Marker for radiodermatitis diagnosis and treatment and application thereof

Abstract

The invention provides a marker for diagnosing and treating radiodermatitis and application of the marker. The relation between SENP5 and radiodermatitis is researched for the first time, it is found that SENP5 is in positive correlation with occurrence and development of radiodermatitis, an SENP5 overexpression group shows better radiation resistance, skin cells are protected, and damage caused by radiation is relieved. The SENP5 is mainly used for promoting DNA damage repair by mediating an HR repair pathway. Besides, the SENP5 knocked-down cell line is successfully constructed by designing shRNA for specifically knocking down the SENP5 expression level, and it is proved that after SENP5 knocked-down skin cells are irradiated by 60Co rays, the cell survival level is lowered, the homologous recombination repair pathway is obviously inhibited, the NF-kappa B pathway is obviously activated, and the inflammation level is improved. Therefore, SENP5 is represented as an anti-radiation gene in skin cells, and SENP5 can be used as a biomarker of radiodermatitis for early diagnosis of radiodermatitis and targeted preparation of drugs for radiodermatitis.

Description

Technical Field

[0001] This invention belongs to the field of biological diagnostics and treatment technology, specifically relating to SENP5, a biomarker for the diagnosis and treatment of radiation dermatitis, and its application. Background Technology

[0002] Radiation dermatitis (RD) is one of the most common complications of radiotherapy for tumors, frequently occurring after radiotherapy for skin cancer, head and neck cancer, and breast cancer. Approximately 95% of patients experience varying degrees of skin reaction after radiotherapy, ranging from mild erythema to severe ulceration. It is typically classified into four grades based on clinical presentation: Grade I (mild): dry skin, redness, and mild itching; Grade II (moderate): significant erythema, edema, and patchy desquamation; Grade III (severe): skin breakdown, exudation, and intense pain; Grade IV (very severe): ulceration, necrosis, and secondary infection. Commonly used assessment tools include: RTOG (Radiotherapy Oncology Group) criteria, CTCAE (Common Terminology for Adverse Events), RISRAS (Radiation Skin Reaction Assessment Scale), and patient self-assessment tools (such as the VAS pain score). Because radiation damage to the skin is cumulative and irreversible, this type of wound is difficult to heal, severely impacting patients' quality of life.

[0003] In terms of treatment, mild (Grade I-II) radiation dermatitis is often relieved by moisturizing agents (such as vitamin E cream, cod liver oil ointment), anti-inflammatory ointments (such as weak glucocorticoids) or external application of traditional Chinese medicine (such as She medicine wet compress, Paris polyphylla ointment); moderate to severe (Grade III-IV) radiation dermatitis is often relieved by antibiotic ointments (such as mupirocin), boric acid wet compresses or laser / phototherapy to promote healing.

[0004] In summary, the diagnosis of radiation dermatitis currently relies mainly on clinical manifestations, lacking a unified assessment standard, which makes it difficult to compare treatment efficacy. Treatment is mainly symptomatic, with insufficient intervention on the underlying mechanisms. Most treatments only relieve symptoms and cannot reverse the core mechanisms of oxidative stress / inflammation. Furthermore, there is a lack of corresponding diagnostic or target biomarkers.

[0005] SUMOylation is a reversible post-translational modification of proteins. The C-terminal double Gly residues of the SUMO protein are covalently linked to Lys residues on the target protein via isopeptide bonds, thus completing SUMOylation. SENPs (SUMO-specific proteases) cleave these isopeptide bonds, releasing the SUMO from the target protein; this process is called deSUMOylation. The dynamic balance between SUMOylation and deSUMOylation regulates normal cellular physiological functions, thereby maintaining intracellular homeostasis.

[0006] SUMO-specific proteases (SENPs, sentrin / SUMO-specific proteases) are a class of key SUMO-processing enzymes responsible for the maturation of SUMO precursors (C-terminal hydrolysis) and the de-SUMOylation of SUMOylated proteins, thereby dynamically regulating the SUMO modification process. Six human SENPs have been identified so far: SENP1-3 and SENP5-7. Previous studies have shown that SENP2 mediates cell cycle transition by regulating the SUMOylation of MDM2; however, whether other SENPs, such as SENP5, regulate radiation dermatitis and its molecular mechanisms remain unclear. Summary of the Invention

[0007] This invention addresses the aforementioned problems by providing a biomarker for the diagnosis and treatment of radiation dermatitis and its application. The biomarker is SENP5, with an NCBI Gene ID of 205564. This invention is the first to explore the relationship between SENP5 and radiation dermatitis, finding a positive correlation between SENP5 and the occurrence and development of radiation dermatitis. SENP5 overexpression groups exhibited better radiation resistance, protecting skin cells and reducing radiation-induced damage. Mechanistically, SENP5 primarily promotes DNA damage repair by mediating the HR repair pathway. Furthermore, by designing shRNAs that specifically knock down SENP5 expression levels, a SENP5 knockdown cell line was successfully constructed, and it was demonstrated that SENP5 knockdown skin cells, after 60 days of treatment... Co After radiation exposure, cell survival decreased, homologous recombination repair pathway was significantly inhibited, NF-κB pathway was significantly activated, and inflammation levels increased.

[0008] Therefore, SENP5 is expressed as an anti-radiation gene in skin cells, and can be used as a biomarker for radiation dermatitis, for early diagnosis of radiation dermatitis, and for targeted preparation of drugs for radiation dermatitis.

[0009] The purpose of this invention is to provide a biomarker for the diagnosis of radiation dermatitis, and also to provide a new use for SENP5, namely, its application in the preparation of diagnostic kits or therapeutic compositions for radiation dermatitis.

[0010] In a first aspect, the invention provides the application of SENP5 as a diagnostic biomarker. Specifically, it provides the application of reagents for detecting SENP5 in the preparation of diagnostic or auxiliary diagnostic products for radiation dermatitis.

[0011] Preferably, the reagent for detecting SENP5 is one that detects the expression level of SENP5 in biological samples at the gene level; the kit contains this reagent for detecting the expression level of SENP5 in biological samples. This includes reagents used in the HE staining, immunohistochemical analysis, and PCR detection methods as described in the specific embodiments section of this invention.

[0012] Further preferred, the reagent for detecting SENP5 expression in biological samples includes PCR primers with detection specificity for the SENP5 gene. The PCR primers with detection specificity for the SENP5 gene are shown in SEQ ID NO. 1-2, and the primer sequences for the control GAPDH are shown in SEQ ID NO. 3-4.

[0013] In a second aspect, the present invention provides a product comprising the aforementioned substance for detecting SENP5, the product having the following use: for the diagnosis or auxiliary diagnosis of radiation dermatitis.

[0014] The product can be a kit for detection at the gene level, consisting of a reverse transcription system, a primer system, and an amplification system. The primer system includes PCR primers as shown in SEQ ID NO.1–2 and SEQ ID NO.3–4.

[0015] SENP5-F: GGGAAGGCCAGTTACTTGGAA (SEQ ID NO.1);

[0016] SENP5-R: CAAAGGGGTTCATCCTTGATCC (SEQ ID NO. 2);

[0017] GAPDH-F: CAGGAGGCATTGCTGATGAT (SEQ ID NO.3);

[0018] GAPDH-R: GAAGGCTGGGGCTCATTT (SEQ ID NO. 4).

[0019] The product can also be a kit for detection at the protein or tissue level, containing reagents for methods such as Western blot, HE staining, immunohistochemistry, and protein extraction.

[0020] Furthermore, the biological samples are selected from skin tissue or blood. Early diagnosis is achieved by collecting and detecting the level of SENP5 in skin tissue or cells.

[0021] A third aspect of the invention provides the use of SENP5 as a therapeutic target. Specifically, it provides the use of substances that promote SENP5 expression in the preparation of products for treating radiation dermatitis.

[0022] Preferably, the substance that promotes SENP5 expression is selected from SENP5 recombinant expression vectors or transgenic cell lines, or liposomes or nanoparticles encapsulating SENP5 nucleic acid molecules.

[0023] In a fourth aspect, the present invention provides a pharmaceutical composition for treating radiation dermatitis, comprising an active ingredient and a pharmaceutically acceptable carrier, said active ingredient being selected from a SENP5 recombinant expression vector or a transgenic cell line, or liposomes or nanoparticles encapsulating SENP5 nucleic acid molecules.

[0024] A fifth aspect of the present invention provides a product comprising at least one of the second, third, and fourth aspects. The product has at least one function of (1)-(3):

[0025] (1) Diagnose radiation dermatitis or assess the severity of radiation dermatitis;

[0026] (2) Treatment of radiation dermatitis;

[0027] (3) Improve radiation resistance.

[0028] The beneficial protections and effects of this invention are as follows:

[0029] This invention proposes for the first time a potential link between the SENP5 gene and radiation dermatitis. SENP5 is highly expressed in radiation dermatitis, and knocking down the SENP5 gene affects post-irradiation cell activity by influencing DNA repair pathways such as HR inhibition and activating the NF-κB signaling pathway; conversely, overexpression of SENP5 protects skin cells and reduces radiation-induced damage. Therefore, targeting the SENP5 gene is of great significance for the prediction, diagnosis, and treatment of radiation dermatitis. Attached Figure Description

[0030] Figure 1 The changes in SENP5 expression in a rat radiation dermatitis model and skin cells after γ-ray irradiation were shown.

[0031] Figure 2 The study showed that knocking down SENP5 in skin cells reduced cell survival and colony formation rate after irradiation, and increased cell apoptosis rate.

[0032] Figure 3 It was shown that overexpression of SENP5 in skin cells increased cell survival after irradiation;

[0033] Figure 4 It was shown that knocking down SENP5 in skin cells increased the degree of DNA damage after irradiation and affected the ability to repair DNA damage.

[0034] Figure 5 The results showed that knocking down SENP5 in skin cells significantly inhibited the HR repair pathway, while the NHEJ repair pathway remained largely unchanged.

[0035] Figure 6The study showed that knocking down SENP5 in skin cells significantly activated the NF-κB pathway and inflammatory factors. Detailed Implementation

[0036] The following embodiments and experimental examples further illustrate the present invention and should not be construed as limiting the invention. The embodiments do not include a detailed description of conventional methods, which are well known to those skilled in the art and described in numerous publications.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to this invention, and the preferred embodiments and materials described in the specific implementation are for illustrative purposes only.

[0038] Unless otherwise specified, the experimental methods described in the following examples are generally performed under standard conditions or as recommended by the manufacturer.

[0039] The human epidermal keratinocytes (NHEK) and human immortalized epidermal cells (HaCaT) used in this invention were both obtained from Shenzhen Huatuo Biotechnology Co., Ltd., and underwent cell identification and mycoplasma contamination exclusion. All reagents used in this invention were commercially available. The experimental methods used in this invention, such as Western blot, qPCR, and immunofluorescence, are conventional techniques and methods in the field. Representative biological replicates are presented in the accompanying figures. Data were analyzed using Graphpad Prism 9.5 software; p < 0.05 was considered statistically significant.

[0040] Example 1: High expression of SENP5 in radiation dermatitis

[0041] Sprague-Dawley rats aged 6-8 weeks were selected. After hair removal of the skin on the rump of the rats, they were administered 50 Gy 60 Co After radiation irradiation, dermatitis began to appear on the rat skin on day 14, ulcers appeared on day 21, and the ulcers gradually healed on day 28. Skin samples from the buttocks and unirradiated normal skin were collected on day 28 post-irradiation, fixed in 4% paraformaldehyde fixative, and analyzed by HE staining and SENP5 immunohistochemical staining. Simultaneously, NHEK and HaCaT cell lines were subjected to 8 Gy 60... Co The SENP5 protein expression level was detected after radiation irradiation at 4h, 8h, 12h, and 24h. The specific experimental method is as follows:

[0042] 1. HE staining experiment:

[0043] Animal skin tissue was directly immersed in 4% paraformaldehyde for fixation for 20-24 hours. The tissue was then dehydrated with ethanol, embedded in paraffin, and after cooling and solidification, it was sliced ​​into thin sections and mounted on glass slides. Hematoxylin and eosin were used to stain the cell nuclei and cytoplasm, respectively. Finally, the sections were dehydrated, mounted, and subjected to microscopic observation and image acquisition.

[0044] 2. Immunohistochemical experiment:

[0045] After dehydration, embedding, sectioning, and dewaxing of the fixed animal tissue, it was blocked with 5% BSA at room temperature for 1 hour. Primary antibody solution was then added to the sections and incubated overnight at 4°C. The next day, the sections were washed three times with PBS for 5 minutes each time, incubated with secondary antibody at room temperature for 1 hour, and then washed three more times with PBS for 5 minutes each time. Subsequently, the sections were stained with DAB chromogenic solution for 20 minutes and hematoxylin for 3 minutes, then dehydrated and mounted. Under a microscope, the target molecules stained by DAB appeared brownish-yellow, and the cell nuclei stained blue by hematoxylin.

[0046] 3. Protein extraction experiment:

[0047] Cells in good condition and in the logarithmic growth phase were plated. After cell adhesion, they were irradiated. Proteins were collected at different time points according to experimental requirements. Cells were digested, centrifuged, resuspended in PBS, and washed. An appropriate amount of protein lysis buffer containing protease and phosphatase inhibitors was added, and the cells were lysed on ice for 10 min. Cells were then sonicated 5 times per sample, 1.5 s each time, with a 1.5 s interval. After sonication, the EP tubes were placed on ice to cool. The centrifuge was pre-chilled and set to 4°C, 14000 rpm, 15 min. After centrifugation, the protein supernatant was carefully aspirated into a new EP tube. Protein concentration was measured using a NanoDrop micro-spectrophotometer. Then, 1 / 4 volume of 5X Loading Buffer was added, mixed well, and boiled in a metal bath at 100°C for 10 min. Subsequent analysis was then performed, or the tubes were transferred to a -20°C freezer for storage.

[0048] The results are as follows Figure 1 As shown, in the animal model of radiation dermatitis, compared with normal skin tissue, the dermatitis area showed a large number of inflammatory cell infiltrations. Figure 1 A, 1B, 1C), and SENP5 showed a high expression trend ( Figure 1 D), in the cell model, the expression level of SENP5 protein showed an upregulation trend after cells were irradiated with 8 Gy. Figure 1 E, 1F). Therefore, SENP5 is concluded to be a radiation-sensitive gene.

[0049] Example 2: SENP5 knockdown reduces cell survival rate and colony formation rate after irradiation, and increases cell apoptosis rate.

[0050] 1. Constructing SENP5 knockdown cell lines

[0051] Two lentiviral interfering plasmids (SH1 and SH2) for SENP5 shRNA were constructed based on a CRISPR Cas9 library. NHEK and HaCaT cells were then infected with these plasmids, and SENP5-stable cell lines were selected using complete culture medium containing 2 μg / mL puromycin. SENP5 knockdown was verified using Western blot and qPCR. The control group and the group with the best knockdown effect were designated as the NC and SENP5-KD groups, respectively.

[0052] The specific testing steps are as follows:

[0053] (1) Western blot experiment:

[0054] Prepare the required concentration of SDS-PAGE gel according to the size of the target protein. Assemble the gel in the electrophoresis tank. After vortexing the sample to be tested until homogeneous, add it to the wells of the upper gel. Add pre-stained protein markers to both sides. Set the electrophoresis program to 80V for 30 min and 120V for 60 min. After electrophoresis, stack the gel in the following order: black side (negative electrode) - sponge - three layers of filter paper - gel - PVDF membrane - three layers of filter paper - sponge - white side (positive electrode). Set the transfer program to 300mA for 120 min. The transfer time can be appropriately extended or shortened according to the molecular weight. After transfer, block the membrane by shaking with 5% skim milk for 1 h. Cut the bands according to the size of the target protein molecule and the marker position, and place them in 15mL centrifuge tubes containing the corresponding primary antibody. Incubate overnight at 4℃ on a shaker. The next day, remove the PVDF membrane and wash it three times with TBST solution, shaking for 10 min each time. Based on the species of the primary antibody, select the corresponding secondary antibody dilution buffer and incubate at room temperature on a shaker for 1 hour. After secondary antibody incubation, wash the bands three times with TBST for 10 minutes each time. Finally, expose the PVDF membrane using a GelView600plus automated imager.

[0055] (2) qPCR experiment:

[0056] RNA was extracted from cells using an RNA extraction kit (YiShan Biotechnology, RN001), and the concentration and purity of the RNA were measured. A reverse transcription reaction system was prepared as shown in Table 1 below. After the solution was prepared, it was placed in a PCR instrument and reverse transcribed according to the following reverse transcription program: 25℃, 5 min; 55℃, 15 min; 85℃, 5 min, to obtain 20 μL of cDNA.

[0057] Table 1 Reverse transcription reaction system

[0058] reagents Reaction volume (μL) RNA X = 800 / RNA concentration 4XHifair®III SuperMix plus 5 <![CDATA[RNase Free ddH2O]]> 15-X Total volume 20

[0059] Real-time quantitative PCR: A 20 μL qPCR system was prepared using the following: 10 μL Hifair® qPCR SYBR Green Master Mix, 0.4 μL Forward Primer, 0.4 μL Reverse Primer, 2 μL cDNA, and 7.2 μL ddH2O. After gentle mixing and brief incubation, the solution was incubated in an RT-qPCR instrument. The reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, and 72℃ extension for 20 s, for a total of 40 cycles. After the reaction, the results were analyzed according to step 2. -△△CT The method calculates the relative expression level of genes.

[0060] The primer sequences for the two genes involved in this embodiment are as follows:

[0061] SENP5-F: GGGAAGGCCAGTTACTTGGAA (SEQ ID NO.1);

[0062] SENP5-R: CAAAGGGGTTCATCCTTGATCC (SEQ ID NO. 2);

[0063] GAPDH-F: CAGGAGGCATTGCTGATGAT (SEQ ID NO.3);

[0064] GAPDH-R: GAAGGCTGGGGCTCATTT (SEQ ID NO. 4).

[0065] 2. CCK8 determination experiment:

[0066] NC and SENP5-KD cells in the logarithmic growth phase were seeded at a density of 3000 cells / well in 96-well plates. After adhesion, the cells were treated with unirradiated (control) and irradiated with 8 Gy 60 Co Cells were irradiated with X-rays, and their proliferation capacity was measured at 24h, 48h, and 72h. The staining solution was prepared by adding 10μL of CCK8 reagent and 90μL of culture medium to each well. One hour after adding the CCK8 reagent, the absorbance at 450nm was measured using an ELISA reader.

[0067] 3. Cloning experiment:

[0068] NC and SENP5-KD cells were seeded into 6-well plates at the densities shown in Table 2. After cell adhesion, the plates were irradiated with the doses shown in the table. After irradiation, the plates were placed in a cell culture incubator. Culture was stopped after approximately 10-12 days when cell clonal clumps with a diameter of about 1 mm were observed in the wells. Cells were fixed with 4% paraformaldehyde for 15 min, then stained with crystal violet at room temperature. After 15 min, the crystal violet staining solution was recovered, excess crystal violet was washed away, and the cells were air-dried. Clonal clumps with 50 or more cells were photographed using a clonal analyzer, and the clumps were counted. Cell viability = (number of clonal clumps in the experimental group / number of cells in the experimental group) / (number of clonal clumps in the control group / number of cells in the control group) × 100%.

[0069] Table 2 Comparison of different cell densities and irradiation doses

[0070] Radiation dose (Gy) Cell density (cells / well) 0 600 2 1200 4 2400 6 4800

[0071] 4. Apoptosis experiment:

[0072] Each group of cells was divided into 3×10 5 Cells were seeded at a density of [number] cells / well in 12-well plates. The cells were irradiated the following day, with each group receiving 1 mL of fresh complete culture medium before irradiation. 24 hours after irradiation, cells were digested with EDTA-free trypsin, and the culture medium was collected and the trypsin neutralized. Cells were gently washed once with pre-chilled PBS. Cells were resuspended in Binding Buffer from an apoptosis kit (Linkec Biotech, AP107). 5 μL of Annexin V-APC and 10 μL of PI were added to each tube, and after vortexing, the cells were analyzed by flow cytometry.

[0073] The results are as follows Figure 2 As shown, among the two lentiviral interference plasmids, SH2 exhibited lower SENP5 protein and RNA expression levels. Therefore, the stable cell line infected with SH2 was selected as the SENP5-KD group. Figure 2 A, 2B, 2C, 2D); CCK8 assay showed that SENP5-KD cells exhibited reduced proliferative capacity after irradiation. Figure 2 E, 2F, 2I, 2J), and the colony formation assay also demonstrated a decrease in the colony-forming ability of SENP5-KD cells. Figure 2 G, 2H). Apoptosis is the main mode of cell death after ionizing radiation. Apoptosis experiments on NC and SENP5-KD cells irradiated for 24 hours showed that downregulation of SENP5 promoted apoptosis in NHEK and HaCaT cells after irradiation. Figure 2 (K, 2L, 2M, 2N). Therefore, it is concluded that SENP5 knockdown affects the survival of skin cells after irradiation.

[0074] Example 3: Construction of SENP5 overexpressing cell lines and CCK8 assay

[0075] 1. Lentiviral packaging:

[0076] Control group (Vector) and SENP5 overexpression group (SENP5-OE) plasmids were constructed. Lentiviral packaging was initiated when 293T cells reached approximately 90% confluence. 1 mL of serum-free DMEM medium, 8 μg of lentiviral plasmid, 4 μg of PSPAX2, 2 μg of PMD2G, and 42 μg of PEI were added to a 1.5 mL sterile EP tube. After mixing and incubation for 15 min, the mixture was added to the 293T cell culture dish to be transfected, gently mixed, and placed in a cell culture incubator. Cell culture media were collected at 48 h and 72 h post-transfection, centrifuged at 3000 rpm for 15 min at 4 °C, and the supernatant was filtered through a 0.22 μm filter membrane, aliquoted into sterile EP tubes, and stored at -80 °C for later use.

[0077] 2. The specific implementation process for lentivirus infection and verification is as follows:

[0078] Take cells in the logarithmic growth phase, at a concentration of 1×10⁻⁶. 5 Cells were seeded at a density of / wells in six-well plates. After cell attachment, 2 mL of virus, 1 mL of antibiotic-free culture medium, and the transfection promoter Polybrene were added. The mixture was gently stirred and the cells were placed in an incubator for further culture. 24 h post-infection, the cell culture medium was replaced with fresh medium. After the cells reached confluence, SENP5 stable cell lines were selected using medium containing 2 μg / mL Puromycin. Western blot and qPCR were used for verification and subsequent CCK8 experiments (see Example 2 for specific steps).

[0079] The results are as follows Figure 3 As shown, both Western blot and qPCR experiments demonstrated that overexpression of SENP5 increased cell survival rate after irradiation. Figure 3 A, 3B); In the CCK8 experiment, the SENP5 overexpression group showed better radiation resistance ( Figure 3 C). As can be seen from Example 2, SENP5 is a radiation-resistant gene in skin cells.

[0080] Example 4: SENP5 knockdown promotes post-radiation DNA damage

[0081] 1. Neutral comet electrophoresis experiment:

[0082] Cells from the NC and SENP5-KD groups were irradiated or not, and the cell suspension was collected and the cell density was adjusted to 3.75 × 10⁻⁶. 5Cells / mL: Mix 10 μL of cell suspension with 40 μL of agarose gel, and add 40 μL of the cell-agarose mixture onto a clear, dry glass slide. After the agarose gel solidifies, place the slide in pre-cooled lysis buffer at 4°C and lyse overnight at 4°C in the dark. The next day, soak the slide in neutral electrophoresis buffer for 30 min, and set the electrophoresis mode to 25V for 20 min. After electrophoresis, soak the slide in DNA precipitation solution for 20 min and then in 70% anhydrous ethanol for 20 min. After the slide dries, add 100 μL of red fluorescent dye to the cell gel portion, incubate at room temperature in the dark for 15 min, and then photograph using a fluorescence microscope.

[0083] 2. Immunofluorescence assay:

[0084] Place a 12mm sterile coverslip in a 24-well plate and add cells from the NC and SENP5-KD groups at a concentration of 1×10⁻⁶ cells / well. 5 Cells were seeded at a density of cells / well. After cell adhesion, the cells were irradiated. Cells from the unirradiated group and the irradiated groups at 0.5h and 24h were collected. Cells were fixed with immunofluorescence fixative for 30min, and the plates were placed on ice. 1mL of 0.5% Triton X 100 was added to each well for cell membrane permeability, followed by blocking with 5% goat serum for 1h. Primary antibody dilution was prepared at a 1:200 ratio, and 70μL was added to each slide. The plates were incubated overnight at 4°C. The next day, the primary antibody was recovered, and secondary antibody dilution was prepared at a 1:500 ratio. 70μL of the secondary antibody dilution was added to each slide, and the plates were incubated at room temperature in the dark for 1h. DAPI staining solution for cell nuclei was then prepared at a 1:2000 ratio and incubated at room temperature for 20min. After the slides dried, coverslips were placed on glycerol-containing slides, sealed with clear nail polish, and allowed to dry. The slides were then observed and photographed using a fluorescence microscope or confocal microscope.

[0085] The results are as follows Figure 4 As shown in the neutral comet electrophoresis diagram, the SENP5-KD group cells exhibit a longer comet tail, indicating more DNA damage fragments. Figure 4 A, 4B). γ-H2AX is the phosphorylated form of histone H2AX. It accumulates in large quantities and forms focal points (foci) at DNA double-strand break sites during DNA damage, thus serving as a marker for DNA double-strand breaks. Immunofluorescence staining of γ-H2AX in NC and SENP5-KD cells showed that knockdown of SENP5 resulted in more γ-H2AX focal points (foci) in the cells. Figure 4C, 4D, indicates aggravated DNA damage. DNA damage repair is a complex and extensive process, mainly involving two repair pathways: homologous recombination (HR) and non-homologous end joining (NHEJ). We collected cellular proteins from each group of cells in unirradiated and 0.5h, 8h, and 24h after irradiation, and examined several key protein molecules regulating DNA damage repair in the HR and NHEJ repair pathways. The results showed that after SENP5 knockdown, the phosphorylation levels of molecules such as ATR, KAP1, CHK1, CHK2, and RPA2 decreased to varying degrees at different time points, indicating that the DNA damage repair pathway was inhibited. Figure 4 (E, 4F). Therefore, this embodiment demonstrates that downregulation of SENP5 in skin cells exacerbates DNA damage and inhibits DNA damage repair.

[0086] Example 5: Knocking down SENP5 primarily affects the HR repair pathway.

[0087] The experiment was conducted using chromatin-binding protein extraction, and the procedure is as follows:

[0088] Chromatin-binding proteins were extracted using a chromatin protein extraction kit (Abcam, ab117152). Healthy cells were irradiated, and 1×Lysis Buffer was added to the cell pellet. The cells were lysed on ice for 10 min, followed by centrifugation at 4°C, 5000 rpm for 5 min. The supernatant contained non-chromatin-binding proteins, and the pellet contained chromatin. The supernatant was carefully transferred to a new EP tube for further analysis. The bottom pellet was resuspended in Extration Buffer, vortexed every 5 min, and lysed on ice for 10 min. The cells were then sonicated using an ultrasonic cell disruptor, followed by centrifugation at 4°C, 1200 rpm for 10 min. The resulting supernatant contained chromatin-binding proteins. This supernatant was transferred to a new EP tube, 1×Loading Buffer was added, and the tube was boiled in a metal bath at 100°C for 10 min before Western blot analysis.

[0089] The results are as follows Figure 5As shown, after DNA damage occurs, DNA damage repair molecules, such as ATM-CHK2, ATR / RPA / ATRIP-CHK1, RAD51, and the KU70 / KU80 complex, are recruited to the damage site, initiating the HR and NHEJ pathways. Chromatin-binding protein results showed that after SENP5 knockdown, molecules such as ATM, ATR, TOBP1, ATRIP, CHK2, CHK1, RAD51, and RPA2 were downregulated at different time points or to varying degrees, indicating that SENP5 knockdown affects the HR repair pathway after DNA damage. Meanwhile, the expression of KU80 and KU70 proteins did not show significant differences, meaning that SENP5 knockdown does not affect the NHEJ repair pathway. RAD51 protein can be recruited to the DNA break site by BRCA2 and binds to homologous chromatids; therefore, RAD51 can serve as a key effector for HR repair. 53BP1 can promote the rejoining of DNA double-strand breaks, thereby promoting NHEJ-mediated repair. Figure 5 A, 5B). Immunofluorescence assays were used to detect the formation rates of RAD51 and 53BP1 foci in different cell groups at 0.5 h and 24 h after irradiation. It was found that SENP5 knockdown significantly reduced the formation rate of RAD51 foci at both 0.5 h and 24 h, while the formation rate of 53BP1 foci only showed a decreasing trend at 24 h. Figure 5 (C, 5D, 5E, 5F). Therefore, we believe that SENP5 mainly regulates DNA damage repair responses through the HR repair pathway.

[0090] Example 6: Knocking down SENP5 activates the NF-κB signaling pathway and inflammatory factors.

[0091] To explore the potential mechanism by which SENP5 regulates heart rate repair, the classic inflammation-related NF-κB pathway was investigated. The NF-κB complex consists of five proteins: RelA (p65), RelB, c-Rel, p50 / p105 (NF-κB1), and p52 / p100 (NF-κB2), which synergistically participate in regulating biological processes such as inflammation, immunity, differentiation, cell growth, tumorigenesis, and apoptosis. Figure 6 Western blot ( Figure 6 A, 6B) and immunofluorescence ( Figure 6 Results (C, 6D) showed that knockdown of SENP5 significantly increased p65 protein phosphorylation and exhibited a clear nuclear translocation trend. qPCR experiments showed that the mRNA levels of pro-inflammatory cytokines IL-6 and TNF-α were significantly upregulated after SENP5 knockdown. Figure 6 E, 6F).

[0092] This embodiment involves two gene primer sequences, as detailed below:

[0093] IL-6-F: CCTGACCCAACCACAAAATGC (SEQ ID NO.5)

[0094] IL-6-R: ATCTGAGGTGCCCATGCTAC (SEQ ID NO.6)

[0095] TNF-α-F: CCCCAGGGACCTCTCTCTAATC (SEQ ID NO.7)

[0096] TNF-α-R: GGTTTGCTACAACATGGGCTACA (SEQ ID NO. 8).

[0097] In summary, the above examples demonstrate that SENP5 expression is elevated in radiation dermatitis. Knockdown of SENP5 affects the survival of skin cells after irradiation, while overexpression of SENP5 protects skin cells and reduces radiation-induced damage. Mechanistically, SENP5 primarily promotes DNA damage repair by mediating the HR repair pathway. Specifically, SENP5 knockdown significantly activates the NF-κB pathway and inflammatory response, exacerbating skin damage. In conclusion, SENP5 is a radiation-protective gene in the skin and can be used as a target for the treatment of radiation dermatitis.

[0098] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. Application of reagents for detecting SENP5 expression levels in the preparation of diagnostic kits for radiation dermatitis.

2. The application according to claim 1, characterized in that, The reagent used to detect SENP5 expression level is a reagent for detecting the amount of SENP5 expression in biological samples; the kit contains reagents for detecting the amount of SENP5 expression in biological samples.

3. The application according to claim 2, characterized in that, The reagents used to detect SENP5 in biological samples are selected from one or more of the following detection techniques or methods: HE staining, immunohistochemical analysis, and PCR detection.

4. The application according to claim 3, characterized in that, The reagent for detecting SENP5 expression in biological samples contains PCR primers that are specific for detecting the SENP5 gene.

5. The application according to claim 4, characterized in that, The PCR primer sequences with detection specificity for the SENP5 gene are shown in SEQ ID NO.1~2.

6. A diagnostic kit for radiation dermatitis, characterized in that, This kit contains reagents for detecting the SENP5 content in biological samples.

7. The reagent kit according to claim 6, characterized in that, The reagents are selected from one or more of the following detection techniques or methods: HE staining, immunohistochemical analysis, and PCR detection. The kit for PCR detection consists of a reverse transcription system, a primer system, and an amplification system. The primer system includes PCR primers as shown in SEQ ID NO.1 to 2.

8. Application of substances that promote SENP5 expression in the preparation of products for treating radiation dermatitis.

9. The application according to claim 8, characterized in that, The substance that promotes SENP5 expression is selected from SENP5 recombinant expression vectors or transgenic cell lines, or liposomes or nanoparticles encapsulating SENP5 nucleic acid molecules.

10. A pharmaceutical composition for treating radiation dermatitis, characterized in that, It includes an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is selected from SENP5 recombinant expression vectors or transgenic cell lines, or liposomes or nanoparticles encapsulating SENP5 nucleic acid molecules.

Images