and the LES series. Multiple probes can be designed for each of the CES and LES series, as detailed below: (1) Adenovirus-specific probe sequence ADV CES1: 5'cctgctctcacagatcacttttCTATGTATCTGTGAGT3' (SEQ ID NO: 5); ADV CES2: 5'gggacSctRccgYtRcgcttttCTATGTATCTGTGAGT3' (SEQ ID NO: 6); ADV LES1: 5'aRcagYatcSgRggagtcttttCGCAGTGCTCGAGCTCTGAGC3' (SEQ ID NO:7); ADV LES2: 5'cagcgMgtgaccRttactttttCGCAGTGCTCGAGCTCTGAGC3' (SEQ ID NO: 8); ADV LES3: 5'gacgccagacgccgcaccttttCGCAGTGCTCGAGCTCTGAGC3' (SEQ ID NO:9); (2) Human internal reference gene-specific probe sequence: Internal reference CES1: 5'AAGGAAGGCAGCAGGCttttATCTGTATAGTGTCTG3' (SEQ ID NO: 14) Internal reference CES2: 5'GCGCAAATTACCCACTttttATCTGTATAGTGTCTG3' (SEQ ID NO:15) Internal reference LES1: 5'CCCGACCCGGGGAGGTttttCGCAGTGCTCGAGCTCTGAGC3' (SEQ ID NO:16) Internal reference LES2: 5'AGTGACGAAAAATAACttttCGCAGTGCTCGAGCTCTGAGC3' (SEQ ID NO:17) Internal reference LES3: 5'AATACAGGACTCTTTCttttCCGCAGTGCTCGAGCTCTGAGC3' (SEQ ID NO:18) (3) C-line colorimetric probe 5'TCAGATCACTATGTACttttCGCAGTGCTCGAGCTCTGAGC3' (SEQ ID NO: 19); (4) Gold probe The 5' end of the gold probe is modified with thiol, and the sequence is as follows: 5'-CCTACTCTGCAGTGCTCCATCGTACGTCTGTCATTTTTGCTCAGAGCTCGAGCACTGCG-3' (SEQ ID NO: 10); 6. Test Strips: The test strips are fixed to a PVC base plate. From left to right, they consist of a sample pad, an NC membrane, and absorbent paper. The NC membrane has a T line (detection line) and a C line (control line). The test strip has three detection lines, which, in reverse order from the sample pad to the absorbent paper, are ADV-T, internal control-T, and C lines (e.g., ...). Figure 3 The ADV-T region is coated with the ADV-coated probe, the internal control-T region is coated with the internal control-coated probe, and the C-line region is coated with the C-line-coated probe. The specific sequences are as follows: ADV-coated probe: 5'ACTCACAGATACATAGttttACTCACAGATACATAG3' (SEQ ID NO: 11); Internal control coated probe: 5'CAGACACTATACAGATttttCAGACACTATACAGAT3' (SEQ ID NO:12); C-line envelope probe: 5'GTACATAGTGATCTGAttttGTACATAGTGATCTGA3' (SEQ ID NO:13); This invention provides a method for detecting adenovirus nucleic acid using "RNA isothermal amplification + gold probe chromatography", comprising the following steps: (1) RNA isothermal amplification This invention detects two indicators: adenovirus and human internal reference gene. A pair of (F / R) amplification primers is designed for each indicator, with the R primer carrying a T7 RNA polymerase promoter at its 5' end. This invention achieves the amplification of nucleic acids for each indicator within the same amplification tube, specifically as follows: During amplification, under the action of the R primer carrying the T7 promoter and reverse transcriptase, the RNA to be tested is converted into an RNA:cDNA hybrid; RNase H in the amplification enzyme digests the RNA in the RNA:cDNA to obtain single-stranded cDNA; under the action of the F primer and the DNA polymerase function of the reverse transcriptase, a second strand is synthesized, forming a double-stranded DNA carrying the T7 promoter; the double-stranded DNA carrying the T7 promoter is transcribed by T7 RNA polymerase to generate a large amount of RNA molecular products (such as...). Figure 1 ).

[0033] The purpose of this invention, which designs a human internal reference gene detection system, is to monitor the effectiveness of sample collection and the effectiveness of the amplification system. When the sample collection is qualified, the sample will definitely contain human exfoliated cells, which will definitely be detected during the test. If the sample test is negative, the internal reference should be positive; otherwise, the entire test needs to be resampled and retested.

[0034] (2) Gold probe chromatography a. Design specific probes, gold probes, and coated probes. Specific probes: Each indicator's specific probes are available in two series: CES and LES. Multiple probes of each series can be designed. The CES probe consists of two parts: one end specifically binds to the amplified RNA product, and the other end binds to a coated probe on an NC membrane, effectively immobilizing the amplified RNA. These two parts are linked by 4-5 T links. The LES probe also consists of two parts: one end specifically binds to the amplified RNA product, and the other end binds to a gold probe, enabling the gold probe to be linked for color development. These two parts are linked by 4-5 T links (e.g., ...). Figure 2 ).

[0035] Gold probe: The 5' end of the gold probe is modified with thiol group, which can form a covalent bond with the colloidal gold particles and be labeled onto the colloidal gold particles. The gold probe can bind to one end of the specific probe LES.

[0036] Coated probe: The coated probe is fixed on the NC membrane and can bind to one end of the specific probe CES to play a fixation role.

[0037] C-line chromogenic probe: One end of this probe can bind to a gold probe, and the other end can bind to a "C-line coated probe" coated on an NC membrane, playing a role in quality control of the quality control chromatography system.

[0038] The specific probes described must be designed to ensure that there is no overlap between different probes for the same index in order to guarantee the specificity of the detection.

[0039] The purpose of designing multiple CES and LES series specific probes is to improve fixation efficiency and combine more gold probes, thereby improving detection sensitivity.

[0040] b, Test strip detection The test strips used have a test line and a control line. The test line includes ADV-T and internal control-T, where the ADV-T region is coated with an ADV-coated probe that specifically binds to one end of an adenovirus CES series probe; the internal control-T region is coated with an internal control-coated probe that specifically binds to one end of an internal control CES series probe. The control line (C line) is coated with a C line-coated probe that specifically binds to a C line chromogenic probe. After hybridization of the specific probe CES, the specific probe LES, the gold probe, and the specific amplification product of the nucleic acid to be tested, the mixture is dropped onto the test strip for chromatography. Color development of the test line indicates the presence of the nucleic acid to be tested, and color development of the control line indicates a valid detection.

[0041] The respiratory adenovirus nucleic acid detection kit of this application will be described in detail below with reference to the embodiments and experimental data.

[0042] Example 1: Preparation and Use of Nucleic Acid Detection Kit I. Preparation of Nucleic Acid Detection Kits (a) Preparation of test strips The main raw materials needed to prepare nucleic acid test strips include: nitrocellulose membrane (NC membrane), sample pad, absorbent paper, and PVC base plate.

[0043] 1. Spraying film: Detection line ADV-T: coated with "ADV-coated probe", (10 μM), spraying volume: 2~3 μL / cm; the ADV-coated probe is an adenovirus-specific probe, and its nucleotide sequence is shown in SEQ ID NO.11; Detection line internal control-T: coated with "human internal control coated probe", (10 uM), spraying volume: 2~3 μL / cm; the nucleotide sequence of the human internal control probe is shown in SEQ ID NO.12; Quality control line (C line): coated with "C line coated probe", (10 μM), spraying volume: 2~3 μL / cm; the nucleotide sequence of the universal quality control probe is shown in SEQ ID NO.13; After the film is sprayed, it is automatically cross-linked once in a UV cross-linker, then dried in a clean constant temperature oven at 37°C for 2 hours, and stored in a dry environment for later use.

[0044] 2. Test strip assembly Cut 2cm lengths of absorbent paper, coated NC membrane, and sample pad, and fix them sequentially onto a PVC base plate from top to bottom to form the test strip. The assembly structure diagram of the test strip is shown below. Figure 3 .

[0045] (ii) Detection solution The 30µL detection solution was a final concentration 4×SSC salt solution containing 0.3µM of a 5'-thiol-modified colloidal gold-labeled probe (SEQ ID NO:10), an adenovirus-specific CES / LES probe set (each at a concentration of 0.03µM), and a human internal reference gene-specific CES / LES probe set (each at a concentration of 0.03µM).

[0046] The adenovirus-specific CES probe set includes SEQ ID NO:5 (ADV CES1) and SEQ ID NO:6 (ADVCES2); the adenovirus-specific LES probe set includes SEQ ID NO:7 (ADV LES1), SEQ ID NO:8 (ADV LES2), and SEQ ID NO:9 (ADV LES3). (III) Preparation of RNA isothermal amplification reaction solution The 17 μL amplification reaction solution contained 40 mM Tris-HCl (pH 8.0), 12 mM MgCl2, 70 mM KCl, 15% DMSO, 5 mM DTT, 1 mM of each dNTP, 2 mM of each NTP, and 0.2 µM of each amplification primer. The primer sequences are SEQ ID NO: 1-4. Nucleic acid extract: Viral RNA molecules were released by lysing cells using cell lysis buffer to obtain nucleic acid extract, which was used as a sample RNA template, in a volume of 2 μL; Amplification enzyme mixture (2.5 μL): Each reaction contains three enzymes: AMV reverse transcriptase 6 U (or M-MLV 100 U), T7 RNA polymerase 32 U, and Rnase H 0.02 U.

[0047] II. Instructions for using the nucleic acid test kit 1. Nucleic acid extraction Pharyngeal swab samples were collected from patients suspected of adenovirus infection, and viral RNA molecules were released by lysis using cell lysis buffer.

[0048] 2. Isothermal RNA amplification Add 2 µL of nucleic acid extract to 17 µL of amplification reaction solution containing adenovirus and internal control primers, heat at 95 °C for 2 minutes, preheat at 42 °C for 2 minutes, add 2.5 µL of amplification enzyme, and amplify at 42 °C for 30 minutes. If adenovirus nucleic acid is present in the sample to be tested, the indicator RNA molecule will be amplified and enriched in large quantities during amplification.

[0049] 3. Test strip chromatography 21.5 µL of isothermal RNA amplification product was mixed with 30 µL of detection solution (including specific probes and gold probes). The amplified RNA molecules bind to the specific probes (including CES series probes and LES series probes) through complementary pairing. One end of the CES series probe hybridizes and pairs complementaryly with the RNA molecule, while the other end binds to the coated probe on the NC membrane. One end of the LES series probe hybridizes and pairs complementaryly with the RNA molecule, while the other end can bind complementaryly with the gold probe. When amplification products are present, a "CES probe-RNA molecule-LES probe-gold probe complex" can be formed.

[0050] The mixed product is dropped onto the sample pad of the test strip. The mixed product will chromatographically migrate along the NC membrane towards the absorbent paper. When the target RNA amplification product is present, the resulting "CES probe-RNA molecule-LES probe-gold probe complex" will be intercepted by the coated probe on the NC membrane during chromatography, forming a visible band. This indicates a positive result (e.g., ...). Figure 4 (Positive result), the entire chromatography detection process takes only 5 minutes, making it convenient and quick.

[0051] If no RNA product is amplified, the "CES probe-RNA molecule-LES probe-gold probe complex" will not form, and the colloidal gold particles will not aggregate at the T line, thus failing to form a visible band, which is a negative result (e.g.). Figure 4 Negative).

[0052] Regardless of whether the RNA product to be tested is amplified, the C-line chromogenic probe will flow forward along the NC membrane. When it reaches the C-line, it binds to the sequence coated at the C-line, thus remaining at the C-line and forming a visible colored band, which indicates that the experimental result is valid.

[0053] This invention utilizes isothermal RNA amplification to detect various adenovirus subtypes (including genera B, C, E, and others) within the same tube. The amplified nucleic acid product is RNA, which is easily degraded in the natural environment, making it easier to prevent contamination compared to DNA amplification via PCR. The isothermal RNA amplification is performed at 42°C, allowing the amplification reaction to be achieved even in a water bath, thus minimizing the requirements for experimental equipment.

[0054] Because adenovirus sequences exhibit significant variation, the primers designed in this invention must be able to amplify the nucleic acids of all common subtypes and circulating strains. The selected gene regions are relatively conserved, and the adenovirus R primers are designed with degenerate bases to provide full coverage of circulating adenovirus strains. Furthermore, the primers in this invention underwent multiple rounds of testing during design to ensure high amplification efficiency for each individual primer, no interference between different primers, and good overall amplification results.

[0055] This invention incorporates the CES and LES series of specific probes, which act as bridging molecules. These two probes successfully tandemly bind the amplification probe and the RNA nucleic acid amplification fragment, enabling specific detection of the indicator RNA nucleic acid fragment. This use of two sets of probes ensures that if either set fails to hybridize with the indicator nucleic acid amplification fragment, it cannot be successfully immobilized on the NC membrane, resulting in no positive detection result and guaranteeing the specificity of the detection. Each set of probes can be designed with more than two probes, further enhancing the sensitivity of the test strip.

[0056] This invention employs isothermal RNA amplification technology and test strip chromatography technology, leveraging the low instrument requirements of isothermal RNA amplification while successfully integrating the rapid characteristics of colloidal gold. Nucleic acid detection using test strips allows for result interpretation in approximately 5 minutes. The operation is also very simple, requiring minimal technical expertise from laboratory personnel.

[0057] Experiment Example 1: Sensitivity Test The pathogen at known concentrations was serially diluted, with each dilution performed 20 times. The lowest viral nucleic acid concentration with a 90%–95% positive detection rate was defined as the limit of detection. The detection results are as follows: Table 1. Detection results of Adv-1 minimum detection limit

[0058] Table 2. Detection results of the lowest detection limit of Adv-3

[0059] Table 3. Detection results of the lowest detection limit for Adv-4

[0060] The detection sensitivity of the kit of the present invention was finally determined to be: Table 4

[0061] This kit has a high sensitivity (100 copies / mL), which exceeds the sensitivity of conventional nucleic acid detection kits on the market (1000 copies / mL).

[0062] Experimental Example 2: Specificity Verification 1. Test strain Nucleic acid was extracted from different microorganisms and detected to verify the effectiveness of the kit of this invention. The results are as follows: Table 5 Information on specificity verification test strains

[0063] The test results of the kit of the present invention for these microorganisms were all negative, which proves that there is no cross-reaction between the kit of the present invention and other microorganisms, demonstrating that the kit has high specificity for detecting pathogens.

[0064] Experiment Example 3: Pathogen Detection Capability Verification The kit of this invention was used to detect 21 clinically positive adenovirus samples diluted to the detection limit (300 copies / mL) to verify the kit's ability to detect different types of adenovirus.

[0065] Table 6 Pathogen Information

[0066] The results above show that this kit has a good detection capability for common influenza virus subtypes.

[0067] Experimental Example 4: Validation of Clinical Samples Batch clinical sample validation was conducted, selecting 641 clinical samples, including 351 males and 290 females. The oldest patient was 93 years old, the youngest was 14 days old, and the average age was 18.49 years. All clinical symptoms were consistent with the intended use. Among them, 231 cases (36.0%) had pneumonia-related symptoms, 127 cases (19.8%) had respiratory infection-related symptoms, 105 cases (16.4%) had cough-related symptoms, 97 cases (15.1%) had bronchitis-related symptoms, 46 cases (7.2%) had fever-related symptoms, and 35 cases (5.5%) had other symptoms.

[0068] During testing, the kit of this invention and a commercially available adenovirus real-time PCR kit were used simultaneously to detect the samples. The test results were summarized into a four-fold table, as follows: Table 7

[0069] For the two inconsistent samples, further testing and identification by a third party showed that the test results were completely consistent with the results of the reagent of this invention. A commercially available adenovirus real-time PCR kit missed one case and had one false positive. Obviously, the reagent of this invention has higher sensitivity and specificity for detecting clinical samples.

[0070] The 165 positive samples were classified and identified, including 95 ADV3 positive samples, 58 ADV2 positive samples, and 32 ADV1 positive samples. These 165 samples corresponded one-to-one with the detection results of this kit, indicating that the kit of this invention has good coverage of adenovirus subtypes.

[0071] Experiment Example 5: Comparison of primer sequence performance at other positions of adenovirus pIII protein The adenovirus primers screened in this application were designed in the conserved region of the pIII protein gene. These primers exhibit high sensitivity and specificity for detection and can cover all ADV subtypes. Other primers were also designed in the same region, and their performance was compared.

[0072] The comparison sequence information is shown in Table 8: Table 8

[0073] Replace the ADV-F / R primers in this application with ADV-F1 / R1 and ADV-F1 / R1 respectively, and use the patented RNA isothermal amplification and test strip chromatography conditions to detect the following indicators: Table 9

[0074] As shown in Table 9, the sequence of this invention has higher detection sensitivity, covers a wider range of subtypes, and has better overall performance when detecting different subtypes of adenovirus.

[0075] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0076] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0077] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, Therefore, this invention also intends to include these modifications and variations.

Claims

1. A respiratory adenovirus nucleic acid detection kit, characterized in that, The kit includes: Adenovirus-specific primer pairs containing the T7 promoter, with nucleotide sequences shown in SEQ ID NO.1-2.

2. The respiratory adenovirus nucleic acid detection kit according to claim 1, characterized in that, The kit also includes: a human 18S rRNA internal reference primer pair, the nucleotide sequence of which is shown in SEQ ID NO.3-4.

3. The respiratory adenovirus nucleic acid detection kit according to claim 1, characterized in that, The kit also includes: Detection solutions: containing 5'-thiol-modified colloidal gold-labeled probes, adenovirus-specific CES / LES probe sets, and human internal reference gene-specific CES / LES probe sets; And test strips, including: a nitrocellulose membrane and ADV-T line, internal reference-T line and C line coated thereon, wherein the ADV-T line is coated with an adenovirus-specific probe, the internal reference-T line is coated with a human internal reference probe and the C line is coated with a universal quality control probe.

4. The respiratory adenovirus nucleic acid detection kit according to claim 3, characterized in that, The nucleotide sequence of the colloidal gold-labeled probe containing 5'-thiol modification is shown in SEQ ID NO:

10.

5. A respiratory adenovirus nucleic acid detection kit according to claim 3, characterized in that, The adenovirus-specific CES probe set includes SEQ ID NO:5 (ADV CES1) and SEQ ID NO:6 (ADV CES2).

6. A respiratory adenovirus nucleic acid detection kit according to claim 3, characterized in that, The adenovirus-specific LES probe set includes SEQ ID NO:7 (ADV LES1), SEQ ID NO:8 (ADV LES2), and SEQ ID NO:9 (ADV LES3).

7. A respiratory adenovirus nucleic acid detection kit according to claim 3, characterized in that, The nucleotide sequence of the adenovirus-specific probe is shown in SEQ ID NO.

11.

8. A respiratory adenovirus nucleic acid detection kit according to claim 3, characterized in that, The nucleotide sequence of the human internal reference probe is shown in SEQ ID NO.

12.

9. A respiratory adenovirus nucleic acid detection kit according to claim 3, characterized in that, The nucleotide sequence of the universal quality control probe is shown in SEQ ID NO.

13.

10. A respiratory adenovirus nucleic acid detection kit according to claim 1, characterized in that, The kit also includes RNA isothermal amplification reaction solution: containing Tris-HCl buffer (pH 8.0), MgCl2, KCl, DMSO, DTT, and dNTPs / NTPs.

Images