D-psicose-3-epimerase mutant, host cell and application of D-psicose-3-epimerase mutant in synthesis of psicose

Abstract

The invention discloses a D-psicose-3-epimerase mutant, a host cell and application of the D-psicose-3-epimerase mutant in synthesis of psicose, and belongs to the technical field of genetic engineering. According to the invention, a series of D-psicose-3-epimerase mutants are obtained by simultaneously mutating any one or more of a plurality of sites such as a 47 site, a 72 site, a 114 site and a 221 site of wild type D-psicose-3-epimerase derived from ruminococcus sp. CAG55, and the catalytic activity and the stability of the D-psicose-3-epimerase mutants are obviously improved. Wherein the catalytic activity of mutants obtained by simultaneous mutation of the 47 site, the 72 site, the 114 site and the 221 site is the highest. The D-psicose-3-epimerase mutant provided by the invention has an important application value in the field of production of D-psicose.

Description

[0001] This application is a divisional application of the patent application filed on August 5, 2025, with application number 2025110860765, entitled "D-allulose-3-epimerase mutant, host cell and its application in the synthesis of allulose". Technical Field

[0002] This invention belongs to the field of genetic engineering technology, specifically involving D-allulose-3-epimerase mutants, host cells, and their application in the synthesis of allulose. Background Technology

[0003] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0004] D-Allulose, a low-calorie (approximately 0.2 kcal / g, compared to 4 kcal / g for sucrose) and high-sweetness (up to 70% of sucrose), is a rare functional ketose with significant applications in the food, health supplement, and pharmaceutical industries. Its unique physiological activities, including blood glucose and lipid regulation, antioxidant effects, and neuroprotective properties, make it an ideal choice for diabetic dietary supplements and healthy sweeteners.

[0005] Currently, industrial production mainly relies on D-allulose-3-epimerase (DAEase) to catalyze the conversion of D-fructose. However, existing natural DAEases suffer from several drawbacks: low catalytic efficiency and insufficient activity for converting the substrate D-fructose; and poor stability, making them unsuitable for the high-temperature, high-sugar, and high-ionic-strength production environments encountered in large-scale industrial production. Therefore, developing DAEase mutants with both high activity and high stability is an urgent need for industry. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a series of D-allulose-3-epimerase mutants, which solve the problems of limited catalytic activity, low conversion efficiency, poor stability, and unfavorable conditions for industrial production of existing D-allulose-3-epimerases.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, this invention provides a D-allulose-3-epimerase mutant, the NCBI accession number for D-allulose-3-epimerase being CDC15199.1, with the mutation site being: F47A; or N72E; or N114G; or C221S; or F47A and N72E; or F47A, N72E and N114G; or F47A, N72E, N114G and C221S.

[0008] In a second aspect of the present application, a nucleic acid molecule having a nucleotide sequence encoding the above-mentioned D-psicose-3-epimerase mutant is provided.

[0009] In a third aspect of the present application, an expression vector having the above-mentioned nucleic acid molecule is provided.

[0010] In some embodiments of the present application, the expression vector comprises a pET-28a plasmid or a PWB980 plasmid.

[0011] In a fourth aspect of the present application, a host cell having any one of the following is provided: (a1), the above-mentioned nucleic acid molecule; (a2), the above-mentioned expression vector; The host cell is a bacterium.

[0012] In some embodiments of the present application, the host cell is Escherichia coli or Bacillus subtilis.

[0013] In a fifth aspect of the present application, a method for preparing a D-psicose-3-epimerase mutant is provided, which is prepared based on any one of the following: (b1), the above-mentioned nucleic acid molecule; (b2), the above-mentioned expression vector; (b3), the above-mentioned host cell.

[0014] In a sixth aspect of the present application, the above-mentioned D-psicose-3-epimerase mutant is provided for use in the preparation of D-psicose.

[0015] In a seventh aspect of the present application, a method for preparing D-psicose is provided, comprising: preparing D-psicose based on the above-mentioned host cell; The reaction system for the preparation comprises: 450-650 g / L fructose, 1 mM Co 2+ , 5-25 g / L wet bacterial cells containing the host cell; The temperature for the preparation is 50-60℃; The time for the preparation is 4-6 hours.

[0016] It is noted that the term Wet Cell Mass refers to a collection of microbial cells containing moisture that is collected from a liquid culture medium (e.g., fermentation broth) by centrifugation, filtration, or other separation methods.

[0017] In some embodiments of the application, the concentration of fructose is 450 g / L, 460 g / L, 470 g / L, 480 g / L, 490 g / L, 500 g / L, 510 g / L, 520 g / L, 530 g / L, 540 g / L, 550 g / L, 560 g / L, 570 g / L, 580 g / L, 590 g / L, 600 g / L, 610 g / L, 620 g / L, 630 g / L, 640 g / L, or 650 g / L.

[0018] In some embodiments of the application, the concentration of wet cell mass is 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L, 11 g / L, 12 g / L, 13 g / L, 14 g / L, 15 g / L, 16 g / L, 17 g / L, 18 g / L, 19 g / L, 20 g / L, 21 g / L, 22 g / L, 23 g / L, 24 g / L, or 25 g / L.

[0019] In some embodiments of the application, the prepared reaction system comprises: 500 g / L fructose, 1 mM Co 2+ , 15 g / L wet cell mass comprising the host cell.

[0020] In some embodiments of the application, the prepared reaction system comprises: 600 g / L fructose, 1 mM Co 2+ , 15 g / L wet cell mass comprising the host cell.

[0021] In some embodiments of the application, the temperature of the preparation is 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, or 60°C.

[0022] In some embodiments of the application, the time of the preparation is 4 hours, 4.5 hours, 5 hours, 5.5 hours, or 6 hours.

[0023] In some embodiments of the application, the temperature of the preparation is 55°C and the time of the preparation is 6 hours.

[0024] In an eighth aspect of the present application, a method for preparing D-psicose is provided, comprising: preparing D-psicose based on the above-mentioned D-psicose-3-epimerase mutant; The reaction system for the preparation comprises: 450-650 g / L fructose, 1 mM Co 2+ , 5-25 g / L of the D-psicose-3-epimerase mutant; The temperature for the preparation is 50-60℃; The time for the preparation is 4-6 hours.

[0025] In some embodiments of the present application, the concentration of the fructose is 450 g / L, 460 g / L, 470 g / L, 480 g / L, 490 g / L, 500 g / L, 510 g / L, 520 g / L, 530 g / L, 540 g / L, 550 g / L, 560 g / L, 570 g / L, 580 g / L, 590 g / L, 600 g / L, 610 g / L, 620 g / L, 630 g / L, 640 g / L, or 650 g / L.

[0026] In some embodiments of the present application, the concentration of the D-psicose-3-epimerase mutant is 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L, 11 g / L, 12 g / L, 13 g / L, 14 g / L, 15 g / L, 16 g / L, 17 g / L, 18 g / L, 19 g / L, 20 g / L, 21 g / L, 22 g / L, 23 g / L, 24 g / L, or 25 g / L.

[0027] In some embodiments of the present application, the reaction system for the preparation comprises: 500 g / L fructose, 1 mM Co 2+ , 20 g / L of the D-psicose-3-epimerase mutant.

[0028] In some embodiments of the present application, the temperature for the preparation is 50℃, 51℃, 52℃, 53℃, 54℃, 55℃, 56℃, 57℃, 58℃, 59℃, or 60℃.

[0029] In some embodiments of the present application, the time for the preparation is 4 hours, 4.5 hours, 5 hours, 5.5 hours, or 6 hours.

[0030] In some embodiments of the present application, the temperature for the preparation is 55℃ and the time is 4 hours.

[0031] In some specific embodiments of the present invention, the preparation temperature is 55°C and the time is 6 hours.

[0032] The beneficial effects of this invention are as follows: This invention utilizes the method of processing bacteria derived from rumenococcus CAG55 ( Ruminococcus sp. Simultaneous mutations at positions 47, 72, 114, and 221 of wild-type D-allulose-3-epimerase (CAG55) yielded a series of D-allulose-3-epimerase mutants, significantly improving their catalytic activity and stability. The mutants obtained by simultaneous mutations at positions 47, 72, 114, and 221 exhibited the highest catalytic activity. Testing revealed that when producing D-allulose from fructose, with *E. coli* as the host bacterium, the engineered *E. coli* strain catalyzed the production of D-allulose from 600 g / L fructose for 4 hours, achieving a conversion rate of 36.3%. With *Bacillus subtilis* as the host bacterium, the supernatant of *B. subtilis* fermentation broth expressing *B. subtilis* catalyzed the production of D-allulose from 500 g / L fructose for 5 hours, achieving a conversion rate of 35.5%. Intracellular expression of *B. subtilis* fermentation broth supernatant catalyzed the production of D-allulose from 500 g / L fructose for 4 hours, achieving a conversion rate of 35.8%. Furthermore, after immobilization, the enzyme retained its activity at 80% even after 30 repeated batches of use. Therefore, the D-allulose-3-epimerase mutant provided by this invention has significant application value in the field of D-allulose production. Attached Figure Description

[0033] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0034] Figure 1 In Embodiment 5 of the present invention E. coli Graph of the reaction process of fructose to D-allulose catalyzed by BL21(DE3) / / pET28a-RsDAE-F47A-N72E-N114G-C221S.

[0035] Figure 2 The secretory expression strain in Example 6 of this invention Bacillus subtilis Schematic diagram of the reaction process for the synthesis of D-allulose from fructose catalyzed by BS168 / PWB980-RsDAE-F47A-N72E-N114G-C221S.

[0036] Figure 3 The intracellular expression strain in Example 6 of this invention Bacillus subtilisBS168 / PWB980-RsDAE-F47A-N72E-N114G-C221S catalyzed the reaction progress of fructose to synthesize D-psicose. DETAILED DESCRIPTION

[0037] The present application discloses D-psicose-3-epimerase mutants, host cells and their applications in synthesizing D-psicose. Those skilled in the art can refer to the content herein and make appropriate improvements to the process parameters. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The methods and applications of the present application have been described by preferred embodiments, and relevant personnel can obviously make changes or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology. In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific embodiments.

[0038] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present application are ordinary market products, which can be purchased from the market.

[0039] The medium formula used in the following examples is as follows: LB medium: 10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of sodium chloride, water as solvent, pH 7.4.

[0040] LB plate: 10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of sodium chloride, 18 g / L of agar, water as solvent, pH 7.4.

[0041] The product D-psicose concentration was detected by high performance liquid chromatography (HPLC), and the analysis method was as follows: calcium cation chromatographic column; mobile phase was water, sample size was 10 μL, differential detector, detection time was 25 min, flow rate was 0.6 mL / min; column temperature was 80℃.

[0042] Sample treatment: 100 μL of the sample at the end of the reaction was diluted 10 times with water solution, filtered through a 0.22 μm filter membrane, and detected by HPLC.

[0043] Example 1 1. Construction of expression vector and engineering bacteria: Through library mining, a D-psicose-3-epimerase mutant was screened from Ruminococcus sp. CAG55 (ATCC BAA-1177) Ruminococcus spD-allulose-3-epimerase of C. acnes (NCBI Accession No. CDC15199.1) and Nanjing Kingsriver Biotechnology Co., Ltd. was commissioned to perform whole gene synthesis, and the nucleotide sequence is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2.

[0044] The nucleotide sequence of D-allulose-3-epimerase (SEQ ID NO. 1): ATGAATAAAATAGGGGTACACTTTGGATATTTCAACCGTGACTGGAATACGGACTTCATCAAGCGCATTGAGCAAGTGAAAAAGATTGGTCTGGATATTTTGGAAGTCGCACCGGCACCGCTCTTAGCCTTGACCAAATTCCAACGCGACGAGATCGCCGCTGCGGCGAAAGCTAATGATATCGAGCTGACTTTCAGCGTTGGCTTGTCTGCGAACCAGGATCTGGCGAGCGAGGACGAAGAGATCCGTAAGAACGGCATTAAGTTTACCACCGATACCTTTCAAATTATGAGCGAGATGGGTGGTAAGACGTACAGTGGTGTTGATATCGCGGCTTGGAACAAAACCTTCATGGAAGGGATCACTGACAAAAGCGCTACCTGGGAACGTAGCATTAGCGCTGTGAAGGAGATTATGAAAGTGGCCGAAGACAAAGGTATCACCTTCGCCGTTGAAGTTGTCAACCGCTACGAATCGTCCTTGGTTAACACCGCGGAAGAAGCAGTGAAGTATGTGGACGAAGTGGGCAGCCCGAACTGCAAGATCCTGCTTGACACGTATCACATGAATATTGAGGAGGATAGCTTTGCGGGTGCGATCAAGCTGGTAGGCAATCGGCTGGGTCATTTTCACGTGGGCGAGTCCAACCGCCGTCCACCGTGTGAAAACGGTAAAATGCCGTGGAACGAAATCACCAATGCACTGAAAGAAATCGATTACCAGGGCGCGATTGTTATGGAGCCGTTTATTAAGATGGGCGGTGAAGTTGGTCGTGACATCAAGGTGTGGCGTGACATCTCTGAAGGTGCGTCGGAGTCCGAGATGGAGCAGCTGCTGGCGGATGCAGCGATGATGCTGCGTAAAAAAATGCAGCGTTAA Amino acid sequence of D-allulose 3-epimerase (SEQ ID NO. 2): MNKIGVHFGYFNRDWNTDFIKRIEQVKKIGLDILEVAPAPLLALTKFQRDEIAAAAKANDIELTFSVGLSANQDLASEDEEIRKNGIKFTTDTFQIMSEMGGKTYSGVDIAAWNKTFMEGITDKSATWERSISAVKEIMKVAEDKGITFAVEVVNRYESSLVNTAEEAVKYVDEVGSPNCKILLDTYHMNIEEDSFAGAIKLVGNRLGHFHVGESNRRPPCENGKMPWNEITNALKEIDYQGAIVMEPFIKMGGEVGRDIKVWRDISEGASESEMEQLLADAAMMLRKKMQR 1. The primers F1, R1, F2 and R2 are designed according to the nucleotide sequence shown in SEQ ID NO. 1 and the pET-28a vector sequence.

[0045] F1: 5'-CTTTAAGAAGGAGATATACCATGAATAAAATAGGGGTACACTTTGG-3' (SEQ ID NO. 3) R1: 5'-TGGTGGTGGTGGTGCTCGAGTTAACGCTGCATTTTTTTACGC-3' (SEQ ID NO. 4) F2: 5'-CTCGAGCACCACCACCACC-3' (SEQ ID NO. 5) R2: 5'-GGTATATCTCCTTCTTAAAGTTAAACAAAAT-3' (SEQ ID NO. 6) 2. The pET-28a plasmid is used as an expression vector to construct Escherichia coli BL21(DE3) / / pET28a-RsDAE. E. coli BL21(DE3) / / pET28a-RsDAE 2.1 Construction of the expression plasmid: The D- Psicose-3-epimerase gene sequence with homologous arms is obtained by amplification with the primers F1 / R1 and F2 / R2 using the target gene as the template and high-fidelity Pfu DNA polymerase, and the linearized vector sequence is obtained by amplification using the pET-28a plasmid as the template and high-fidelity Pfu DNA polymerase, and the target gene is homologously recombined with the linearized vector using a homologous recombination enzyme to construct the expression plasmid pET28a-RSDAE.

[0046] 2.2 Construction of the recombinant Escherichia coli: The Escherichia coli BL21(DE3) stored at -80°C is inoculated into LB medium containing 50 mg / L kanamycin and cultured at 37°C for 12 hours. E. coliBL21(DE3) competent cells were incubated at 0°C on ice for 10 min, then 5 µL of the homologous recombinant product (expression plasmid pET28a-RSDAE) was added in a clean bench, incubated at 0°C on ice for 30 min, heat-shocked in a 42°C water bath for 90 s, incubated at 0°C on ice for 2 min, and then 600 µL of LB medium was added. The cells were cultured at 37°C and 200 rpm for 1 h. The culture was then spread on LB plates containing 50 μg / mL kanamycin and cultured at 37°C for 8–12 h. Clones were randomly selected, plasmids were extracted, and sequenced for identification. Recombinant *E. coli* containing the expression plasmid pET28a-RSDAE were screened for these cells. E. coli BL21(DE3) / / pET28a-RsDAE.

[0047] Example 2 The expression of D-allulose-3-epimerase was induced to obtain wet bacterial cells containing the D-allulose-3-epimerase gene: The recombinant Escherichia coli obtained in Example 1 were respectively... E. coli BL21(DE3) / / pET28a-RsDAE was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 200 rpm for 12 h. Then, it was inoculated at a 1% (v / v) inoculation rate into fresh LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 200 rpm until the bacterial OD reached the target cell count. 600 When the concentration reached 0.6-0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM. After induction culture at 25°C for 16 h, the mixture was centrifuged at 4°C and 8000 rpm for 20 min. The supernatant was discarded, and the precipitate was collected to obtain recombinant Escherichia coli containing D-allulose-3-epimerase. E. coli Wet cells of BL21(DE3) / / pET28a-RsDAE.

[0048] Example 3 Establishment of a mutant library of D-allulose-3-epimerase gene: The recombinant Escherichia coli expressing D-allulose-3-epimerase constructed in Example 2 E. coli BL21(DE3) / / pET28a-RsDAE is the originating strain.

[0049] According to the crystal structure of D-psicose-3-epimerase obtained by homology modeling, the stability improvement sites T17G, P38A, F47A, V67G, S70P, N72E, T90L, Q95D, D109L, N114G, M118A, S160Y, C221S and M284A were selected for site-directed mutagenesis according to the calculation of protein folding free energy.

[0050] The mutation PCR system (100 μL) was as follows: 2*Phanta Max buffer 25 μL, dNTPs 1 μL, mutation primers (Table 1) 1 μL each, template (original strain) 1 μL, Pfu DNA polymerase 0.5 μL, and ddH2O to 50 μL.

[0051] The PCR conditions were as follows: 95°C pre-denaturation for 3 min, 30 cycles of 95°C for 15 s, 60°C for 15 s, 72°C for 7 min 20 s, and finally 72°C for 10 min.

[0052] The PCR results were verified by DNA agarose gel electrophoresis: the PCR products were subjected to DpnI enzyme digestion of the template at 37°C for 1 hour, 200 rpm, inactivation at 65°C for 1 min, heat shock transformation, and E. coli E. coli The BL21(DE3) was activated and cultured at 37°C, 200 rpm for 1 hour, spread on LB plates containing 50 μg / mL kanamycin resistance, and incubated at 37°C overnight.

[0053] Table 1 Design of D-psicose-3-epimerase site-directed mutation primers

[0054] Through DNA sequencing, the DNA sequencing results of the mutants of T17G, P38A, F47A, V67G, S70P, N72E, T90L, Q95D, D109L, N114G, M118A, S160Y, C221S and M284A site-directed mutations were completely consistent with the expected designed mutations.

[0055] Example 4 Screening of D-psicose-3-epimerase gene mutation library: The single clone obtained in Example 3 was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, and cultured at 37°C, 200 rpm for 12 h, and then inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at a 1% (v / v) inoculation amount, and cultured at 37°C, 200 rpm until the bacterial OD 600 was 0.6-0.8, and isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM, and the culture was induced at 25°C for 16 h, and then centrifuged at 4°C, 8000 rpm for 20 min, and the supernatant was discarded, and the precipitate was collected, thereby obtaining wet bacteria containing the D-allulose-3-epimerase gene mutation library.

[0056] 1. Primary screening: The reaction solution (200 μL) was prepared: final concentration of 300 g / L substrate fructose, final concentration of 1 mM Co 2+ , and the catalyst was used in an amount of 5 g / L based on the total weight of the wet bacteria, and pure water was used as the reaction medium to form the reaction solution.

[0057] The reaction conditions were as follows: reaction at 55°C, 500 rpm for 1 h, and then 20 μL of the reaction sample was taken after the reaction was completed, diluted 20 times, filtered through a 0.22 μm filter membrane, and subjected to HPLC detection, and the detection results are shown in Table 2.

[0058] Table 2. Primary screening reaction results

[0059] After primary screening, the mutants F47A, N72E, N114G, and C221S catalyzed the preparation of D-allulose from fructose, and the obtained D-allulose concentration was higher than that of the parent, indicating that the catalytic activity of these four mutants was improved. The mutants F47A, N72E, N114G, and C221S were used for subsequent experiments.

[0060] 2. Secondary screening: The strains obtained by primary screening were subjected to secondary screening.

[0061] The mutants F47A+N72E, F47A+N72E+N114G, and F47A+N72E+N114G+C221S were constructed by the method of Example 3. DNA sequencing showed that the DNA sequencing results of these three mutants were completely consistent with the expected designed mutations.

[0062] The secondary screening reaction solution (10 mL) was prepared: final concentration of 300 g / L substrate fructose, final concentration of 1 mM Co 2+ , and the catalyst was used in an amount of 5 g / L based on the total weight of the wet bacteria, and pure water was used as the reaction medium to form the reaction solution.

[0063] Reaction conditions: 55°C, 500 rpm for 1 hour, 20 μL of the reaction sample was taken after the reaction, diluted 20 times, filtered through a 0.22 μm filter membrane, and subjected to HPLC detection. The detection results are shown in Table 3.

[0064] The detection results are shown in Table 3.

[0065] Table 3. Results of rescreening reactions

[0066] It was determined through rescreening that the catalytic activities of the seven mutants described in Table 3 were all significantly improved. Among them, the mutant F47A+N72E+N114G+C221S had the highest catalytic activity. Therefore, the mutant F47A+N72E+N114G+C221S was selected for the following experiments.

[0067] Example 5 Application of D-allulose-3-epimerase isomers in the synthesis of D-allulose: The recombinant D-allulose-3-epimerase mutant with the highest activity obtained in Example 4 E. coli BL21(DE3) / / pET28a-RsDAE-F47A-N72E-N114G-C221S was inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured at 37°C for 9 hours as a seed solution. The seed solution was inoculated into a 5 L fermenter containing 3 L of fermentation medium at a volume concentration of 3.5%. The prepared medium was added, the outlet was sealed with the inlet, and the inoculation port was opened. The prepared lactose inducer was placed in a sterilization pot at 115°C for 30 minutes. The sterilized fermenter was screwed onto the inoculation port and installed on the operation system. The condensate water and air were turned on (the inlet pipe was installed with a sterilization membrane), and the outlet was inserted below the liquid level of the conical flask. When the sterilization pot was reduced to 37°C, the culture seed solution was inoculated into the fermenter. The culture was incubated at 37°C and 500 rpm for about 3-4 hours, and the bacterial density OD 600 When the bacterial density reached 6-8, the temperature of the fermenter was reduced to 25°C, and lactose with a final concentration of 16 g / L was added as an inducer. Then the culture was incubated at 25°C and 500 rpm for 12 hours. The fermented broth was centrifuged at 8000 rpm for 10 minutes to obtain wet bacterial cells containing D-allulose-3-epimerase mutant E. coli BL21(DE3) / / pET28a-RsDAE-F47A-N72E-N114G-C221S.

[0068] The fermentation tank culture medium composition: tryptone 45 g, yeast extract 36 g, sodium chloride 30 g, potassium dihydrogen phosphate 4.08 g, glycerol (glycerin) 45 g, potassium phosphate dibasic trihydrate 6.84 g, ammonium sulfate 15 g, magnesium sulfate 1.125 g, antifoaming agent 4 g, add distilled water to constant volume to 3 L for dissolution.

[0069] The catalyst dosage is 15 g / L based on the total weight of the wet bacteria, the final concentration of the substrate fructose is 600 g / L, and the final concentration of Co 2+ Pure water is the reaction medium to form the reaction solution, and the total volume is 1 L. The reaction conditions are: 55℃, 500 rpm for 4 hours. After the reaction is completed, 20 μL of the sample at the end of the reaction is taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and subjected to HPLC detection. The reaction progress curve is shown in Figure 1 After the reaction is completed, the D-allulose concentration is 217.8 g / L, and the conversion rate is 36.3%.

[0070] Example 6 Construction of RsDAE-F47A-N72E-N114G-C221S Bacillus subtilis strain and its application in synthesis of D-allulose: The recombinant D-allulose-3-epimerase RsDAE-F47A-N72E-N114G-C221S with the highest activity obtained in Example 4 is subjected to Bacillus subtilis codon optimization and full gene synthesis, the nucleotide sequence is shown in SEQ ID NO. 35, and the amino acid sequence is shown in SEQ ID NO. 36. It is planned to construct RsDAE-F47A-N72E-N114G-C221S on the secretory expression plasmid PWB980 (XhoI-NheI), and at the same time construct a PWB980 recombinant plasmid for intracellular expression by knocking out the secretory signal peptide.

[0071] The nucleic acid sequence of the recombinant D-allulose-3-epimerase RsDAE-F47A-N72E-N114G-C221S after Bacillus subtilis codon optimization (SEQ ID NO. 35): ATGAACAAAATCGGCGTTCATTTTGGCTATTTTAACCGTGATTGGAACACCGATTTTATTAAGCGGATTGAGCAAGTGAAAAAGATCGGGCTGGATATTTTAGAAGTGGCTCCCGCGCCGCTGCTGGCCTTGACAAAAGCCCAAAGAGACGAAATTGCCGCCGCAGCGAAAGCGAATGATATCGAGCTTACCTTCTCTGTAGGGCTTAGTGCAGAACAGGATTTAGCTTCAGAAGATGAAGAAATCAGAAAGAACGGCATCAAGTTTACGACTGATACATTCCAAATCATGAGCGAGATGGGAGGTAAAACATACTCTGGTGTGGACATTGCTGCTTGGGGTAAAACGTTTATGGAAGGCATCACAGATAAAAGCGCGACATGGGAAAGATCGATTTCCGCCGTTAAAGAAATTATGAAAGTGGCAGAAGACAAAGGAATTACATTCGCAGTTGAAGTTGTTAACCGCTATGAAAGCTCACTCGTCAATACTGCTGAAGAAGCAGTAAAATACGTAGATGAGGTCGGATCACCAAACTGCAAAATTTTGCTTGATACGTATCATATGAATATAGAAGAGGACAGCTTTGCGGGAGCTATTAAGCTTGTCGGCAACAGGCTCGGCCACTTTCATGTCGGTGAATCAAATCGCCGGCCGCCTAGCGAAAATGGGAAAATGCCTTGGAATGAAATCACGAATGCCTTAAAAGAGATTGATTATCAAGGAGCCATTGTCATGGAGCCGTTTATCAAAATGGGCGGTGAAGTAGGACGTGACATAAAGGTGTGGCGCGATATTTCTGAGGGAGCGAGTGAGTCCGAAATGGAACAGTTACTAGCAGACGCAGCGATGATGCTGCGAAAAAAGATGCAGCGTTAA Nucleic acid sequence of the recombinant D- Psicose-3-epimerase RsDAE-F47A-N72E-N114G-C221S after codon optimization for Bacillus subtilis (SEQ ID NO. 36): MNKIGVHFGYFNRDWNTDFIKRIEQVKKIGLDILEVAPAPLLALTKAQRDEIAAAAKANDIELTFSVGLSAEQDLASEDEEIRKNGIKFTTDTFQIMSEMGGKTYSGVDIAAWGKTFMEGITDKSATWERSISAVKEIMKVAEDKGITFAVEVVNRYESSLVNTAEEAVKYVDEVGSPNCKILLDTYHMNIEEDSFAGAIKLVGNRLGHFHVGESNRRPPSENGKMPWNEITNALKEIDYQGAIVMEPFIKMGGEVGRDIKVWRDISEGASESEMEQLLADAAMMLRKKMQR The primers F3, R3, F4 and R4 were designed according to the nucleotide sequence shown in SEQ ID NO. 35 and the PWB980 vector sequence for the secretory expression of the PWB980 recombinant plasmid.

[0072] The primers F5, R5, F6 and R6 were designed according to the nucleotide sequence shown in SEQ ID NO. 35 and the PWB980 vector sequence for the intracellular expression of the PWB980 recombinant plasmid.

[0073] F3: 5'-ggcgcaactcaagctttgc ATGAACAAAATCGGCGTTCATTTTG-3'; (SEQ ID NO. 37) R3: 5'-ggaattgtgctgaagctagc TTAACGCTGCATCTTTTTTCGCAGCATC-3'; (SEQ ID NO. 38) F4: 5'-GCTAGCTTCAGCACAATTCCAA-3'; (SEQ ID NO. 39) R4: 5'-GCAAAAGCTTGAGTTGCGCC-3'; (SEQ ID NO. 40) F5: 5'-taaaaaaggagacatgaacg ATGAACAAAATCGGCGTTCATT-3'; (SEQ ID NO. 41) R5: 5'-tccccgggtaccgagctcga TTAACGCTGCATCTTTTTTCGC-3'; (SEQ ID NO. 42) F6: 5'-TCGAGCTCGGTACCCGGG-3'; (SEQ ID NO. 43) R6: 5'-CGTTCATGTCTCCTTTTTTATGTACTG-3' (SEQ ID NO. 44) Construction of B. subtilis secretory expression strain with PWB980 plasmid as expression vector Bacillus subtilis BS168 / PWB980-RsDAE-F47A-N72E-N114G-C221S and B. subtilis intracellular expression strain Bacillus subtilis BS168 / PWB980-RsDAE-F47A-N72E-N114G-C221S.

[0074] Construction of secretory expression plasmid: using high-fidelity Pfu DNA polymerase to amplify the D- Psicose-3-epimerase gene sequence with homologous arms as the template under the priming of primers F3 / R3 and F4 / R4, using PWB980 plasmid as the template to amplify the linearized vector sequence using high-fidelity Pfu DNA polymerase, and using homologous recombination enzyme to homologously recombine the target gene with the linearized vector to construct the secretory expression plasmid PWB980-RsDAE-F47A-N72E-N114G-C221S. Then, using the same method as the construction of the secretory expression plasmid, the intracellular expression plasmid was constructed.

[0075] Construction of recombinant B. subtilis: 200 μL of the homologous recombination product (i.e. secretory expression plasmid or intracellular expression plasmid) stored at -80°C was added to 20 μL of competent cells of BS168 in an ultra-clean bench at 0°C for 10 min, and then cultured at 37°C and 200 rpm for 2 h; 800 μL of LB medium was added, and the culture was continued at 37°C and 200 rpm for 1 h, and then plated on LB plates containing 25 μg / mL of kanamycin resistance and cultured at 37°C for 15 h. Random clones were picked and the plasmids were extracted for sequencing identification, and the recombinant B. subtilis strains expressing recombinant secretory expression and intracellular expression were screened, respectively. Bacillus subtilis BS168 competent cells were placed in an ice bath at 0°C for 10 min, and then 20 μL of the homologous recombination product (i.e. secretory expression plasmid or intracellular expression plasmid) was added in an ultra-clean bench, and cultured at 37°C and 200 rpm for 2 h; 800 μL of LB medium was added, and the culture was continued at 37°C and 200 rpm for 1 h, and then plated on LB plates containing 25 μg / mL of kanamycin resistance and cultured at 37°C for 15 h. Random clones were picked and the plasmids were extracted for sequencing identification, and the recombinant B. subtilis strains expressing recombinant secretory expression and intracellular expression were screened, respectively. Bacillus subtilis BS168 / PWB980-RsDAE-F47A-N72E-N114G-C221S.

[0076] The recombinant B. subtilis strains expressing recombinant secretory expression and intracellular expression were screened, respectively. Bacillus subtilisBS168 / PWB980-RsDAE-F47A-N72E-N114G-C221S was inoculated into LB liquid medium containing kanamycin at a final concentration of 25 μg / mL and incubated at 37°C for 10 hours as seed liquid, which was inoculated into a 5 L fermenter containing 3 L fermentation medium at a volume concentration of 5%. The pH of the fermentation process was controlled at about 7.0 by using ammonia solution and 30% (v / v) phosphoric acid solution, the rotation speed was coupled with dissolved oxygen (DO), and the change of DO curve was timely observed. When the dissolved oxygen rebounded, the feed medium was timely added to control the DO value of the fermentation process at about 30%. After 48 hours of fermentation, the supernatant was collected by centrifugation to obtain the fermentation broth containing the target protein.

[0077] The 3 L fermentation medium was composed of yeast powder 75 g, glucose 36 g, corn syrup 30 g, dipotassium hydrogen phosphate 9 g, sodium chloride 3 g, magnesium sulfate 3 g, and calcium chloride 0.75 g.

[0078] The feed medium (0.5 L) was composed of proteose peptone 15 g, yeast powder 30 g, and dipotassium hydrogen phosphate 3 g.

[0079] Vigor detection of the secretory expression strain: the substrate fructose was added at a final concentration of 500 g / L, Co 2+ , and the supernatant of the fermentation broth was 200 mL to form a reaction solution with a total volume of 1 L. The reaction conditions were 55°C and 500 rpm for 5 hours. After the reaction, 20 μL of the reaction sample was taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and subjected to HPLC detection. The reaction progress curve is shown in Figure 2 , and the D-allulose concentration was 177.5 g / L with a conversion rate of 35.5 % after the reaction.

[0080] Vigor detection of the intracellular expression strain: the substrate fructose was added at a final concentration of 500 g / L, Co 2+ , and the bacterial slurry was 25 g / L to form a reaction solution with a total volume of 1 L. The reaction conditions were 55°C and 500 rpm for 4 hours. After the reaction, 20 μL of the reaction sample was taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and subjected to HPLC detection. The reaction progress curve is shown in Figure 3 , and the D-allulose concentration was 179 g / L with a conversion rate of 35.8 % after the reaction.

[0081] Example 7 Immobilization of D-allulose-3-epimerase and its application in synthesis of D-allulose: The secretory expression Bacillus subtilisBS168 / PWB980-RsDAE-F47A-N72E-N114G-C221S fermentation supernatant, add 2 volumes of purified water, take an appropriate amount of diatomite (the addition amount is 1:8 of the mass ratio of the diluted fermentation broth, stir and mix for 10-15 min, then add 0.3% of polyethyleneimine by volume to flocculate for 20-30 min, finally add 0.8% of glutaraldehyde by volume to covalently crosslink for 1 h, then wash with purified water for 3-5 times to obtain the immobilized RsDAE-F47A-N72E-N114G-C221S.

[0082] The catalyst dosage is 20 g / L based on the total weight of the immobilized enzyme, the final concentration of the substrate fructose is 500 g / L, and the final concentration of Co 2+ is 1 mM. Purified water is used as the reaction medium to form the reaction solution, and the total volume is 1 L. The reaction conditions are: 55°C, 500 rpm for 4-6 hours. After the reaction is completed, 20 μL of the sample at the end of the reaction is taken, diluted 50 times, filtered through a 0.22 μm filter membrane, and subjected to HPLC detection. The conversion rate of the immobilized RsDAE-F47A-N72E-N114G-C221 can reach 36.0% after 4 h of reaction, and the enzyme activity can still be maintained at more than 80% after 30 batches of reaction.

[0083] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A D-allulose-3-epimerase mutant, characterized in that, The NCBI accession number of the D-psicose-3-epimerase is CDC15199.1, and the mutation site is F47A.

2. A nucleic acid molecule, characterized in that, The nucleotide sequence encoding the D-psicose-3-epimerase mutant of claim 1.

3. An expression vector, characterized by, The nucleic acid molecule of claim 2.

4. The expression vector of claim 3, wherein, The expression vector comprises a pET-28a plasmid or a PWB980 plasmid.

5. A host cell, characterized in that, Any one of the following: (a1), the nucleic acid molecule of claim 2; (a2), the expression vector of claim 3 or 4; The host cell is a bacterium.

6. The host cell of claim 5, wherein The host cell is Escherichia coli or Bacillus subtilis.

7. A method for producing a D-allulose-3-epimerase mutant, characterized by, It is prepared based on any one of the following: (b1), the nucleic acid molecule of claim 2; (b2), the expression vector of claim 3 or 4; (b3), the host cell of claim 5 or 6.

8. Use of the D-psicose-3-epimerase mutant of claim 1 in the preparation of D-psicose.

9. A method for producing D-allulose, characterized by, It comprises: D-psicose is prepared based on the host cell of claim 5 or 6; The prepared reaction system comprises: 450-650 g / L fructose, 1 mM Co 2+ 5-25 g / L wet bacterial bodies containing the host cell; The temperature of the preparation is 50-60℃; The time of the preparation is 4-6 hours.

10. A method for producing D-allulose, characterized by, It comprises: D-psicose is prepared based on the D-psicose-3-epimerase mutant of claim 1; The prepared reaction system comprises: 450-650 g / L fructose, 1 mM Co 2+ 5-25 g / L of the D-psicose-3-epimerase mutant; The temperature of the preparation is 50-60℃; The time of the preparation is 4-6 hours.

Images