Eimeria gene editing system, recombinant coccidiosis vector and application of recombinant coccidiosis vector

Abstract

The invention discloses an eimeria gene editing system, a recombinant coccidium vector and application of the recombinant coccidium vector. The invention firstly provides the sgRNA targeting the ETH00010755 gene and the gene editing system containing the sgRNA, and the sgRNA and the gene editing system can realize high-efficiency and high-specificity gene editing. A donor plasmid template containing His4 and EtU6 promoters is constructed, compared with an original plasmid template, the donor plasmid template has the advantages that the positive rate is higher, an exogenous gene can be accurately inserted into an ETH00010755 gene, the unspecific gene editing risk can be avoided through the gene editing plasmid, and the high editing efficiency and the low off-target rate are achieved. The gene editing system, the recombinant coccidiosis vector and the construction method of the recombinant coccidiosis vector are mature, reliable and easy to operate and have high success rate and repeatability, and the obtained recombinant coccidiosis vector can be applied to preparation of immune drugs and / or vaccines for preventing eimeria.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to an Eimeria coccidia gene editing system, a recombinant coccidia vector, and their applications. Background Technology

[0002] Coccidiosis in chickens is a serious disease caused by Eimeria species, which can lead to subclinical infections and even death in persistently infected flocks. It results in decreased feed conversion ratio, reduced weight gain, lower egg production, and decreased reproductive performance. Persistent Eimeria infection can cause intestinal mucosal shedding and increase susceptibility to secondary bacterial infections. Eimeria tenella, which parasitizes the cecum, often causes acute cecal coccidiosis, primarily affecting chicks aged 3-6 weeks. The parasites reside in the cecal and rectal mucosa, damaging the cecal mucosal barrier and causing intestinal microbial imbalance. After infection with Eimeria tenella, lesions appear on the cecal mucosa, with visible dark red petechiae. When the coccidia invade intestinal cells, they multiply rapidly in the intestinal mucosal epithelial cells, leading to severe damage to the intestinal mucosa, cecal wall edema and cellular infiltration, and later, thickened scar tissue. Blood clots or yellow, cottage cheese-like necrotic material appear in the cecum. In severely affected chickens, the cecum is filled with blood clots and plugs formed from solidified viscous exudate, obstructing the intestinal lumen. Coccidiosis infection in chicken flocks can lead to stunted growth, uneven development, and reduced feed conversion rates, placing enormous pressure on production management.

[0003] The CRISPR / Cas9 system for prokaryotes is a widely used gene-editing tool in various organisms, including protozoan parasites such as Toxoplasma gondii, Plasmodium, and Trypanosoma. While genetic editing techniques for parasites like Toxoplasma gondii and Plasmodium are relatively mature, genetic modification techniques for Eimeria tenella remain relatively underdeveloped due to the lack of effective in vitro tissue culture modalities and effective selection markers. Although reverse genetics techniques for Eimeria tenella are quite advanced, targeting to specific sites is limited because exogenous DNA in the apical complex often undergoes recombination through non-homologous integration into the chromosome. Therefore, developing an alternative method for precise gene targeting in Eimeria tenella is essential. The CRISPR / Cas9 system achieves precise gene modification in target sequences homologous to SgRNA by introducing site-specific double-stranded DNA breaks (DSBs) with Cas9 endonucleases. In the presence of a DNA donor template, DSBs can be repaired via direct homology repair (HDR). Patent CN 114181939 A demonstrates that the CRISPR / Cas9 system is also suitable for targeted gene editing in *Eimeria tenella*. However, its transfection efficiency is low (especially co-transfection), which may be a factor contributing to the low efficiency of the CRISPR / Cas9 system in *Eimeria tenella* gene editing. Furthermore, the plasmid template pSAG1-CAS9-U6-sgUPRT, commonly used in *Toxoplasma gondii* gene editing, showed a low positive rate in the construction of recombinant coccidia vectors, and its specificity still needs improvement. Therefore, further optimization of the transfection system is crucial for improving the efficiency of *Eimeria tenella* gene editing. Summary of the Invention

[0004] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide an Eimeria coccidia gene editing system.

[0005] A second objective of this invention is to provide a recombinant coccidia vector.

[0006] A third objective of this invention is to provide the application of the Eimeria coccidia gene editing system and the recombinant coccidia vector.

[0007] The above-mentioned objective of the present invention is achieved through the following technical solution:

[0008] The present invention first provides an sgRNA targeting the ETH_00010755 gene of Eimeria coccidia, the nucleotide sequence of which is shown in SEQ ID No.1: ggatgtgcagggaagaggtg.

[0009] This invention investigates the ETH_00010755 gene of Eimeria coccidia and successfully uses the designed sgRNA for gene editing, achieving efficient and specific gene editing.

[0010] The present invention also provides a gene editing system for Eimeria coccidia ETH_00010755, wherein the ETH_00010755 gene editing system includes sgRNA targeting the Eimeria coccidia ETH_00010755 gene.

[0011] Furthermore, the Eimeria coccidia ETH_00010755 gene editing system also includes Cas9 nuclease and homologous recombinant plasmid.

[0012] Furthermore, the sgRNA targeting the Eimeria coccidia ETH_00010755 gene is linked to the Cas9 nuclease in the same gene-editing plasmid.

[0013] Preferably, the method for linking the sgRNA of the coccidia ETH_00010755 gene and the Cas9 nuclease in the same gene editing plasmid is to amplify the sgRNA of the coccidia ETH_00010755 gene and the coding sequence of Cas9 by PCR, and then link them to obtain a gene editing plasmid containing the sgRNA of the coccidia ETH_00010755 gene and Cas9.

[0014] Furthermore, the gene editing plasmid includes the His4Nls promoter and the EtU6 promoter, and is pHis4Nls-eSpCas9-EtU6-sgRNA. The nucleotide sequence of the gene editing plasmid is shown in SEQ ID No. 2.

[0015] The gene-editing plasmid provided by this invention replaces the promoter of the original plasmid pSAG1-CAS9-U6-sgUPRT with promoters His4 and EtU6 to make it more suitable for gene editing in coccidia. Compared with the plasmid template pSAG1-CAS9-U6-sgUPRT, the gene-editing plasmid constructed by this invention has a higher positive rate when used to construct recombinant coccidia vectors, indicating that it has higher specificity.

[0016] Preferably, the gene editing plasmid is constructed by replacing the Toxoplasma gondii TgU6 promoter with the Coccidia ectenes EtU6 promoter on the original template plasmid pSAG1-CAS9-U6-sgUPRT, amplifying the His4Nls, eSpCas9 fragments and linearized vector by PCR, performing seamless cloning, and ligating the fragments and vector to construct the complete gene editing plasmid pHis4Nls-eSpCas9-EtU6-sgRNA.

[0017] Furthermore, the homologous recombination plasmid includes a fluorescent tag gene.

[0018] Preferably, the fluorescent tag gene is the mCherry fluorescent protein gene.

[0019] Preferably, the homologous recombination plasmid includes the 5' homologous arm of the ETH_00010755 gene, the SAG13 promoter, the mCherry fluorescent protein gene, the SAG13 terminator, and the 3' homologous arm of the coccidia ETH_00010755 gene; the nucleotide sequence of the homologous recombination plasmid is shown in SEQ ID No. 8.

[0020] Preferably, the method for constructing the homologous recombination plasmid involves sequentially ligating the 5H homologous arm, SAG13 promoter, mCherry fluorescent protein gene, SAG terminator, and 3H homologous arm using snapgene software to obtain a complete donor fragment map. The complete fragment is then constructed into a cloning vector to obtain the homologous recombination plasmid; using the obtained homologous recombination plasmid as a template, the homologous recombination fragment is amplified by PCR.

[0021] The present invention also provides a recombinant coccidia vector containing the sgRNA that targets the ETH_00010755 gene of Eimeria tenella.

[0022] Furthermore, the recombinant coccidia vector contains any of the above-described Eimeria coccidia ETH_00010755 gene editing systems.

[0023] Furthermore, the recombinant coccidia vector is a coccidia vector that integrates a fluorescent tag gene into the ETH_00010755 gene after being edited by any of the above-mentioned Eimeria coccidia ETH_00010755 gene editing systems.

[0024] Preferably, the method for constructing the recombinant coccidia vector is to introduce the gene-editing plasmid containing the sgRNA and Cas9 targeting the coccidia gene and the homologous recombination fragment into sporozoites of Eimeria tenella via electroporation, infect animals with the sporozoites, screen for positive clones, and obtain positive coccidia vectors, which are the recombinant coccidia vectors.

[0025] Preferably, the positive clones are selected based on fluorescent tag genes on homologous recombination fragments to obtain positive clone vectors.

[0026] Furthermore, the present invention also provides a method for detecting the recombinant coccidia vector, wherein the method comprises extracting DNA and total RNA from the positive coccidia vector, performing PCR detection, verifying successful expression of the mCherry fluorescent protein gene, and proving that the recombinant coccidia vector expressing the fluorescent tag protein has been successfully constructed.

[0027] This invention provides the use of any of the above-described recombinant coccidia vectors in the preparation of immunomodulatory drugs and / or vaccines for the prevention of Eimeria coccidia.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] This invention first provides an sgRNA targeting the ETH_00010755 gene and an ETH_00010755 gene editing system containing this sgRNA, which enables efficient and specific gene editing. Furthermore, this invention optimizes the gene editing plasmid in the gene editing system for *Eimeria tenella*, constructing a donor plasmid template containing His4 and EtU6 promoters. Compared to the original plasmid template, this plasmid has a higher positive rate and can precisely insert exogenous genes into the ETH_00010755 gene of *Eimeria tenella*. This gene editing plasmid avoids the risk of non-specific gene editing, achieving high editing efficiency and low off-target rate. On the other hand, the homologous substitution fragments designed in this invention, ranging from 500-1000 kb, can successfully undergo homologous recombination, inserting exogenous marker genes into the target site to obtain recombinant coccidia vectors expressing fluorescently labeled proteins. The ETH_00010755 gene editing system, recombinant coccidia vector, and their construction method provided by this invention are mature, reliable, easy to operate, and have high success rate and reproducibility. The obtained recombinant coccidia vector can be used in the preparation of immunosuppressive drugs and / or vaccines for the prevention of Eimeria coccidia. Attached Figure Description

[0030] Figure 1 The results are PCR amplification results of the His4Nls fragment; where M is the DL 2000 Marker and 1 is the amplification product of the eSpcas9 fragment.

[0031] Figure 2 The results are PCR amplification results of the eSpcas9 fragment; where M is the DL 5000 Marker, and 1-2 are the amplification products of the eSpcas9 fragment.

[0032] Figure 3 The results are PCR amplification results of the linearized vector pSAG1-CAS9-EtU6-sgUPRT; where M is DL5000 Marker, and 1-2 are the amplification products of the linearized vector pSAG1-CAS9-EtU6-sgUPRT.

[0033] Figure 4 The results of PCR identification of the recombinant plasmid pHis4Nls-eSpCas9-EtU6-sgRNA are shown; where M is the DL10000 Marker and 1-5 are positive plasmid amplification products.

[0034] Figure 5The results of Sal I restriction enzyme digestion identification of the knockout plasmid pHis4Nls-eSpcas9-EtU6-sgRNA are shown; where M is the DL 1kb Marker, and 1-4 are the enzyme digestion products.

[0035] Figure 6 This is a comparison map of single colony sequencing and plasmid sequences of pHis4Nls-eSpcas9-EtU6-sgRNA; the white-filled portion represents the sgRNA sequence.

[0036] Figure 7 Image of a recombinant coccidia vector (magnification = 400x).

[0037] Figure 8 The results are for the DNA and RNA validation of the mCherry fluorescent gene of recombinant coccidia; where M is DL1000 DNA Marker, 1 is recombinant coccidia DNA, 2 is EtMZ DNA, 3 is positive plasmid, 4 is recombinant coccidia cDNA, and "-" indicates negative. Detailed Implementation

[0038] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0039] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0040] Example 1

[0041] This embodiment provides a gene editing system for Eimeria coccidia ETH_00010755, which includes sgRNA, Cas9, and homologous recombination fragments targeting the ETH_00010755 gene of Eimeria coccidia; the nucleotide sequence of the sgRNA is as shown in SEQ ID No.1: ggatgtgcagggaagaggtg.

[0042] The NCBI number of the ETH_00010755 gene is XM_013377271.1. The target site of the sgRNA targeting the coccidia ETH_00010755 gene is located in the ETH_00010755 gene. The sgRNA targeting the coccidia ETH_00010755 gene is linked to the Cas9 in the same gene editing plasmid.

[0043] The gene-editing plasmid was prepared by the following method:

[0044] 1. Construction of the knockout plasmid template pHis4Nls-eSpCas9-EtU6-sgRNA

[0045] Based on the commercially available plasmid template pSAG1-CAS9-U6-sgUPRT, a template plasmid containing the promoters His4 and U6 was constructed to better suit gene editing in coccidia.

[0046] 1.1 Replace the Toxoplasma gondii TgU6 promoter with the Coccidia trachomatis EtU6 promoter.

[0047] 1.1.1 Obtaining the inserted fragment EtU6:

[0048] Using Eimeria tenella genomic DNA as a template, upstream and downstream primers were designed as EtU6+A3-F (sequence: GCTGCAGTGCGTTGCAAGA) and EtU6+A3-R (sequence: ATCCTCTTAACCCACTCTCGTACAG). PCR amplification was performed, and the reaction system is shown in Table 1.

[0049] Table 1 PCR amplification reaction system

[0050]

[0051]

[0052] The PCR amplification reaction procedure is shown in Table 2:

[0053] Table 2. PCR amplification reaction procedures

[0054]

[0055] 1.1.2 Obtaining the linearized vector: Using plasmid pSAG1-CAS9-U6-sgUPRT as a template, primers for the linearized vector were designed as ΔU6-line-F and ΔU6-line-R, respectively. The linearized vector fragment was obtained by PCR amplification. The system and procedure were the same as those in Tables 1 and 2. The primer sequences are shown below:

[0056] ΔU6 line-F: ggcgtctcgattgtgagagc; ΔU6 line-R: gatccactagttctaga.

[0057] 1.1.3 Recombination Reaction: The linearized vector and the insert fragment were mixed in a specific ratio, and the recombination reaction was completed under the catalysis of the recombinase system. The reaction system is shown in Table 3:

[0058] Table 3 Recombination Reaction System

[0059]

[0060] After adding all the ingredients, incubate at 37°C for 30 minutes, then cool to 4°C.

[0061] Add 10 μL of recombinant product to 100 μL of competent cells, mix well, incubate on ice for 30 min, then heat shock in a 42℃ water bath for 45 s, followed by an ice bath for 2 min. Add 900 μL of antibiotic-free SOC medium, incubate at 37℃ with shaking at 200 rpm for 1 h, centrifuge at 5000 rpm for 5 min, and discard the 900 μL supernatant. Resuspend the bacterial cells in the remaining medium, and gently spread them evenly on an Amp-resistant plate using a sterile spreader. Incubate upside down in a 37℃ incubator for 12 h. Pick single colonies, culture them in liquid medium containing Amp resistance, and then amplify and identify them using universal primer M13. Perform PCR identification on the amplified products. Take 1 mL of bacterial culture for preservation, and extract plasmids from the remaining bacterial culture; this is the positive plasmid, pSAG1-CAS9-EtU6-sgUPRT.

[0062] 1.2 pSAG1-CAS9-EtU6-sgUPRT was constructed into pHis4Nls-eSpCas9-EtU6-sgUPRT

[0063] 1.2.1 Obtaining the inserted fragments His4Nls and eSpcas9:

[0064] Using Eimeria tenella genomic DNA as a template, primers HisNls-F and HisNls-R were designed, respectively. Using the GenScript synthetic strain espcas9 as a template, upstream and downstream primers eSpCas9-F and eSpCas9-R were designed, respectively. The primer sequences are shown below:

[0065] HisNls-F:TCACACAGACGGGCATTTGCT;

[0066] HisNls-R: GATACCCTGGATGTTGTCGCG;

[0067] eSpCas9-F:GACAAGAAGTACAGCATCGGCC;

[0068] eSpCas9-R: TGGGCCAGGATTCTCCTCGA.

[0069] Fragments were obtained through PCR amplification and gel recovery. The PCR amplification results for the His4Nls and eSpcas9 fragments are shown below. Figure 1 , 2 As shown.

[0070] 1.2.2 Obtaining the linearized vector: Linearization primers were designed using pSAG1-CAS9-EtU6-sgUPRT as a template, namely the reverse cas9 line-F and the reverse TgSAG1p line-R. The primer sequences are shown below:

[0071] Reverse CAS9 line -F: gcctatccctatgacgtgccc; Reverse TgSAG1p line -R: cgataccgtcgacctcgagg.

[0072] The linearized fragment was obtained by PCR amplification and gel extraction. The PCR amplification results of the linearized vector pSAG1-CAS9-EtU6-sgUPRT are as follows. Figure 3 As shown.

[0073] 1.2.3 Recombination reaction

[0074] The linearized vector and the insert fragment were mixed in a specific ratio, and the recombination reaction was completed under the catalysis of a recombinase system. The reaction system is shown in Table 4.

[0075] Table 4. Reaction system for recombination reaction

[0076]

[0077] The subsequent reaction process is the same as in step 1.1.3, and the PCR identification results of the homologous recombination products are as follows. Figure 4 The homologous recombination product is pHis4Nls-eSpcas9-EtU6-sgUPRT.

[0078] 2. PCR amplification of the sgRNA and Cas9 coding sequences of the target coccidia ETH_00010755 gene:

[0079] 2.1 Using CRISPR-F and CRISPR-R as primers and pHis4Nls-eSpcas9-EtU6-sgUPRT plasmid as template, PCR reaction was performed using the Q5 site-directed mutagenesis kit to obtain PCR products.

[0080] The primer sequences are shown below:

[0081] CRISPR-F: ggatgtgcagggaagaggtggttttagagctagaaatagc;

[0082] CRISPR-R:ATCCTCTTAACCCACTCTCG.

[0083] The PCR amplification reaction system is shown in Table 5:

[0084] Table 5. Reaction system for PCR amplification

[0085]

[0086] The PCR amplification reaction procedure is shown in Table 6:

[0087] Table 6. PCR amplification reaction procedures

[0088]

[0089] After obtaining the Q5 mutant product, it was digested with DPnⅠ restriction enzyme. The enzyme was inactivated by digestion in a hot water bath at 37℃ for 2 hours and then in a water bath at 85℃ for 20 minutes.

[0090] 2.2 Connection:

[0091] Using the PCR products described above, KLD reaction was performed according to the instructions on the Q5 site-directed mutagenesis kit. The amplified products were then circularized and ligated. The reaction system is shown in Table 7.

[0092] Table 7 Reaction System

[0093]

[0094]

[0095] Prepare the above system using 200 μL centrifuge tubes and incubate at 28°C for 30 min.

[0096] Transform 5 μL of the KLD reaction product into DH5α competent cells, plate them on Amp+ resistant solid medium plates, and incubate overnight at 37°C inverted. Pick 5 single colonies for Sal I restriction enzyme digestion verification. The results of the digestion product after 1% agarose gel electrophoresis are as follows. Figure 5 As shown, two bands appearing in the enzyme digestion product, with sizes of 6.0kb and 3.7kb respectively, indicate a positive recombinant plasmid. The bacterial culture was sent for sequencing, and the sequencing results showed that the sgRNA was successfully ligated into the vector. Its nucleotide sequence is shown in SEQ ID No. 2, and the sequence alignment results are as follows. Figure 6 .

[0097] 3. The process of constructing homologous recombination fragments includes the following steps:

[0098] The donor fragments were sequentially ligated using snapgene software, consisting of the 5' homologous arm of the coccidia ETH_00010755 gene, the SAG13 promoter, the mCherry fluorescent protein gene, the SAG13 terminator, and the 3' homologous arm of the coccidia ETH_00010755 gene. All fragments and the vector plasmid were then ligated using a seamless cloning kit to construct the recombinant plasmid.

[0099] 3.1 Origin of 5H and 3H homologous arm sequences: 5H is derived from the first 1000 bp of the 5' region of the sgRNA, and 3H is derived from the last 1000 bp of the 3' region of the sgRNA. Genomic DNA was extracted from *Eimeria tenella* (EtMZ). Using the EtMZ parental strain as a template, the 5H and 3H fragments were amplified by PCR using primers 5H-F, 5H-R, and 3H-F, 3H-R, respectively, and then recovered by gel extraction. The primer sequences are shown below:

[0100] 5H-F:TTCTATTCCACTCGTTTCTCGTGCCT;

[0101] 5H-R: GCTAGTGGTCAATGCATTGTGGTGTAT;

[0102] 3H-F: TGGCGGAAGATTGTCCAAGCT;

[0103] 3H-R:GCCGTAGAACCTGGAGAACCTG.

[0104] The sequences of the amplified products of the 5H and 3H homologous arms are shown in SEQ ID No. 3 and SEQ ID No. 4.

[0105] 3.2 Amplification of the SAG13 promoter sequence and the SAG terminator sequence:

[0106] Using SAG13-F and SAG13-R, SAGter-F and SAGter-R as primers, and the genome of *Eimeria tenella* as a template, a PCR reaction was performed. The amplification system and procedure were the same as those used in the construction of the gene-editing plasmid. The primer sequences are shown below:

[0107] SAG13-F: gatcccattaactcaacaggctcac; SAG13-R: gctttctgtgtttttccgca;

[0108] SAGter-F: Atttcgcgaagggcgtcaaac; SAGter-R: TCCTCCACCTTTCGCTGCT.

[0109] The SAG13 promoter sequence and the SAG terminator amplification product sequence are shown in SEQ ID No. 5 and SEQ ID No. 6.

[0110] 3.3 Amplification of mCherry sequence:

[0111] Using mCh-F and mCh-R as primers, the mCherry sequence was obtained through NCBI and sent to a gene company for synthesis. The synthesized bacterial culture was then used as a template for PCR. The amplification system and procedure were the same as those used in constructing the gene-editing plasmid. The primer sequences are shown below:

[0112] mCh-F: ATGGTGAGCAAGGGCGAGGA;

[0113] mCh-R:TTACTTGTACAGCTCGTCCATGC.

[0114] The amplified product mCherry sequence is shown in SEQ ID No. 7.

[0115] 3.4 Recombination reaction:

[0116] The linearized vector and gene fragments were mixed in proportion, and the recombination reaction was completed under the catalysis of a recombinase system. The reaction system is shown in Table 8.

[0117] Table 8 Reaction System

[0118]

[0119] The reaction conditions were: 37℃, reaction time 30 min.

[0120] Add 10 μL of the recombinant product to 100 μL of competent cells, mix well, incubate on ice for 30 min, then heat shock in a 42℃ water bath for 45 s, followed by an ice bath for 2 min. Add 900 μL of antibiotic-free SOC medium, incubate at 37℃ with shaking at 200 rpm for 1 h, centrifuge at 5000 rpm for 5 min, and discard the 900 μL supernatant. Resuspend the bacterial cells in the remaining medium, and gently spread them evenly on an Amp-resistant plate using a sterile spreader. Incubate upside down in a 37℃ incubator for 12 h. Pick single colonies, culture them in liquid medium containing Amp resistance, and then amplify and identify them using universal primers for the PUC19 vector. Perform PCR identification on the amplified products. Take 1 mL of bacterial culture for preservation, and extract plasmids from the remaining bacterial culture; these are the positive plasmids, i.e., the homologous recombinant plasmids.

[0121] 3.5 Amplification of homologous recombination fragments:

[0122] Using 5H-F (sequence: TTCTATTCCACTCGTTCTCGTGCCT) and 3H-R (sequence: GCTAGTGGTCAATGCATTGTGGTGTAT) as primers and homologous recombinant plasmid as template, PCR was performed. The amplification system and procedure were the same as those used in the construction of the gene-editing plasmid. The sequence of the amplified product is shown in SEQ ID No. 8.

[0123] Example 2

[0124] This embodiment provides a recombinant coccidia vector, which is a coccidia vector that integrates the mCherry gene into the coccidia ETH_00010755 gene after being edited by the coccidia ETH_00010755 gene editing system described in Example 1.

[0125] The method for constructing the recombinant coccidia vector is as follows:

[0126] (1) Extract a suspension of 1 million fresh coccidia sporozoites and resuspend the sporozoites in a 4 mm electroporation cup using electroporation buffer.

[0127] (2) Add the gene editing plasmid and homologous recombination fragment from Example 1 to the electrolysis solution, gently pipette to mix them, and incubate on ice for 20 minutes;

[0128] (3) Place the electroporation cup in the BTX electroporator and give it 2 to 4 shocks under the conditions of 2000V voltage, 25μF capacitance and 50Ω resistance;

[0129] (4) After electroporation, use a 1mL syringe (with the needle removed) to draw up the sporozoite suspension after electroporation, dip it in glycerol, and inoculate it into 3-day-old SPF chickens through the cloaca. Collect feces 7-10 days after infection, purify the oocysts and perform sporulation.

[0130] (5) After oocyst sporulation for 24 hours, fluorescence microscopy was performed to observe coccidia that emitted red fluorescence, which were the coccidia vectors of the recombinant gene.

[0131] Positive clones were screened using a flow cytometry system to obtain positive coccidia vectors, which are the recombinant coccidia vectors, representing first-generation recombinant coccidia sporulated oocysts. The recombinant coccidia vectors are as follows: Figure 7 As shown.

[0132] Example 3

[0133] This embodiment provides a method for detecting recombinant coccidia vectors, using the method to detect DNA and RNA in the recombinant coccidia vector from Example 2. The detection steps are as follows:

[0134] (1) Identification of recombinant coccidia DNA and RNA:

[0135] Two million fresh recombinant coccidia vector oocysts were collected, and coccidia genomic DNA was extracted using the Promega Genome Extraction Kit. RNA was extracted from the coccidia using the RNAeasy Animal RNA Extraction Kit according to its instructions, and then cDNA was synthesized using the BeyoRT II cDNA Synthesis Kit (with gDNA Eraser). PCR amplification was performed using mCh-F and mCh-R primers to identify the fluorescent protein gene. The primer sequences are as follows:

[0136] mCh-F: ATGGTGAGCAAGGGCGAGGA;

[0137] mCh-R:TTACTTGTACAGCTCGTCCATGC.

[0138] Depend on Figure 8 As can be seen, the size of the amplified product is consistent with the expectation, indicating that the mCherry tag protein has been successfully transcribed in the recombinant coccidia vector.

[0139] Using the above construction method, this embodiment successfully inserted the mCherry fluorescent protein gene into the ETH_00010755 gene of *Eimeria tenella*, and obtained a stably heritable strain. The invented CRISPR / Cas9 gene modification system for *Eimeria tenella* demonstrates higher gene modification efficiency compared to existing knockout plasmid methods, and the constructed recombinant coccidia vector can be used for immunotherapy and / or vaccine research.

[0140] Comparative Example

[0141] To conduct a control experiment, this example used the pSAG1-CAS9-U6-sgUPRT plasmid template and the constructed homologous recombination plasmid to construct a recombinant coccidia vector. The construction method was the same as in Example 2. The positive rates of the two knockout plasmids, the same concentration of homologous recombination fragments, and the number of electric shocks are shown in Table 9.

[0142] Table 9. Positive rates of two knockout plasmids and homologous recombination fragment concentrations at the same concentration, and the number of electroporation cycles.

[0143]

[0144] As can be seen from the table above, the donor plasmid template pHis4Nls-eSpCas9-EtU6-sgRNA, which is specific to the His4 and U6 promoters of Eimeria tenella constructed in this invention, has a higher positive rate than the original plasmid template pSAG1-CAS9-U6-sgUPRT, indicating that it has higher specificity.

Claims

1. An sgRNA targeting the ETH_00010755 gene of *Eimeria tenella*, characterized in that, The nucleotide sequence of the sgRNA targeting the ETH_00010755 gene is shown in SEQ ID No.

1.

2. A gene editing system for Eimeria coccidia ETH_00010755, characterized in that, The ETH_00010755 gene editing system includes the sgRNA targeting the ETH_00010755 gene of Eimeria as described in claim 1.

3. The Eimeria coccidia ETH_00010755 gene editing system according to claim 2, characterized in that, It also includes Cas9 nuclease and homologous recombinant plasmids.

4. The Eimeria coccidia ETH_00010755 gene editing system according to claim 3, characterized in that, The sgRNA targeting the ETH_00010755 gene of Eimeria coccidia is linked to the Cas9 nuclease on the same gene-editing plasmid.

5. The Eimeria coccidia ETH_00010755 gene editing system according to claim 4, characterized in that, The gene editing plasmid includes a His4Nls fragment and an EtU6 promoter, and the nucleotide sequence of the gene editing plasmid is shown in SEQ ID No.

2.

6. The Eimeria coccidia ETH_00010755 gene editing system according to claim 3, characterized in that, The homologous recombination plasmid includes a fluorescent tag gene.

7. A recombinant coccidia vector, characterized in that, The coccidia vector contains the sgRNA targeting the ETH_00010755 gene as described in claim 1.

8. The recombinant coccidia vector according to claim 7, characterized in that, The recombinant coccidia vector contains the ETH_00010755 gene editing system described in any one of claims 2 to 6.

9. The recombinant coccidia vector according to claim 7, characterized in that, The recombinant coccidia vector is a coccidia vector that integrates a fluorescent tag gene into the ETH_00010755 gene after being edited using the Eimeria coccidia ETH_00010755 gene editing system described in any of claims 2 to 6.

10. The use of the recombinant coccidia vector according to any one of claims 7 to 9 in the preparation of immunomodulatory drugs and / or vaccines for the prevention of Eimeria coccidia.

Images