Protease-producing yarrowia lipolytica and application thereof

Abstract

The invention discloses a strain of yarrowia lipolytica for producing protease, which is preserved in the China General Microbiological Culture Collection Center (CGMCC), is classified and named as yarrowia lipolytica, has the preservation number of CGMCC NO.35648, and is preserved on August 18, 2025. According to the application of the yarrowia lipolytica in preparation of the polypeptide with DPP-IV inhibitory activity, when the yarrowia lipolytica is specifically applied, eels are fermented by utilizing the yarrowia lipolytica. According to the present invention, the dominant bacteria in the fish head of astrocandra glabra are subjected to enrichment culture, and the screening is performed to obtain the strain YM-5 having strong extracellular protease production ability, and the identification results show that the strain is the yarrowia lipolytica, and the strain has characteristics of acid and alkali resistance, nitrite resistance, low temperature resistance and the like. A polypeptide with DPP-IV (dipeptidyl peptidase-IV) inhibitory activity can be obtained by utilizing the strain to ferment the astrocandra glabra. The research of the invention not only improves the additional value of the eel head, but also has important meanings for the research of bioactive peptides and the treatment of type 2 diabetes mellitus.

Description

TECHNICAL FIELD

[0001] The present application relates to a protease-producing Yarrowia lipolytica and its application, and belongs to the technical field of strain fermentation. BACKGROUND

[0002] Eel meat is delicious, nutritious and has high economic value, and the scale of eel farming is expanding. Eel head is a by-product of eel processing, and has low economic value, and is often discarded or used to make feed, with low added value. How to comprehensively utilize eel head and improve its added value is one of the research hotspots.

[0003] Bioactive peptides are short protein fragments composed of amino acids, have various physiological functions, and have very good research and development prospects. A large number of bioactive peptides with various biological functions can be obtained by hydrolysis or fermentation of proteins through selection of appropriate proteases or protease-producing strains. Therefore, using strains to ferment low-value processing by-products (such as fish heads, fish bones and fish skins, etc.), exploring new types of small molecule active peptides and developing functional foods are effective strategies to improve the added value of low-value processing by-products and realize efficient development and utilization of biological resources.

[0004] DPP-IV, also known as CD26, is a zinc metalloprotease present on the cell membrane. In diabetic patients, due to insufficient or impaired insulin secretion, blood glucose levels are elevated; and DPP-IV can degrade GLP-1 and GIP, reducing the concentration of these two important blood glucose regulating peptides in the body, further exacerbating the increase in blood glucose. Therefore, inhibiting the activity of DPP-IV is a strategy for treating diabetes. DPP-IV inhibitors can inhibit the activity of DPP-IV, thereby prolonging the half-life of GLP-1 and GIP in the body, increasing the concentration of these two polypeptides, and then promoting the secretion of insulin and inhibiting the release of glucagon, thereby reducing blood glucose levels. Currently, a variety of DPP-IV inhibitors have been approved for the treatment of type 2 diabetes, such as sitagliptin, vildagliptin, etc. SUMMARY

[0005] In view of the above prior art, the present application screens a protease-producing Yarrowia lipolytica, and also provides its application in preparing a polypeptide with DPP-IV inhibitory activity.

[0006] The present application is realized by the following technical solutions: A protease-producing Yarrowia lipolytica is preserved in the China General Microbiological Culture Collection Center, and is classified and named as Yarrowia lipolytica, with a preservation number of CGMCC NO. 35648 and a preservation date of August 18, 2025. The address for preservation is No. 1, Xibei Xili, Chaoyang District, Beijing, China Institute of Microbiology, Chinese Academy of Sciences, and the postcode is 100101.

[0007] The Yarrowia lipolytica is applied to preparation of a protease.

[0008] Further, the protease has the activity of hydrolyzing proteins derived from eel heads to obtain polypeptides with DPP-IV inhibitory activity.

[0009] The Yarrowia lipolytica is applied to preparation of polypeptides with DPP-IV inhibitory activity and fermentation of eels.

[0010] Further, in specific application, the Yarrowia lipolytica is used to ferment eel heads to extract polypeptides with DPP-IV inhibitory activity.

[0011] A method for preparing bioactive peptides with DPP-IV inhibitory activity is as follows: the Yarrowia lipolytica is used to ferment eel heads to extract bioactive peptides with DPP-IV inhibitory activity.

[0012] Further, the specific method is as follows: the eel heads are mixed with water, homogenized, and autoclaved; the Yarrowia lipolytica is inoculated into the mixture to ferment and obtain a fermentation liquor; the fermentation liquor is mixed with hydrochloric acid, homogenized, filtered, centrifuged, and supernatant is obtained; the supernatant is mixed with an ethanol solution, left to stand, centrifuged, and the supernatant is rotary-evaporated to a solid state, dissolved in an appropriate amount of water, filtered, and freeze-dried to obtain the bioactive peptides with DPP-IV inhibitory activity.

[0013] Further, the eel is of the species Conger myriaster.

[0014] The present application enriches and cultures dominant bacteria in eel heads of Conger myriaster, and a strain YM-5 with strong extracellular protease production capacity is screened and obtained, which is identified as Yarrowia lipolytica and preserved. The strain has the characteristics of acid and alkali resistance, nitrite resistance, and low-temperature resistance. The DPP-IV inhibition rate of polypeptides extracted by fermentation of Conger myriaster using the strain can reach 48.55%. The research of the present application not only improves the added value of eel heads, but also has important significance for the research of bioactive peptides and the treatment of type 2 diabetes.

[0015] Various terms and phrases used in the present application have the general meanings known to those skilled in the art. BRIEF DESCRIPTION OF DRAWINGS

[0016] The protease-producing Yarrowia lipolytica of the present application is deposited in the China General Microbiological Culture Collection Center, and is classified as Yarrowia lipolytica, with the preservation number of CGMCC NO. 35648, the preservation date of August 18, 2025, and the preservation address of No. 3, Beichen West Road, Beijing Chaoyang District, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101.

[0017] Figure 1 Results of hemolysis experiment.

[0018] Figure 2 Results of coagulase activity experiment, in which A: 6 h after adding rabbit plasma; B: after the bottle was placed upside down.

[0019] Figure 3 Results of protease activity determination, in which the letter annotation method is used to represent the significance of difference.

[0020] Figure 4 Results of acid and alkali resistance determination.

[0021] Figure 5 Results of salt tolerance determination.

[0022] Figure 6 Results of determination of optimal growth temperature.

[0023] Figure 7 Schematic diagram of cell morphology, in which A: one of cell morphologies; B: another cell morphology.

[0024] Figure 8 Schematic diagram of colony morphology. DETAILED DESCRIPTION

[0025] The present application will be further described below in conjunction with examples. However, the scope of the present application is not limited to the following examples. Those skilled in the art can understand that various changes and modifications can be made to the present application without departing from the spirit and scope of the present application.

[0026] The instruments, reagents, and materials involved in the following examples are all conventional instruments, reagents, and materials available in the prior art, and can be obtained through regular commercial channels, unless otherwise specified. The experimental methods and detection methods involved in the following examples are all conventional experimental methods and detection methods available in the prior art, unless otherwise specified.

[0027] The star conger fish heads used in the present application are purchased from Shandong Rongxin Aquatic Food Group Co., Ltd.

[0028] Experiment 1: Screening of protease-producing strains This experiment enriched bacteria in the head of Star Conger eel in order to screen for strains with strong extracellular protease production capabilities. The specific process is as follows.

[0029] (a) Initial screening of protease-producing strains (1) Weigh 25 g of star conger eel head, add 225 ml of physiological saline, and homogenize using a sterile homogenizer to obtain a homogenate; place the homogenate in a water bath at 37℃ (for screening bacteria) or 30℃ (for screening fungi) and incubate for 1 h; take 1 ml of the homogenate and dilute it to 1×10 using a serial dilution method. -2 ~10 -6 Concentration, take 1×10 -3 Up to 1×10 -6 100 μl of the dilution solution was spread onto MRS agar, YPD agar, LB agar, and YM agar plates, respectively. The plates were spread three times and incubated at 37°C (bacteria) and 30°C (fungi), respectively. After obtaining single colonies on the plates, pure strains were isolated by streaking multiple times and numbered.

[0030] (2) Each single strain was inoculated onto its corresponding skim milk plate using an inoculation loop (skim milk added at 6% by volume). The plates were then incubated at 37°C (bacteria) or 30°C (fungi) in an incubator. After 24 h, the diameters of the protein hydrolysis zone d and colony D were measured, and the ratios were calculated. The isolated strains were statistically analyzed, as shown in Table 1. Larger single colonies were selected and stored in glycerol tubes.

[0031]

[0032] (ii) Secondary screening of protease-producing strains (1) Hemolytic activity tests were performed on the strains (11 strains with a diameter ratio greater than 1.5 obtained from the initial screening, numbered HA, ZH, BLS, ML, NY0-1, NY0-4, NM7-1, NM7-5, NM7-6, NM7-7, and YM-5) on Columbia blood agar plates supplemented with sheep blood. Each group of strains was cultured at 30℃ or 37℃ for 24 h to observe whether the strains produced α-hemolysis; then, they were placed at 4℃ for 12 h (because β-toxin does not lyse cells at 30℃ and 37℃) to observe whether the strains produced β-hemolysis. The results of the hemolytic activity tests are as follows: Figure 1 As shown, three strains exhibited hemolysis (BLS, ML, and NM7-6). Further experiments were conducted on the eight non-hemolytic strains (HA, ZH, NY0-1, NY0-4, NM7-1, NM7-5, NM7-7, and YM-5).

[0033] (2) Drug resistance genes present in bacteria can be transmitted to enteric pathogenic bacteria (such as E. coli, Salmonella, etc.) through plasmids, transposons or bacteriophages during fermentation. If consumed by humans, the intestinal flora can form a "drug-resistant bacterial reservoir", increasing the risk of clinical antibiotic treatment failure. Therefore, it is necessary to conduct drug sensitivity tests (disk diffusion method and micro-broth method) on non-hemolytic strains to determine whether they have antibiotic resistance: apply the CNS guidelines of the Clinical and Laboratory Standards Institute (http: / / www.clsi.org / ) and the European Committee on Antimicrobial Susceptibility Testing (http: / / www.example.com) www.eucast.org. Staphylococcus aureus ATCC25923 is a commonly used drug sensitivity control strain in drug sensitivity tests, which is used as a control strain for drug sensitivity tests in this experiment. The results of the drug resistance test are shown in Table 2, where R indicates resistance, S indicates sensitivity, and I indicates intermediate sensitivity. As can be seen in the bacterial class, NYO-1, NYO-4, NM7-1 and ZH are resistant to 3 or more antibiotics, and only NM7-7 is sensitive to 13 antibiotics. YM-5 shows resistance to 13 antibiotics, but YM-5 belongs to the yeast class, and the nuclear membrane and chromosomal structure of eukaryotes naturally block gene transfer, so in the EFSA (European Union) and FDA fermentation strain safety guidelines, yeast is generally not required to screen for bacterial drug resistance genes; Moreover, these antibiotics are all designed for bacterial targets (such as cell walls and ribosomes), which are fundamentally different or do not exist in eukaryotic cells, and yeast drug resistance genes will not be transferred to other strains by gene level.

[0034]

[0035] (3) Coagulase activity test: each strain (7 strains except YM-5, coagulase activity test is only for Staphylococcus) was cultured overnight for 16 h, then added to a test tube containing rabbit plasma, observed every half hour for a total of 6 h; After 6 h, the tube was placed horizontally and the liquid also remained horizontal, the liquid in the tube did not coagulate, and the results of the coagulase activity test are shown in Table 3. Figure 2 Figure 2 G bottle in B is a blank culture medium without bacterial liquid, as a control group.

[0036] (4) Determination of protease activity: the strains were activated in their respective culture media, and after overnight culture (16 h), the OD 600 of the bacterial liquid was adjusted to 1, inoculated into a re-screening medium (10 g / L of proteose peptone, 50 g / L of sodium chloride, 70 g / L of glucose, 1000 ml of deionized water, pH 5.5), and fermented at 30°C (fungi) or 37°C (bacteria) for 48 h. The protease activity of each strain was determined by the Folin phenol method, and the results are shown in Table 4. Figure 3 ​As shown, the protease activity of strain YM-5 was the highest, reaching 22.57 U / ml, strain HA was 21.44 U / ml, strain ZH was 20.85 U / ml, and strain NYO-4 was 5.49 U / ml. YM-5 was significantly different from other strains, p<0.05, which indicated that strain YM-5 had strong protease production capacity and high activity of the produced protease, and had high application value.

[0037] The ITS identification of strain YM-5 was carried out, and the results were as follows: YM-5-ITS1-TSS20250110-020-02481-BSND_C07 (5'-3' direction) (as shown in SEQ ID NO. 1): TTTTATCATTTCTGTGGTTTCTATTCTATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTAAACTCTCCAATATTACCTCATTTCACCTCCTTCATCCGAAAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAGATGGCCATTCT.

[0038] YM-5-ITS4_TSS20250110-020-02481-BSND_B08 (5'-3' direction) (as shown in SEQ ID NO. 2): TATCGGGTATCTCGGTGAGGAGGTGAAATGACGTAATAATTGAGAGTTTAAAAAATCCATTTCAGAAAGCAATGGGATCCCCGAGGGAACCCGCTCCTCCCTCCGGGCGGTACGGAATGGCATACCGCGCAATGGGCGTTCAAAGATTGATGATTCACATCTGCAAGTCACAAAAAATATCGCGGTTCGCTGCGTTCTTCATCGATGGGAGAGCCAAGAAATCCGTTGGTGATAGTTATAATTGAAATAAAATGACGCTGGAATAAAATAAAAATCCACAGAAATAAATAAAATCAATAATGATCCTTCCGCAGGTCAACTACGGAAGGGGGACATTATTGATTTTATCTATTTCTGGGGATTTCTATTCCAATACAGCGGCATTTTATTTCAATTATTACTATTCACAACGGACTCCTTGGGTCCACATGGACGAAAAAGGAAGGAACCGGAAATCTTTTTGGGGTTTGGAAATGGAAAAACCTCAAACTTTGAAAGCCACA.

[0039] The strain YM-5 is identified as Yarrowia lipolytica. It is preserved in the China General Microbiological Culture Collection Center, and is classified and named as Yarrowia lipolytica Yarrowia lipolytica , with the preservation number of CGMCC NO.35648, the preservation date of August 18, 2025, and the preservation address of No. 1 Yard, West Beichen Road, Chaoyang District, Beijing, China Institute of Microbiology, Chinese Academy of Sciences, postcode: 100101.

[0040] Experiment 2: Study on the physicochemical properties of Yarrowia lipolytica The acid and alkali resistance, salt tolerance, and optimal growth temperature of the strain YM-5 were studied. The initial condition was YM medium, the culture temperature was 30°C, the inoculum was 2% (volume percentage), and the culture time was 24 h.

[0041] (1) Fresh bacterial liquid obtained by overnight culture (about 16 h) was inoculated into culture medium with pH values of 2, 3, 4, 5, 6, 7, 8, 9, and 10, respectively, and cultured at 30°C for 24 h. The absorbance (A) of the bacterial liquid at 590 nm was measured using a UV spectrophotometer, with 0 h of culture as the blank control. The results are as follows Figure 4As shown in Figure 1, the optimal pH of Yarrowia lipolytica is between 4.5 and 6.0. Meat fermentation at a lower pH can delay the growth of spoilage bacteria, and is more conducive to the stability of the quality of the final product.

[0042] (2) Fresh bacterial liquid obtained by overnight culture (about 16 h) was inoculated in culture medium with salt addition (sodium chloride, mass / volume ratio, g / mL) of 0%, 2%, 4%, 6%, 8%, 10%, 12%, and 14%, respectively, and cultured at 30°C for 24 h. The absorbance (A) of the bacterial liquid at 590 nm was measured by using an ultraviolet spectrophotometer, with 0 h of culture as the blank control. The results are shown in Figure 2. Figure 5 As shown in Figure 2, it can be seen that the strain YM-5 can grow at a salt addition of 0-12%, showing a trend of first increasing and then decreasing, and cannot grow when the salt addition exceeds 12%, indicating that it has a certain salt tolerance. The growth is best at a salt concentration of 2%, indicating that a low salt concentration can promote the growth of YM-5. Subsequently, 150 mg / kg of nitrite was added to the culture medium with 3% salt, and the measured absorbance was 6.72, indicating that the presence of nitrite-resistant has little effect on the growth of the yeast.

[0043] (3) Fresh bacterial liquid obtained by overnight culture (about 16 h) was inoculated in culture medium, and the temperature was controlled at 10°C, 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, and 45°C, respectively, and cultured for 24 h. The absorbance (A) of the bacterial liquid at 590 nm was measured by using an ultraviolet spectrophotometer, with 0 h of culture as the blank control. The results are shown in Figure 3. Figure 6 As shown in Figure 3, it can be seen that the strain YM-5 can grow only at a temperature of 10-40°C, showing a trend of first increasing and then decreasing, and cannot grow when the temperature exceeds 40°C, and can grow slowly at low temperature, with an optimal temperature of 30°C.

[0044] (4) Cell morphology: The cell morphology was observed under an electron microscope, as shown in Figure 4. Figure 7 As shown in Figure 4, the epidermis is wrinkled, the cells are concave inward to form cavities, and the cells are clustered.

[0045] (5) Colony morphology: The colony morphology was observed on a plate, as shown in Figure 5. Figure 8 As shown in Figure 5, it presents a milky white protrusion with a round surface that is not smooth.

[0046] Experiment 3 Fermentation of Star Conger Fish Head The strain YM-5 was used to ferment the star conger fish head, and the method was as follows: The star conger fish head and water were mixed in a ratio of 3:7 (weight ratio), and a tissue homogenizer was used to make a homogenate, which was placed in a conical flask with a liquid volume of not more than 20%, and autoclaved. The bacterial liquid of the strain YM-5 (bacterial liquid concentration OD590=0.8) was inoculated at an inoculation amount of 2%, and fermented at 30°C in a water bath for 24 h to obtain a fermentation liquid.

[0047] The fermentation broth was added to a homogenization bag containing 4 volumes of 0.01 M hydrochloric acid, homogenized for 20 min at 8 s / time using a beating homogenizer, and filtered with a 200 mesh screen to obtain a filtrate; the filtrate was centrifuged at 8000 g for 20 min at 4°C to obtain a supernatant; 3 volumes of 95% ethanol solution were added to the supernatant, which was placed at 4°C for 30 min, and then centrifuged at 10000 g for 20 min at 4°C; the supernatant was concentrated by rotary evaporation until no liquid was left, dissolved with an appropriate amount of ultrapure water, filtered through a 0.45 μm nylon membrane, and freeze-dried to obtain a polypeptide extract, which was placed in a -20°C refrigerator for standby.

[0048] The polypeptide extract was dissolved in an appropriate amount of ultrapure water to obtain a polypeptide solution. The following procedures were performed according to the reagent manufacturer's instructions [DPP4 / DPP(IV) Inhibitor Screening Assay Kit, item number BGT-KAT-100]. In a 96-well plate, 30 μl of test buffer (20 mM Tris-HCl containing 100 mM NaCl and 1 mM EDTA) and 10 μl of DPP-IV enzyme preparation (the blank group was replaced with test buffer) were added to each well, followed by the addition of diluted polypeptide solution, mixing, and finally the addition of 50 μl of H-Gly-Pro coupled aminomethyl coumarin (AMC) to all wells, which were incubated at 37°C for 30 min. The free AMC group was detected by a fluorescence enzyme marker at an excitation wavelength of 355 nm and an emission wavelength of 455 nm, with sitagliptin (100 μM) as a positive control. The DPP-IV inhibition rate of the polypeptide was calculated using the following formula: .

[0049] wherein I (%) is the DPP-IV inhibition rate of the polypeptide or drug, F i is the fluorescence value of 100% initial activity, i.e., no addition of any inhibitor, t is the fluorescence value of the inhibitor, i.e., the addition of polypeptide or drug. The IC 50 value of the polypeptide sample was determined from the graph of DPP-IV inhibition percentage (%) versus log10(sample concentration).

[0050] Results: The DPP-IV inhibition rate of the polypeptide extract at 2 mg / ml was 48.55%. Sitagliptin at a final concentration of 100 μM inhibited all enzyme activity.

[0051] The above examples are provided to those skilled in the art to fully disclose and describe how to implement and use the claimed embodiments, rather than to limit the scope of the disclosure herein. Modifications obvious to those skilled in the art will be within the scope of the appended claims.

Claims

1. A protease-producing strain of the lipolytic yeast Yarrowia lipolytica, characterized in that: Yarrowia lipolytica, and the preservation number is CGMCC NO. 35648, and the preservation date is August 18, 2025.

2. Use of the Yarrowia lipolytica in claim 1 in the preparation of a protease.

3. Use according to claim 2, characterized in that, The protease has the activity of hydrolyzing proteins derived from eel heads to obtain polypeptides with DPP-IV inhibitory activity.

4. Use of the Yarrowia lipolytica in claim 1 in the preparation of polypeptides with DPP-IV inhibitory activity.

5. Use according to claim 4, characterized in that: In a specific application, the Yarrowia lipolytica is used to ferment eel heads to obtain polypeptides with DPP-IV inhibitory activity.

6. A method of preparing a biologically active peptide having DPP-IV inhibitory activity, characterized by: The Yarrowia lipolytica in claim 1 is used to ferment eel heads to obtain bioactive peptides with DPP-IV inhibitory activity.

7. The method of producing a bioactive peptide having DPP-IV inhibitory activity according to claim 6, wherein: The eel heads are mixed with water, homogenized, and autoclaved; the Yarrowia lipolytica is inoculated into the mixture to ferment, obtaining a fermentation liquor; the fermentation liquor is mixed with hydrochloric acid, homogenized, filtered, and centrifuged to obtain a supernatant; the supernatant is mixed with an ethanol solution, centrifuged, and the supernatant is concentrated to a solid state by rotary evaporation; the solid is dissolved in an appropriate amount of water, filtered, and freeze-dried to obtain bioactive peptides with DPP-IV inhibitory activity.

8. The method of producing a bioactive peptide having DPP-IV inhibitory activity according to claim 6, wherein: The eel is a star conger eel.

Images