A monoclonal antibody diva55 against porcine pestivirus and a preparation method and application thereof
By developing the monoclonal antibody DIVA55 and its antigen-binding fragment, the problem of serological differential diagnosis of classical swine fever virus E2 protein subunit vaccination and wild-type strain infection was solved, achieving highly sensitive serological diagnosis and purification, supporting rapid, large-scale sample testing, and reducing costs.
Patent Information
- Application Number
- CN202511562833.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-30
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2045-10-30
AI Technical Summary
Existing serological diagnostic kits for swine fever virus E2 protein subunit vaccination and wild-type strain infection lack specificity and sensitivity, making it difficult to achieve swine fever virus eradication.
A monoclonal antibody, DIVA55, and its antigen-binding fragment, containing specific heavy and light chain variable region amino acid sequences, were developed for use in the preparation of kits for serological differential diagnosis, capable of distinguishing between E2 protein-labeled subunit vaccination and wild-type virus infection.
It enables specific identification and differentiation of the E2 protein of classical swine fever virus, provides a highly sensitive serological diagnostic method, supports rapid and large-scale sample detection, reduces costs, and improves the efficiency of classical swine fever virus eradication.
Smart Images

Figure CN121064321B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a monoclonal antibody DIVA55 against swine fever virus, its preparation method, and its application in the field of medical preparations. Background Technology
[0002] Classical swine fever (CSF) is a major animal disease in pigs caused by classical swine fever virus (CSFV), characterized by high morbidity and mortality. This disease seriously threatens the healthy development of the pig farming industry and is listed as a notifiable animal disease by the World Organisation for Animal Health (OIE) and classified as a Class II infectious disease under my country's animal health regulations. Therefore, the prevention and eradication of CSF is crucial for enhancing the core competitiveness of pig farming enterprises. Currently, neither the commercially available CSF rabbit-adapted attenuated live vaccine (C strain) nor the E2 protein subunit vaccine are accompanied by highly specific and sensitive differential vaccination kits or serological diagnostic kits for wild-type CSFV infection, which is a major obstacle to achieving CSF eradication. Summary of the Invention
[0003] The main problem this invention aims to solve is how to differentiate between E2 protein-labeled subunit vaccination and CSFV wild-type virus infection, so as to achieve serological differential diagnosis and purification of classical swine fever virus.
[0004] To address the above problems, the present invention provides an antibody.
[0005] The present invention provides a monoclonal antibody or its antigen-binding fragment thereof, wherein the monoclonal antibody or its antigen-binding fragment includes a heavy chain variable region and a light chain variable region; the amino acid sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region of the antibody are shown as SEQ ID No:4, 24 to 34, 50 to 56 and 89 to 97 respectively, and LCDR1, LCDR2 and LCDR3 are complementarity-determining regions; the amino acid sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region of the antibody are shown as SEQ ID No:5, 31 to 35, 50 to 66 and 99 to 110 respectively, and HCDR1, HCDR2 and HCDR3 are complementarity-determining regions.
[0006] In this invention, an "antigen-binding fragment" refers to an antigen-binding fragment of an antibody, which typically includes at least a portion of the antigen-binding region or variable region (e.g., one or more CDRs) of the parent antibody. This antigen-binding fragment retains at least some of the binding specificity of the parent antibody. Typically, when activity is expressed on a molar basis, the antigen-binding fragment retains at least 10% of the parent antibody's binding activity. Specifically, the antigen-binding fragment retains at least 20%, 50%, 70%, 80%, 90%, 95%, or 100% or more of the parent antibody's binding affinity to the target.
[0007] The antigen-binding fragments mentioned above may be complete antibodies, fusion antibodies, antibody-drug conjugates, Fab fragments, Fv fragments, Fab' fragments, F(ab')2 fragments, single-chain antibodies (ScFv), or minimum recognition units (MRUs) containing the nanobody.
[0008] In this invention, the "Fab fragment" is a heterodimer formed by the heavy chain Fd and the intact light chain linked by disulfide bonds, containing only one antigen-binding site. The aforementioned heavy chain Fd refers to approximately half of the H chain portion of Fab (containing approximately 225 amino acid residues, including VH, CH1, and part of the hinge region).
[0009] In this invention, "Fv fragment" refers to a vector containing VH and VL genes that can be constructed separately, co-transfected into cells to express them separately, and then assembled into a functional Fv antibody; alternatively, a stop codon can be set between VH and VL in the vector to express two small protein fragments, which can then be bound together by non-covalent bonds to form an Fv antibody (Fv fragment).
[0010] In this invention, the “Fab′ fragment” contains a light chain and a heavy chain portion that includes the VH domain, the CH1 domain, and the region between the CH1 and CH2 domains, thereby enabling the formation of interchain disulfide bonds between the two heavy chains of two Fab′ fragments to form the F(ab′)2 molecule.
[0011] In this invention, the “F(ab′)2 fragment” contains two light chains and two heavy chains comprising portions of a constant region between the CH1 and CH2 structural domains, thereby forming interchain disulfide bonds between the two heavy chains. Therefore, the F(ab′)2 fragment consists of two Fab′ fragments held together by disulfide bonds between the two heavy chains.
[0012] In this invention, "single-chain antibody (ScFv)" refers to a polypeptide obtained by linking a light chain variable region and a heavy chain variable region. This polypeptide can spontaneously fold into its native conformation, maintaining the specificity and affinity of Fv.
[0013] In this invention, the light chain variable region (VL) or heavy chain variable region (VH) of the antibody is composed of a "framework" region separated by three "complementarity-determining regions" or "CDRs". The framework regions are used to align the CDRs that specifically bind to the antigenic epitopes. The CDRs include the amino acid residues in the antibody that are primarily responsible for antigen binding. Both the VL and VH domains contain the following framework (FR) and CDR regions from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The CDR1, CDR2, and CDR3 of the VL domain are also referred to herein as LCDR1, LCDR2, and LCDR3, respectively; and the CDR1, CDR2, and CDR3 of the VH domain are also referred to herein as HCDR1, HCDR2, and HCDR3, respectively.
[0014] In the above-mentioned antibodies, the heavy chain type of the antibody is IgG2b; and / or the light chain type of the antibody is kappa.
[0015] The CDRs mentioned above are sequences defined according to the Kabat numbering system.
[0016] Furthermore, the amino acid sequence of the light chain variable region of the antibody is SEQ ID No:4; and / or the amino acid sequence of the heavy chain variable region of the antibody is SEQ ID No:5.
[0017] Furthermore, the monoclonal antibody or its antigen-binding fragment may further include a heavy chain constant region (CH) and a light chain constant region (CL). The heavy chain constant region may be selected from the heavy chain constant regions of IgG, IgA, IgM, IgD, and IgE. The heavy chain constant region may also be selected from the CH1, Fc, and CH3 domains. The light chain constant region may be selected from Kappa (κ) and lambda (λ) type light chain constant regions. The heavy chain constant region and light chain constant region may be derived from humans or non-human mammals (such as mice, rats, guinea pigs, rabbits, sheep, camels, etc.).
[0018] Furthermore, the heavy chain constant region may be the heavy chain constant region of mouse IgG2a.
[0019] Furthermore, the light chain constant region can be the mouse Kappa(κ) type light chain constant region.
[0020] Furthermore, the nucleotide sequence of the heavy chain constant region may be as shown in SEQ ID No:11.
[0021] Furthermore, the nucleotide sequence of the light chain constant region may be as shown in SEQ ID No:12.
[0022] The present invention also provides the following biomaterials, wherein the biomaterials are any one of the following:
[0023] A1) Nucleic acid molecules that encode the heavy chain variable region and light chain variable region of the monoclonal antibody or its antigen-binding fragment described above;
[0024] A2) An expression cassette containing the nucleic acid molecule described in A1);
[0025] A3) A recombinant vector containing the nucleic acid molecules described in A1);
[0026] A4) Recombinant microorganisms containing the nucleic acid molecules described in A1);
[0027] A5) Recombinant host cells containing the nucleic acid molecules described in A1).
[0028] Furthermore, in the nucleic acid molecule described in (A1), the nucleotide sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region encoding the antibody are shown in SEQ ID No:9, lines 70 to 102, 148 to 168 and 265 to 291, respectively.
[0029] and / or
[0030] In the nucleic acid molecule described in (A1), the nucleotide sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region encoding the antibody are shown in positions 91 to 105, 148 to 198 and 295 to 330 of SEQ ID No:10, respectively.
[0031] Furthermore, the DNA molecule shown in SEQ ID No:10 encodes the amino acid sequence of the heavy chain variable region of SEQ ID No:5. The DNA molecule shown in SEQ ID No:9 encodes the amino acid sequence of the light chain variable region of SEQ ID No:4.
[0032] Furthermore, the vector may be selected from prokaryotic expression vectors (including but not limited to Escherichia coli expression vectors such as BL21 series expression cells, M15 expression cells, Top10 expression cells and Origamai series expression cells) and eukaryotic expression vectors (including but not limited to yeast expression vectors such as X33 cells, GS115 cells and SMD1168 cells, insect cell expression vectors such as Sf21 cells, Sf-9 cells and Hi-5 cells, mammalian cell expression vectors such as HET293 cells and CHO cells).
[0033] The antibody is monoclonal antibody DIVA55.
[0034] The present invention also provides a kit for antibody detection to identify classical swine fever E2 protein-labeled subunit vaccination and wild-type virus infection, the kit comprising the antibody or its antigen-binding fragment described above.
[0035] The test samples for the kit can be environmental samples, blood samples (such as whole blood, plasma, serum), sputum samples, tissue samples, cell samples, fecal samples, etc., but are not limited to these.
[0036] Furthermore, the environmental samples may include feed mill environmental samples (such as feed silos, conveyor belts, workbenches, ground, etc.), aquaculture environmental samples (such as sludge, aquaculture feed, soil, feed troughs, rags used for wiping the environment, swabs, aquaculture water, air, etc.) and surrounding environmental samples (such as transport vehicles, surrounding farmland, etc.).
[0037] The kit may be a chemiluminescent immunoassay kit, enzyme-linked immunosorbent assay kit, immunoprecipitation assay kit, immunoblotting assay kit, immunochromatographic assay kit, flow cytometry assay kit, immunohistochemistry assay kit, colloidal gold immunoassay kit, or fluorescent immunoassay kit, but is not limited thereto.
[0038] Furthermore, the kit may also include reagents required for immunoassay, such as labeled antibodies or antigens, magnetic microparticles, blocking solution, diluent, washing solution, chromogenic solution, stop solution, etc., but not limited to these.
[0039] The various reagent components of the kit may be present in separate containers, or may be pre-assembled into a reagent mixture, either wholly or partially.
[0040] The components of the kit may be provided in solution form, such as an aqueous solution. When present in aqueous solution, the concentration or content of these components can be readily determined by those skilled in the art according to different needs. For example, for storage purposes, the components may be present at a higher concentration, which can be reduced to the working concentration by diluting the higher concentration solution when in operation or for use.
[0041] The kit may also contain, for example, buffers, preservatives, or protein stabilizers. The kit may also contain components necessary for detecting the detectable label, such as enzymes or substrates. The kit may also contain one or a series of control samples, which can be measured and compared to the test sample. The kit may have written instructions on or included with the kit container. The written instructions describe how to use the reagents included in the kit.
[0042] In one specific embodiment, the kit is a blocking ELISA kit, and the detection method when using the kit is serological detection.
[0043] The classical swine fever virus can be any genotype of wild-type CSFV strain or the swine fever rabbit-attenuated live vaccine strain C (HCLV).
[0044] The present invention also provides an antibody conjugate comprising an antibody portion and a conjugation portion, wherein the antibody portion is the monoclonal antibody or its antigen-binding fragment described above, and the conjugation portion is a detectable label.
[0045] Furthermore, the antibody portion and the conjugated portion can be directly connected or covalently connected through a connector (such as a hydrazone bond, disulfide bond, thioether bond, or peptide bond).
[0046] Furthermore, the detectable markers include enzymes (such as horseradish peroxidase (HRP), alkaline phosphatase (AP), β-galactosidase, etc.), chemiluminescent reagents (such as acridine esters, acridine sulfonamides, luminol and its derivatives, ruthenium derivatives, etc.), and fluorescent dyes (such as AMCA, FITC, CFSE, GFP, DAPI, 7-AAD, Hoechst 33342, Pacific Blue, PE, PE-TR, PE-Cy7, PE-Cy5, PI, PerCP-Cy5.5, APC, APC-CY7, APC-H7, V500, Alexa). 700, BV605, BV480, BV785, BV510, BV711, BV421, etc.), near-infrared dyes (such as cyanine dyes, BODIPY dyes, rhodamine dyes, squaric acid dyes, porphyrin dyes, etc.), radionuclides (such as 125I, 18F, 11C, 99mTc, 123I, etc.), biotin, nanoparticles for magnetic resonance imaging, quantum dots for magnetic resonance imaging, magnetic materials (such as magnetic beads, nanoparticles containing gadolinium complexes, superparamagnetic iron oxide nanoparticles), and colloidal gold, but not limited to these.
[0047] As those skilled in the art will recognize, the conjugates and fusion antibody expression products comprise: conjugates formed by binding drugs, toxins, cytokines, radionuclides, enzymes, and other diagnostic or therapeutic molecules to the antibodies or fragments thereof of the present invention. The present invention also includes cell surface markers or antigens that bind to the monoclonal antibodies or fragments thereof.
[0048] The antigen described in this invention is the E2 protein of classical swine fever virus. The amino acid sequence of the E2 protein is located at GenBank: AY526732, positions 1171-2259, updated on July 26, 2016.
[0049] The antibody conjugate may be an HRP-DIVA55 conjugate antibody.
[0050] The present invention also provides the use of the antibodies described above in any of the following:
[0051] (B1) Prepare products for recognizing or assisting in the recognition of classical swine fever virus E2 protein;
[0052] (B2) Prepare products for binding or assisting in the binding of classical swine fever virus E2 protein;
[0053] (B3) Detection or auxiliary detection of whether the sample to be tested contains classical swine fever virus E2 protein;
[0054] (B4) Prepare products for detecting or assisting in the detection of whether the sample to be tested contains classical swine fever virus E2;
[0055] (B5) Prepare products for serological identification of classical swine fever virus E2 protein-labeled subunit vaccine immunization and wild-type strain infection;
[0056] (B6) Prepare products that can identify and differentiate diseases caused by immunization with E2-marked classical swine fever virus vaccine strains and infection with wild-type strains;
[0057] (B7) Detection or auxiliary detection of the content of classical swine fever virus E2 protein in the sample to be tested;
[0058] (B8) Detection or auxiliary detection of the content of classical swine fever virus E2 protein antibody in the sample to be tested;
[0059] (B9) Prepare products for detecting or assisting in the detection of the content of classical swine fever virus E2 protein in the sample to be tested;
[0060] (B10) Prepare products for detecting or assisting in the detection of the content of swine fever virus E2 protein antibodies in the sample to be tested.
[0061] This invention also provides the use of the aforementioned biomaterials in any of the following:
[0062] (B1) Prepare products for recognizing or assisting in the recognition of classical swine fever virus E2 protein;
[0063] (B2) Prepare products for binding or assisting in the binding of classical swine fever virus E2 protein;
[0064] (B3) Detection or auxiliary detection of whether the sample to be tested contains classical swine fever virus E2 protein;
[0065] (B4) Prepare products for detecting or assisting in the detection of whether the sample to be tested contains classical swine fever virus E2;
[0066] (B5) Prepare products for serological identification to distinguish between classical swine fever virus E2 protein-labeled subunit vaccines and infections from circulating strains;
[0067] (B6) Prepare products that can identify and differentiate diseases caused by immunization with classical swine fever virus E2-marked vaccine strains and infection with circulating strains;
[0068] (B7) Detection or auxiliary detection of the content of classical swine fever virus E2 protein in the sample to be tested;
[0069] (B8) Detection or auxiliary detection of the content of classical swine fever virus E2 protein antibody in the sample to be tested;
[0070] (B9) Preparation of products for detecting or assisting in the detection of the content of classical swine fever virus E2 protein antibodies in the sample to be tested.
[0071] (B10) Prepare products for detecting or assisting in the detection of the content of swine fever virus E2 protein antibodies in the sample to be tested.
[0072] The product used to identify or assist in the identification of classical swine fever virus E2 protein and antibodies can be a test kit.
[0073] In this article, the product that binds to or assists in binding the classical swine fever virus E2 protein can be an E2 protein inhibitor, or a product used to isolate or purify the E2 protein, but is not limited thereto. For example, the monoclonal antibody or its antigen-binding fragment described in this invention can be prepared into an immunoaffinity chromatography column. Based on the principle that the antigen can be captured by the antibody when passing through the chromatography column, and that environmental conditions such as changing the pH value can cause the antigen to dissociate from it, the E2 protein can be screened and isolated.
[0074] In this study, serum samples from immunized pigs and infected pigs with the classical swine fever virus E2 protein-labeled subunit vaccine and wild-type strain infection were obtained from immunized pigs and infected pigs, respectively. Then, the presence or content of classical swine fever virus E2 protein antibodies in the serum samples was detected by an antibody blocking ELISA kit developed based on the monoclonal antibody or its antigen-binding fragment. The identification of classical swine fever virus E2 protein-labeled subunit vaccine immunization and wild-type strain infection was performed based on the detection results.
[0075] In this document, the detection or auxiliary detection of the E2 protein content of classical swine fever virus in the test sample includes the detection of any in vivo or in vitro E2 protein based on the principle of antigen-antibody specific reaction. The detection of E2 protein may be to detect whether the test sample contains E2 protein and / or to detect the content of E2 protein in the test sample.
[0076] The products described herein may include reagents, kits, chips, test strips, test cards, and immunosensors.
[0077] In this article, the methods for detecting E2 protein and its antibodies may be for disease diagnosis, disease prognosis and / or disease treatment purposes, or they may be for non-disease diagnosis, non-disease prognosis and non-disease treatment purposes.
[0078] The non-disease diagnosis, non-disease prognosis, and non-disease treatment purposes may be to detect whether there is viral contamination in environmental samples.
[0079] The subjects may be humans or non-human animals (such as pigs, cattle, sheep, rabbits, cats, horses, deer, monkeys, chickens, dogs, etc.). The antibodies described herein can be prepared using various methods known in the art, such as through genetic engineering recombination techniques. For example, DNA molecules encoding the heavy and light chain genes of the antibodies of this invention can be obtained through chemical synthesis or PCR amplification. The obtained DNA molecules are inserted into an expression vector, then transfected into host cells, and the transfected host cells are cultured under specific conditions to express the antibodies of this invention. Those skilled in the art can select, as needed, conventional host cells, expression vectors, methods for introducing the expression vector into host cells, and antibody isolation and purification methods.
[0080] The present invention also provides a method for preparing the antibody described above, comprising expressing the monoclonal antibody or its antigen-binding fragment described above in a host cell, and recovering or separating the monoclonal antibody or its antigen-binding fragment.
[0081] The host cell can be a microbial cell or a eukaryotic cell, such as bacteria (e.g., Escherichia coli), yeast, algae, or fungi.
[0082] Furthermore, the host cell may be a 293T cell.
[0083] The present invention also provides a method for detecting antibodies against the E2 protein of wild-type classical swine fever virus, the method comprising using the monoclonal antibody or its antigen-binding fragment described above, the kit described above, or the antibody-drug conjugate described above to detect antibodies against the E2 protein of wild-type classical swine fever virus.
[0084] This invention utilizes genetic engineering to prepare the monoclonal antibody DIVA55. The monoclonal antibody (DIVA55) specifically reacts with the E2 protein of wild-type classical swine fever virus (CSFV) strains, but does not react with CSFV E2 protein-labeled vaccines. Using antibody DIVA55, a blocking ELISA method was established to serologically differentiate between CSFV E2 protein-labeled subunit vaccine immunization and wild-type strain infection. The monoclonal antibody DIVA55 of this invention can be used in serological diagnosis, evaluation of immunization efficacy, and related experiments for CSFV immunization and wild-type virus infection. It features simple operation, rapid large-scale sample detection, high sensitivity and specificity for specific antibodies, and low cost, providing antibody resources for the serological identification and eradication of CSFV immunization and infection. Attached Figure Description
[0085] Figure 1 PCR identification of the recombinant protein expression plasmid of classical swine fever virus E2.
[0086] Figure 2 Immunological identification of recombinant E2 protein of classical swine fever virus.
[0087] Figure 3The results of SDS-PAGE validation of the purified monoclonal antibody DIVA55 are shown.
[0088] Figure 4 The results are from Western blot experiments of monoclonal antibody DIVA55 with mutated and unmutated E2 protein of classical swine fever virus.
[0089] Figure 5 The results were used to validate the expression activity of the monoclonal antibody DIVA55 at IFA. Among the components were: HCLV (swine fever rabbit-attenuated live vaccine, strain C); SM (swine fever virus SM virulent strain); WH303 (E2 protein positive control antibody); and DIVA55 (E2 protein monoclonal antibody).
[0090] Figure 6 Clinical scoring for testing the protective efficacy of the classical swine fever virus E2 protein-labeled subunit vaccine.
[0091] Figure 7 Viral copy number in each tissue for testing the protective efficacy of the classical swine fever virus E2 protein-labeled subunit vaccine.
[0092] Figure 8 E2 antibody levels were used to test the protective efficacy of classical swine fever virus (CSF) E2 protein-labeled subunit vaccines. A represents the changes in E2 antibody levels after two immunizations with the E2 protein-labeled subunit vaccine (Group 1) and the E2 protein subunit vaccine TWJ-E2 (Group 3), and after challenge with the JL23 strain. B represents the changes in E2 antibody levels after one immunization with strain C (Group 2) and after challenge with the JL23 strain. C represents the changes in E2 antibody levels in unimmunized pigs (Group 4) challenged with the JL23 strain and in unimmunized and unchallenged pigs (Group 5). Detailed Implementation
[0093] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0094] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0095] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0096] The pcDNA3.1 vector used in the following examples was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number A339023.
[0097] The CSFV broad-spectrum antibody WH303 in the following examples is described in the following literature: Mishijiang. Identification of monoclonal antibodies and broad-spectrum monoclonal antibodies for differentiating wild-type and vaccine strains of classical swine fever virus and their antigenic epitope analysis [D]. Jilin University, 2022. The public may obtain this biological material from the applicant. This biological material is only for repeating the experiments of this invention and may not be used for other purposes.
[0098] The protein-tagged antibody anti-His Tag mAb used in the following examples was purchased from Solarbio, catalog number K200060M.
[0099] The CSFV SM strain, the swine fever rabbit-attenuated live vaccine (HCLV, also known as strain C), the vaccine strain LPC, and the wild-type strain JL23 in the following examples are described in: Shijiang Mi, Lihua Wang, Hongwei Li, et al. Characterization of monoclonal antibodies that specifically differentiate field isolates from vaccine strains of classical swine fever virus. Frontiersin Immunology, 2022, 13, 930631. This biological material is available to the public from the applicant and is intended solely for repeating experiments of this invention and may not be used for any other purpose.
[0100] Example 1: Preparation of recombinant classical swine fever virus E2 protein
[0101] Based on the E2 gene of classic strains and wild-type strains (such as vaccine strain C, LPC strain, and wild-type strains SM and JL23) from both domestic and international sources, this invention mutates the amino acid sequences 193P, 195V, 197T, 200L, and 203Q of the LPC E2 protein to 193V, 195K, 197V, 200P, and 203K, ultimately obtaining a nucleic acid molecule encoding the recombinant E2 protein of classical swine fever virus (nucleotide sequence SEQ ID No:2), which can express the recombinant E2 protein of classical swine fever virus, and its amino acid sequence is shown in SEQ ID No:1.
[0102] 1. Mutation of the E2 gene of classical swine fever virus and construction of eukaryotic expression vector
[0103] Based on the amino acid sequence (SEQ ID No:3) of the E2 protein of the classical swine fever virus (CSFV) vaccine strain LPC (CSFV-LPC), the amino acids 193P, 195V, 197T, 200L, and 203Q of the LPC E2 protein (genomic nucleotide sequence SEQ ID No:6) were mutated to 193V, 195K, 197V, 200P, and 203K, respectively, to obtain the nucleotide sequence SEQ ID No:2. In addition to the restriction enzyme sites, the Kozak sequence 5'-GCCACC-3' and the LPC E2 signal peptide sequence 5'-ATGTCAACCACGGCATTTCTCATCTGCTTGGTAAAAGTATTAAGAGGACAGATCGTGCAAGGTGTGATATGGCTGCTATTAGTAACTGGGGCACAAGGC-3' (SEQ ID No:17) were added to the 5' end. A His tag (His tag nucleotide sequence 5'-CATCATCACCATCACCAT-3', SEQ ID No:17) was added to the 3' end. No:18) and restriction enzyme sites Bam HI (sequence 5'-GGATCC-3') yielded the nucleotide sequence SEQ ID No:7. After sequence synthesis, it was confirmed by PCR amplification and agarose gel electrophoresis, as shown in the figure. Figure 1 As shown.
[0104] The amplified target E2 (mutant) gene fragment was recovered using a gel extraction kit. The correctly identified target E2 gene fragment was digested with enzymes, mixed with the pcDNA3.1 vector and T4 ligase at a 3:1 molar ratio, and ligated overnight at 16°C in a metal bath. 2 μL of the ligation product was mixed with 50 μL of DH5α E. coli competent cells, transformed, and single colonies were picked and cultured. Positive colonies were identified by PCR, and sequencing confirmed the presence of the recombinant expression plasmid pcDNA3.1-E2 (mutant).
[0105] The structure of the pcDNA3.1-E2 (mutant) vector is described below: It is a vector expressed in the eukaryotic expression vector pcDNA3.1. Eco RI and Bam A recombinant vector was obtained by inserting a DNA fragment with the sequence SEQ ID No:7 between the two HI restriction sites while keeping the other sequences of the vector pcDNA3.1 unchanged.
[0106] The recombinant expression plasmid pcDNA3.1-E2, obtained from the E2 protein genome sequence (nucleotide sequence SEQ ID No:6) of the vaccine strain LPC (CSFV-LPC) using the same procedure, served as a control.
[0107] The only difference between the pcDNA3.1-E2 vector and the pcDNA3.1-E2 (mutant) vector is that the DNA molecule described in SEQ ID No:7 in the pcDNA3.1-E2 (mutant) vector is replaced with the DNA molecule described in SEQ ID No:8.
[0108] 2. Expression and identification of the target protein
[0109] CHO cells (ATCC number: CCL-61) were stored at a density of 3-4 × 10⁻⁴ cells / year. 6 CFU / mL, cultured overnight at 37°C in a shaking incubator with 8% CO2 in 50 mL ExpiCHO™ expression medium (Gibco™, catalog number 10743029), following the guidelines for ExpiFectamine. TM The CHO Transfection Kit (purchased from Gibco™, catalog number A29129) instructions are as follows: Transfect pcDNA3.1-E2 and pcDNA3.1-E2 (mutant) recombinant plasmids into CHO cells separately: Take two 15 mL centrifuge tubes and add 2 mL of pre-chilled OptiPRO™ SFM buffer to each tube. Add 160 μL of ExpiFectamine™ CHO transfection reagent to one 15 mL centrifuge tube and 50 μg of the plasmid to be transfected to the other 15 mL centrifuge tube. Mix thoroughly in each tube, then combine them and mix again. Incubate at room temperature for 5 min. Add the complex of ExpiFectamine™ CHO transfection reagent and the plasmid to be transfected into the CHO cells, gently shake to mix, and incubate at 37°C with 8% CO2 for 18 to 22 h. Mix 12 mL of ExpiCHO™ Feed reagent and 300 μL of ExpiFectamine™ CHO Enhancer reagent thoroughly, add to the transfected CHO cells, and continue culturing for 8 days. Cell samples were collected, centrifuged at 6000 rpm and 4℃ for 30 min, and the culture supernatant was collected. The total protein content in the samples was determined by the Bicinchoninic Acid (BCA) method.
[0110] The expression of the above-described protein was verified by Western blot experiment, and the steps are as follows:
[0111] ① Protein treatment: Add E2 protein (mutated recombinant protein and non-mutated recombinant protein) to 4× loading buffer in proportion and boil for 10 min.
[0112] ② Protein electrophoresis: Load the processed protein (10 μL per lane) into a 10% SDS-PAGE gel and perform protein electrophoresis. The program is 55 V for 50 min and 110 V for 80 min.
[0113] ③ Transfer: Use a semi-dry transfer method to transfer the proteins after electrophoresis to an NC membrane (purchased from GE, catalog number: [list of products]).
[0114] 10600002), the program is 23 V-25 min.
[0115] ④ Blocking: Add 5 g of skim milk powder (purchased from BD, catalog number 232100) to every 100 mL of PBS, and shake thoroughly to prepare the blocking solution. Add 5 mL of blocking solution to a resealable bag and place on a shaker at room temperature to block the NC membrane for 1 h.
[0116] ⑤ Incubation with primary antibody: Anti-His Tag antibody was diluted 1:3000 with blocking buffer and incubated overnight at 4°C on a shaker.
[0117] ⑥ Incubate with secondary antibody: Wash the membrane 3 times with PBS, add Alexa Fluor 680-labeled fluorescent secondary antibody (purchased from Invitrogen, catalog number 8310-16) diluted 1:5000 with PBS, and incubate on a shaker at room temperature in the dark for 1 h.
[0118] ⑦ Scan the NC membrane: Wash the membrane three times with PBS, place it in a two-color infrared laser imaging system for scanning, and save the image.
[0119] The results are as follows Figure 2 As shown, the recombinant E2 protein exhibits specific bands around 45 kDa and 90 kDa, indicating successful expression of the recombinant protein.
[0120] 3. Vaccine preparation
[0121] Expression of recombinant E2 marker protein of classical swine fever virus: CHO cells transfected with pcDNA3.1-E2 (mutant) plasmid were cultured in a bioreactor. After optimization, the dissolved oxygen concentration in the bioreactor was between 40% and 50%, the temperature was 27℃, the rotation speed was 40-120 rpm, and the cell density at expression was 2×10⁶ cells / year. 6 Cells / mL, after culturing for 150 h, a stable expression of over 140 μg / mL can be obtained, which is 20 μg higher than the expression in conventional shake flask culture. Cell debris is removed, and the supernatant is collected as the labeled classical swine fever virus E2 protein solution.
[0122] The classical swine fever virus E2 protein was emulsified with 563VG (Cybex, catalog number: 36025H) to prepare a vaccine: First, the 563VG oil adjuvant was sterilized (121℃, 15pa, 20 min). The protein antigen and adjuvant were mixed at a 1:1 (mass ratio) and emulsified at 5000 rpm for 10 min, stopped for 10 min, and then emulsified again at 5000 rpm for 10 min to obtain the classical swine fever virus E2 protein-labeled subunit vaccine.
[0123] Example 2: Preparation of Antibodies by Genetic Engineering
[0124] Hybridoma cells secreting DIVA55 were sent to Nanjing Detai Biotechnology Co., Ltd. for sequencing, and the sequence was obtained as follows:
[0125] The amino acid sequence of the heavy chain variable region of monoclonal antibody DIVA55 is shown in SEQ ID No:5, and the nucleotide sequence of the gene encoding the heavy chain variable region is shown in SEQ ID No:10; the amino acid sequence of the light chain variable region of monoclonal antibody DIVA55 is shown in SEQ ID No:4, and the nucleotide sequence of the gene encoding the light chain variable region is shown in SEQ ID No:9. Wherein:
[0126] The amino acid sequence of the CDR1 variable region of the heavy chain of monoclonal antibody DIVA55 is shown in positions 31-35 of SEQ ID No:5;
[0127] The amino acid sequence of the CDR2 variable region of the heavy chain of monoclonal antibody DIVA55 is shown in positions 50-66 of SEQ ID No:5;
[0128] The amino acid sequence of the CDR3 variable region of the heavy chain of monoclonal antibody DIVA55 is shown in positions 99-110 of SEQ ID No:5;
[0129] The amino acid sequence of the CDR1 variable region of the light chain of monoclonal antibody DIVA55 is shown in positions 24-34 of SEQ ID No:4;
[0130] The amino acid sequence of the CDR2 variable region of the light chain of monoclonal antibody DIVA55 is shown in positions 50-56 of SEQ ID No:4;
[0131] The amino acid sequence of the CDR3 variable region of the light chain of monoclonal antibody DIVA55 is shown in positions 89-97 of SEQ ID No:4.
[0132] 1. Construction of recombinant expression plasmids
[0133] To express the monoclonal antibody DIVA55, heavy chain expression vectors and light chain expression vectors were prepared separately: The nucleotide sequence of the DIVA55 heavy chain gene was obtained by directly linking the nucleotide sequence of the heavy chain variable region encoding gene (SEQ ID No: 10) with the mouse-IgG2a template sequence (heavy chain constant region sequence, SEQ ID No: 11). The nucleotide sequence of the DIVA55 light chain gene was obtained by directly linking the nucleotide sequence of the light chain variable region encoding gene (SEQ ID No: 9) with the mouse-kappa template sequence (light chain constant region sequence, SEQ ID No: 12).
[0134] The heavy chain gene and light chain gene of the monoclonal antibody DIVA55 were cloned into the vector pcDNA3.4, respectively, to obtain the heavy chain expression vector pcDNA3.4-H and the light chain expression vector pcDNA3.4-L. The recombinant vectors pcDNA3.4-H (which can express the heavy chain) and pcDNA3.4-L (which can express the light chain) were synthesized by Nanjing Detai Biotechnology Co., Ltd.
[0135] The structure of pcDNA3.4-H is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:13 between the Xbal and BamHI restriction sites of the eukaryotic expression vector pcDNA3.4, while keeping the other sequences of the vector pcDNA3.4 unchanged. The pcDNA3.4-H vector can express the DIVA55 antibody heavy chain, and its amino acid sequence is SEQ ID No:15.
[0136] The structure of pcDNA3.4-L is described as follows: a DNA fragment with the sequence SEQ ID No:14 is inserted between the two restriction sites Xbal and BamHI of the eukaryotic expression vector pcDNA3.4. The pcDNA3.4-L vector can express the DIVA55 antibody light chain, and its amino acid sequence is SEQ ID No:16.
[0137] 2. Antibody expression
[0138] a) Freshly digested 293T cells (purchased from Cybio, catalog number HEMCL-032) were seeded into 175 cm⁻¹ cells. 2 Add 35 mL of DMEM medium (Corning, catalog number 10-013-CVRC) containing 8% FBS to the culture flask and culture the cells to a density of 90%.
[0139] b) Dilute 200 μg of vector plasmid containing light and heavy chains (100 μg each) and 200 μL of QuickShuttle-293 cell transfection reagent (Biolong, catalog number KX0110044) into 1 mL of physiological saline.
[0140] c) Combine the two solutions from step b) above and mix them well to obtain the complex.
[0141] d) Add the above complex directly to the cell culture medium in step a), and mix well by pipetting.
[0142] e) Transfer the cell plate to a 37ºC / 5% CO2 incubator for culture, and collect the culture supernatant after 3 days of culture.
[0143] 3. Antibody purification
[0144] a) Buffer preparation: Add Na2HPO4·12H2O to sterile ddH2O to make the final concentration 0.2 M, and shake thoroughly to mix.
[0145] b) Preparation of pre-elution buffer: Add 0.1 M citric acid to the buffer solution to make the volume percentage of citric acid 20%.
[0146] c) Preparation of elution buffer: Add 0.1 M citric acid to the buffer solution to make the volume percentage of citric acid 60%.
[0147] d) Sample processing: Take 30 mL of the cell expression supernatant verified in step 3), add the buffer prepared in step a) at a volume ratio of 1:1, filter with a pore size of 0.22 μm and prepare for column loading.
[0148] e) Equilibrate the column: Use a constant flow pump to slowly pass 10 mL of buffer solution through a pre-packed Protein A / G4FF column (purchased from Sangon Biotech, catalog number C600983) at a flow rate of 1 mL / min.
[0149] f) Sample loading: Use a constant flow pump to slowly pass the solution from step d) through the Protein A / G column at a flow rate of 1 mL / min.
[0150] g) Washing: Use a constant flow pump to slowly pass 10 mL of washing buffer through the Protein A / G column at a flow rate of 1 mL / min.
[0151] h) Pre-elution: Use a constant flow pump to slowly pass 10 mL of pre-elution solution through the Protein A / G column at a flow rate of 1 mL / min.
[0152] i) Elution: Use a constant flow pump to slowly pass 15 mL of eluent through the Protein A / G column at a flow rate of 1 mL / min, and aliquot the elution product into 1.5 mL centrifuge tubes.
[0153] The expression of antibodies was verified using an indirect immunofluorescence assay (IFA). The expression supernatant was used as the primary antibody, and the broad-spectrum CSFV antibody WH303 was used as a control. The antibody was compared with the wild-type CSFV strain SM and the rabbit-adapted attenuated classical swine fever vaccine strain C (HCLV) for indirect immunofluorescence assay (IFA). The specific steps are as follows:
[0154] ① Cell inoculation: Simultaneously administer 100 TCID50. 50 CSFV cytotoxicity was inoculated into each well, and PK-15 cells were added to a 96-well plate and incubated at 37°C in a 5% CO2 incubator for 72 h.
[0155] ② Cell fixation: Discard the cell culture supernatant, add 200 μL PBS to each well of a 96-well plate and wash three times, add 50 μL of 80% cold acetone stored at -20℃, and fix in a -20℃ freezer for 1 h.
[0156] ③ Primary antibody incubation: Discard the cold acetone fixative, add 200 μL of PBS to each well and wash 3 times, add 100 μL of hybridoma cell culture supernatant to each well, and incubate at 37℃ for 1 h.
[0157] ④ Secondary antibody incubation: Discard the primary antibody incubation solution, add 200 μL of PBS to each well and wash 3 times. Dilute the Alexa Fluor 488 fluorescent secondary antibody 1:500 with PBS, and add 0.01% Evans Blue and 5% FBS. Mix thoroughly and add 100 μL to each well of the cell plate. Incubate at 37°C for 1 h.
[0158] ⑤ Fluorescence observation: Discard the secondary antibody incubation solution, add 200 μL of PBS to each well and wash 3 times, then observe the reaction between serum antibody and infected cells under a fluorescence microscope.
[0159] The results are as follows Figure 5 As shown, the control antibody showed obvious green fluorescence in the reaction with cells infected with wild-type SM virus and cells infected with vaccine strain HCLV, indicating successful inoculation; the supernatant of 293T cells expressing the antibody also showed obvious green fluorescence in the reaction with cells infected with wild-type SM virus and cells infected with vaccine strain HCLV, indicating that antibody DIVA55 was successfully expressed.
[0160] 3. Validation of purified antibodies
[0161] The purified antibody DIVA55 was added to a reducing buffer containing DTT in a specific ratio and loaded for SDS-PAGE. The results are as follows. Figure 3 As shown: After treatment with reducing buffer, the antibody showed two distinct bands at approximately 25 kDa and 50 kDa, representing the light and heavy chains, indicating that the antibody was well purified.
[0162] The purified antibody DIVA55 was subjected to Western blot experiments with mutant and non-mutated LPC E2 protein, and the results are as follows: Figure 4 As shown: when the purified antibody reacts with the non-mutated E2 protein, lane 2 shows a band at 90 kDa; however, it does not react with the mutant E2 protein, and lane 3 shows no specific band.
[0163] 4. Preparation of HRP-conjugated antibody HRP-DIVA55
[0164] DIVA55 was coupled to HRP using an HRP coupling kit (Sangon Biotech, D601047):
[0165] (1) Mix 500 μL of HRP solution with 200 μL of HRP activation buffer on a shaker at room temperature for 30 min by inverting the mixture.
[0166] (2) Add 200 μL of HRP coupling buffer and let stand at room temperature for 30 min.
[0167] (3) Place 1 mg of purified DIVA55 in a dialysis bag and dialyze in 2 L of dialysis solution at room temperature for 2 h.
[0168] (4) Add 100 μL of reducing agent to the dialysis product, let stand at room temperature for 2 h, gently mix once every 30 min, dispense and store the coupling product HRP-DIVA55.
[0169] Example 3: Verification of the Immunization Efficacy of the Classical Swine Fever Virus E2 Protein-Labeled Subunit Vaccine
[0170] 1. Safety testing of classical swine fever virus E2 protein-labeled subunit vaccine
[0171] Ten healthy weaned piglets (Tiankang Livestock Technology Co., Ltd.) aged 4-5 weeks with negative results for both classical swine fever virus nucleic acid and antibodies were selected. Five piglets (numbered V1, V2, V3, V4, and V5) were injected intramuscularly into the neck behind the ears with 30 μg of classical swine fever virus E2 protein-labeled subunit vaccine. Five piglets (numbered C1, C2, C3, C4, and C5) were not injected as negative controls. The piglets were observed for 14 consecutive days, and rectal temperature was measured daily. Specific body temperatures are shown in Table 1. The body temperature of both the vaccine-immunized group and the control group did not exceed 40℃, and no deaths occurred. The piglets exhibited normal mental status, among other information.
[0172] Table 1. Experimental results of safety testing for classical swine fever virus E2 protein-labeled subunit vaccines.
[0173]
[0174] 2. Testing the protective efficacy of classical swine fever virus E2 protein-labeled subunit vaccines
[0175] Twenty-five healthy weaned piglets that were negative for both classical swine fever virus nucleic acid and antibodies were selected and divided into the following groups:
[0176] The first group (5 heads, 1-1, 1-2, 1-3, 1-4, 1-5) was immunized with the classical swine fever virus E2 protein-labeled subunit vaccine, which was administered twice via intramuscular injection in the neck, each time with an adjuvant-emulsified protein (30 μg).
[0177] The second group (5 heads, 2-1, 2-2, 2-3, 2-4, 2-5) was immunized with classical swine fever rabbit-attenuated live vaccine (C strain, passaged cell source), once by intramuscular injection in the neck, with a dose of 1 mL per head.
[0178] The third group (5 heads, 3-1, 3-2, 3-3, 3-4, 3-5) was immunized with the classical swine fever virus E2 protein subunit vaccine (TWJ-E2, purchased from Tiankang Pharmaceutical Co., Ltd., product name: Tianwenjing), which was administered twice via intramuscular injection in the neck, each time with an adjuvant-emulsified protein (30 μg).
[0179] The fourth group (5 animals, 4-1, 4-2, 4-3, 4-4, 4-5) was the non-immunized challenge group, and 1 mL of wild-type toxin was injected into the neck intramuscularly.
[0180] The fifth group (5 animals, 5-1, 5-2, 5-3, 5-4, 5-5) was a healthy control group that was not immunized or challenged with the virus and was raised in isolation under the same conditions.
[0181] The methods for obtaining the vaccine serum for the second and third groups mentioned above are described in the following literature: Gong W, Li J, Wang Z, et al. Commercial E2 subunit vaccine provides full protection to pigs against lethal challenge with 4 strains of classical swine fever virus genotype 2. Vet Microbiol. 2019;237:108403.
[0182] The E2 protein-labeled subunit vaccine (Group 1) and the E2 protein subunit vaccine TWJ-E2 (Group 3) prepared in Example 1 were administered a second immunization 21 days after the first immunization. After a 14-day interval, all immunized pigs were intramuscularly injected with 1 ml of wild-type classical swine fever virus strain JL23 (containing 10... 5 The MLD strain was challenged, and strain C (group 2) was challenged 14 days after the first immunization. After challenge, the patients were observed for 24 consecutive days, with rectal temperature measured and clinical manifestations observed daily, and clinical scores were calculated.
[0183] During the challenge period, experimental pigs that were near death or had died, as well as those that were still alive at the end of the experiment, were dissected to observe the pathological conditions of tissues and organs such as tonsils, larynx, lymph nodes, kidneys, spleen, and ileum.
[0184] The results are as follows Figure 6 As shown: In groups one, two, and three—the groups immunized with the classical swine fever virus E2 protein-labeled subunit vaccine, the groups immunized with the classical swine fever rabbit-attenuated live vaccine (passaged cell source), and the groups immunized with the classical swine fever E2 subunit vaccine—no pigs exhibited clinical symptoms of classical swine fever. However, all pigs in group four (the control group) developed the disease, primarily exhibiting persistent high fever, respiratory distress, conjunctivitis, loss of appetite, lethargy, and patchy hemorrhages on the lower extremities. All affected pigs died within 14–22 days. Furthermore, healthy controls (group five) that were neither immunized nor challenged showed no clinical symptoms. After immunization and challenge, no hemorrhages or other abnormalities were observed in the challenged pigs. In contrast, the control group (group four) showed hemorrhages or petechiae on the tonsils, larynx, lymph nodes, and kidneys; splenic marginal infarction; button-like ulcers on the ileocecal valve; and enlarged lymph nodes with a marbled appearance of red and white stripes on the cut surface.
[0185] Virus copy number of each organization as follows Figure 7 As shown, the viral load in each tissue of the first, second, and third groups was significantly lower than that in the fourth group (non-immunized challenge group), and was basically the same as that in the healthy control group (non-immunized and non-challenged).
[0186] The E2 antibody test results for each group are as follows: The E2 antibody test results for Group 1 and Group 3, i.e., the experimental groups immunized with the classical swine fever virus E2 protein-labeled subunit vaccine and TWJ-E2 respectively, are as follows: Figure 8 As shown in Figure A, E2 antibody levels generally showed a continuous upward trend after immunization, with a slight decline during days 1-12 after challenge. The E2 antibody detection results for the second group, the experimental group immunized with the classical swine fever rabbit-attenuated live vaccine, are as follows: Figure 8 As shown in B, the E2 antibody levels remained consistently high, slightly lower than in groups one and three after challenge; while the E2 antibody test results in group four (non-immunized and challenged) and group five (non-immunized and non-challenged healthy control group) after challenge were as follows: Figure 8 As shown in C, it remains at a low level.
[0187] The above results demonstrate that the classical swine fever virus E2 protein-labeled subunit vaccine, classical swine fever rabbit-attenuated live vaccine strain C, and classical swine fever E2 subunit vaccine of the present invention provide comparable protection for pigs. Mutation of the E2 protein does not substantially alter its overall immunogenicity.
[0188] Example 4: Application of monoclonal antibody DIVA55 in immunization with classical swine fever virus E2 protein-labeled subunit vaccine and serological identification of wild-type strain infection.
[0189] This embodiment utilizes the monoclonal antibody DIVA55 to establish a blocking ELISA method for distinguishing between classical swine fever virus E2 protein-labeled subunit vaccine immunization and wild-type strain infection. The specific operation method is as follows:
[0190] (1) The CSFV LPC strain E2 protein (i.e., the CSFV-E2 protein in Example 1) was coated in the microplate at a concentration of 0.1 μg / mL. After coating, the coating solution was discarded and the plate was sealed in a vacuum.
[0191] (2) Add 50 μL of sample diluent to each well of the coated plate, and then add 50 μL of classical swine fever virus infection sample (numbered 1-5, serum obtained by challenge with classical swine fever virus wild strain AH1), labeled vaccine immunization sample (numbered 6-10, serum obtained by immunization with classical swine fever virus E2 protein labeled subunit vaccine), classical swine fever antibody negative control (classical swine fever antibody negative serum), classical swine fever antibody positive control (serum obtained by challenge with classical swine fever wild strain GD23), and set up duplicate wells for negative control and positive control. Incubate at 37ºC for 1 h.
[0192] The preparation methods of the serum described in positive samples 1-5 and the negative and positive control sera for classical swine fever antibodies in positive samples 6-10 are described in the following literature: Gong W, Li J, Wang Z, et al. Commercial E2 subunit vaccine provides full protection to pigs against lethal challenge with 4 strains of classical swine fever virus genotype 2. Vet Microbiol. 2019;237:108403.
[0193] (3) After discarding the liquid in each well, wash the wells of the plate with 300 μL of washing solution 5 times. After the last wash, pat the washing solution in the wells dry.
[0194] (4) Add 100 μL of HRP-DIVA55 conjugate antibody diluted 1:5000 to each well of the plate and incubate at 37°C for 1 h.
[0195] (5) Repeat step (3).
[0196] (6) Add 50 μL of TMB colorimetric solution to each well and incubate at room temperature in the dark for 10 min.
[0197] (7) Add 50 μL of stop solution to each well to terminate the reaction, and measure the OD using an enzyme-linked immunosorbent assay (ELISA) reader. 450 Value, calculate the blocking rate, the calculation formula is (negative serum OD) 450-Sample OD 450 ) / Negative serum OD 450 ×100%.
[0198] The results are shown in Table 2: the blocking rate was 95.12% for serum infected with wild-type virus and 3.25% for serum immunized with vaccine. This indicates that the blocking ELISA method based on monoclonal antibody DIVA55 can clearly distinguish between swine fever E2-labeled vaccine immunization and wild-type virus infection. Monoclonal antibody DIVA55 can be used for the development and preparation of blocking ELISA kits for serological differential diagnosis of swine fever immunization and infection.
[0199] Table 2. Experimental results for differentiating between classical swine fever virus E2 protein-labeled vaccine strains and wild-type strains.
[0200]
[0201] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. An antibody that binds to the E2 protein of classical swine fever virus, characterized in that: The antibody is a monoclonal antibody or its antigen-binding fragment, which includes a heavy chain variable region and a light chain variable region. The amino acid sequences of LCDR1, LCDR2, and LCDR3 in the light chain variable region of the antibody are shown as SEQ ID No:4, numbers 24 to 34, 50 to 56, and 89 to 97, respectively, and LCDR1, LCDR2, and LCDR3 are complementarity-determining regions. The amino acid sequences of HCDR1, HCDR2, and HCDR3 in the heavy chain variable region of the antibody are shown as SEQ ID No:5, numbers 31 to 35, 50 to 66, and 99 to 110, respectively, and HCDR1, HCDR2, and HCDR3 are complementarity-determining regions.
2. The antibody binding to the E2 protein of classical swine fever virus according to claim 1, characterized in that: The amino acid sequence of the light chain variable region of the antibody is SEQ ID No:4; and / or the amino acid sequence of the heavy chain variable region of the antibody is SEQ ID No:
5.
3. A biomaterial, characterized in that, The biomaterial is any one of the following: A1) A nucleic acid molecule that encodes the heavy chain variable region and the light chain variable region of the monoclonal antibody or its antigen-binding fragment as described in claim 1 or 2; A2) An expression cassette containing the nucleic acid molecule described in A1); A3) A recombinant vector containing the nucleic acid molecules described in A1); A4) Recombinant microorganisms containing the nucleic acid molecules described in A1); A5) Recombinant host cells containing the nucleic acid molecules described in A1).
4. The biomaterial according to claim 3, characterized in that: In the nucleic acid molecule described in (A1), the nucleotide sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region encoding the antibody are shown in positions 70 to 102, 148 to 168 and 265 to 291 of SEQ ID No:9, respectively. and / or In the nucleic acid molecule described in (A1), the nucleotide sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region encoding the antibody are shown in SEQ ID No:10, 91 to 105, 148 to 198 and 295 to 330 respectively.
5. A kit for serological identification of classical swine fever E2 protein-labeled subunit vaccine immunization or wild-type strain infection, characterized in that, The kit includes the monoclonal antibody or its antigen-binding fragment as described in claim 1 or 2.
6. The reagent kit according to claim 5, characterized in that, This kit is a blocking ELISA kit, and the detection method when using the kit is serological detection.
7. An antibody-drug conjugate, comprising an antibody portion and a conjugation portion, characterized in that, The antibody portion is the monoclonal antibody or its antigen-binding fragment as described in claim 1 or 2, and the conjugated portion is a detectable label.
8. The use of the antibody according to claim 1 or 2 that binds to the E2 protein of classical swine fever virus for non-disease diagnostic and therapeutic purposes in any of the following: (B1) Detection or auxiliary detection of whether the sample to be tested contains the E2 protein of classical swine fever virus; (B2) Prepare products for detecting or assisting in the detection of whether the sample to be tested contains classical swine fever virus E2; (B3) Prepare products for serological identification of swine fever E2-marked subunit vaccine immunization and wild-type virus infection; (B4) Prepare products to identify and differentiate diseases caused by immunization with classical swine fever E2-marked vaccine strains and infection with wild-type strains; (B5) Detection or auxiliary detection of the content of classical swine fever virus E2 protein in the sample to be tested; (B6) Detection or auxiliary detection of the content of classical swine fever virus E2 protein antibody in the sample to be tested; (B7) Prepare products for detecting or assisting in the detection of the content of classical swine fever virus E2 protein in the sample to be tested; (B8) Prepare products for detecting or assisting in the detection of the content of swine fever virus E2 protein antibodies in the sample to be tested.
9. The method for preparing the antibody binding to the E2 protein of classical swine fever virus as described in claim 1 or 2, characterized in that, The preparation method includes expressing the monoclonal antibody or its antigen-binding fragment as described in claim 1 or 2 in a host cell, and recovering or separating the monoclonal antibody or its antigen-binding fragment.
10. A method for detecting wild-type classical swine fever virus (CSFV) strains or the E2 protein of CSFV strains for non-disease diagnosis and treatment purposes, characterized in that, The method includes detecting the E2 protein of a pre-existing classical swine fever virus strain, a wild-type classical swine fever virus strain, or a wild-type classical swine fever virus strain using the monoclonal antibody or antigen-binding fragment thereof as described in claim 1 or 2, the kit as described in claim 5 or 6, or the antibody-drug conjugate as described in claim 7.
Citation Information
Patent Citations
Monoclonal antibody for distinguishing hog cholera lapinized virus vaccine strain and epidemic strain and application thereof
CN119350494A
Chog cholera virus broad-spectrum neutralizing monoclonal antibody and application thereof
CN120058918A