Salt-resistant alkali-resistant xylanase and application thereof
By extracting the salt- and alkali-tolerant xylanase gene cwp6-xyn10 from saline-alkali soil, the problem of insufficient enzyme activity of existing xylanases in high-salt and alkaline environments has been solved, enabling efficient application in high-salt and alkaline environments.
Patent Information
- Application Number
- CN202511257857.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-04
- Publication Date
- 2025-12-09
AI Technical Summary
Existing xylanases have insufficient enzyme activity and stability in high-salt and alkaline environments, which limits their application in industrial and agricultural waste treatment.
Metagenomic DNA was extracted from the saline-alkali soil of Chaiwopu Lake to obtain the salt- and alkali-tolerant GH10 xylanase gene cwp6-xyn10, which was heterologously expressed and purified in Escherichia coli to construct a recombinant vector for application in high-salt and alkaline environments.
CWP6-Xyn10 exhibits high enzyme activity, salt and alkali tolerance, and can effectively hydrolyze agricultural waste, showing broad prospects for industrial and environmental applications.
Smart Images

Figure CN121087019A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, more particularly to a salt-tolerant and alkali-tolerant xylanase and application thereof. BACKGROUND
[0002] Hemicellulose is the second most abundant biopolymer in nature after cellulose, and xylan is the main component of hemicellulose in plant cells. It is composed of β-1, 4-glucosidic linked xylose units and side chains composed of α-glucuronide, arabinose, galactose, acetic acid, methyl glucuronide and other monosaccharides. Due to the heterogeneity and complexity of xylan, complete hydrolysis requires the synergistic action of multiple enzymes. Generally, "xylanase" refers to endo-1, 4-β-D-xylanase (EC 3.2.1.8) which breaks the β-1, 4-xylosidic bond in the xylan backbone to produce different xylan oligosaccharides (Xylo-Oligosaccharides XOS) and a small amount of xylose. Xylanase mainly exists in glycoside hydrolase (GH) family (for example, 5, 7, 8, 9, 10, 11, 12, 16, 26, 30, 43, 44, 51 and 62 families, among which GH10 and GH11 families are the most representative. Compared with GH11, GH10 xylanase not only can act on a wider range of xylan substrates, but also performs more effectively in the process of biomass hydrolysis when synergized with cellulase.
[0003] Xylanase is ubiquitous in nature and is observed in a variety of organisms, such as marine, terrestrial, insects and microorganisms. Among them, bacteria and fungi are widely used in industrial production of xylanase. In bacteria, Bacillus, which has been widely reported, is the strongest producer of xylan hydrolysis enzyme, for example, Gupta et al. isolated a high-temperature and alkali-tolerant xylanase from Bacillus sp. and Bacillus halodurans, which is used for biobleaching of kraft pulp and deinking of waste paper. Kumar and Satyanarayana found that the synergistic effect of commercial cellulase and Bacillus halodurans TSEV1 xylanase on deinking of waste paper was remarkable under alkaline pH and high temperature conditions. However, many xylanases from ordinary environmental microorganisms are limited in specific industries due to their enzyme activity, salt tolerance and alkali tolerance. Halophilic and alkali-tolerant xylanases are mainly derived from halophilic microorganisms, mainly distributed in extreme environments such as saline-alkali soil, alkaline lake and mangrove forest, and the enzymes cloned and expressed from these extreme microorganisms usually have better performance than those extracted from ordinary environment. Therefore, metagenomic technology has great potential in extracting high-activity, halophilic and alkali-tolerant xylanases from extreme environmental microorganisms.
[0004] The present application obtains a novel GH10 xylanase gene (cwp6-xyn10) from the metagenomic DNA data of saline-alkali soil of Chaiwopu Lake. The gene sequence is artificially synthesized, and an expression plasmid (named pSHY211) is constructed for cloning and expressing the cwp6-xyn10 gene in E. coli DH5α. After heterologous expression and protein purification, the activity of the recombinant enzyme is characterized. Enzymatic characterization shows that CWP6-Xyn10 has high enzyme activity, salt tolerance and alkali tolerance, and is expected to be applied in pulp bleaching, industrial wastewater treatment, textiles and other high-salt environments. And it can directly process natural substrates such as agricultural straw, and biologically convert lignocellulose waste into high-value prebiotic xylo-oligosaccharides. SUMMARY
[0005] Therefore, the present application provides a salt-tolerant and alkali-tolerant xylanase gene, a recombinant vector, a host cell, a salt-tolerant and alkali-tolerant xylanase and its application. The enzyme can be used in high-salt and alkali industrial environments, and has wide application prospects in biofuel production, high-salt wastewater treatment and agricultural waste regeneration, and has important economic and environmental value.
[0006] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:
[0007] A salt-tolerant and alkali-tolerant xylanase, wherein the salt-tolerant and alkali-tolerant xylanase is CWP6-Xyn10, and the amino acid sequence is shown as SEQ ID NO: 2.
[0008] A DNA molecule encoding the salt-tolerant and alkali-tolerant xylanase of claim 1, wherein the DNA molecule is (a) or (b):
[0009] (a) the nucleotide sequence is shown as SEQ ID NO: 1;
[0010] (b) a DNA molecule encoding the salt-tolerant and alkali-tolerant xylanase formed by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown as SEQ ID NO: 1.
[0011] A recombinant vector, wherein the recombinant vector comprises the DNA molecule and a regulatory sequence for expression operably linked to the DNA molecule.
[0012] A host cell, wherein the host cell comprises the DNA molecule or the recombinant vector.
[0013] Application of the salt-tolerant and alkali-tolerant xylanase in degrading hemicellulose.
[0014] Application of the salt-tolerant and alkali-tolerant xylanase in treating agricultural waste.
[0015] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows:
[0016] This invention utilizes metagenomics technology to obtain a novel salt and alkali tolerance gene, cwp6-xyn10, from the Chaiwopu saline-alkali land. Subsequently, both genes were heterologously expressed in *E. coli*, and their enzymatic properties were analyzed. Enzymatic characterization revealed that CWP6-Xyn10 is a highly active, salt- and alkali-tolerant xylanase with good salt tolerance and pH stability. TLC analysis identified its hydrolysis products. Hydrolysis experiments evaluated the potential applications of CWP6-Xyn10 xylanase in agricultural waste. This enzyme can be used in high-salt and alkaline industrial environments and has broad application prospects in biofuel production, high-salt wastewater treatment, and the regeneration of agricultural waste, possessing significant economic and environmental value. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0018] Figure 1 Sequence analysis for CWP6-Xyn10; Figure 1 a) Multiple sequence alignment of CWP6-Xyn10 (PDB IDs: 4K68, 1UQY, 1UR1, 2CNC, and 4PMU); Figure 1 b) Tertiary structure predicted using SWISS-MODEL; the two glutamic acid residues are marked with a blue asterisk;
[0019] Figure 2 The phylogenetic tree results for CWP6-Xyn10;
[0020] Figure 3 12% SDS-PAGE analysis of CWP6-Xyn10; M is the protein molecular weight standard; 1 is the total protein of E. coli DH5α / pSHY211-CWP6-Xyn10; 2 is the purified protein;
[0021] Figure 4 The effects of temperature and pH on the activity of recombinant CWP6-Xyn10; Figure 4 a: The effect of temperature on the activity of CWP6-Xyn10; Figure 4b: Effect of pH on CWP6-XynlO activity; values represent the mean of three biological replicates, error bars represent the mean + standard error (SEM) of three biological replicates; the effect of temperature and pH on enzyme activity was assessed by ANOVA; control activity was taken as 100%, 100% of CWP6-XynlO = 256.05 ± 4.20 U / mg;
[0022] Figure 5 Effect of temperature and pH on recombinant CWP6-XynlO stability; Figure 5 a: Effect of different incubation temperatures (45, 50 and 55°C) and different times (0, 20, 40, 60, 80, 100 and 120 min) on CWP6-XynlO stability; Figure 5 b: Effect of pH on CWP6-XynlO stability; values represent the mean of three biological replicates, error bars represent the mean + standard error (SEM) of three biological replicates; the effect of temperature and pH on enzyme stability was assessed by ANOVA; control activity was taken as 100%, 100% of CWP6-XynlO = 256.05 ± 4.20 U / mg;
[0023] Figure 6 Effect of metal ions on CWP6-XynlO enzyme activity; note: values represent the mean of three biological replicates (mean ± SEM); ** represents p<0.01, values at dotted line are relative activity 100%; control, without addition of any reagent; CWP6-XynlO control activity taken as 100%, 100% = 256.05 ± 4.20 U / mg;
[0024] Figure 7 Effect of chemical reagents on CWP6-XynlO enzyme activity; note: values represent the mean of three biological replicates (mean ± SEM); ** represents p<0.01, values at dotted line are relative activity 100%; control, without addition of any reagent; CWP6-XynlO control activity taken as 100%, 100% = 256.05 ± 4.20 U / mg;
[0025] Figure 8 Effect of salt solutions on recombinant CWP6-XynlO activity and stability; Figure 8 a: Effect of salt solutions on CWP6-XynlO activity; Figure 8 b: Effect of different incubation concentrations (1, 2, 3, 4 and 5 M NaCl) and different times (12 h and 108 h) on CWP6-XynlO stability;
[0026] Figure 9Thin layer chromatography analysis of CWP6-XynlO hydrolysate of xylo- oligosaccharides; M, standard: X1 (xylose), X2 (xylose disaccharide), X3 (xylose trisaccharide), X4 (xylose tetrasaccharide); 1, beechwood xylan (without enzyme); 2, purified CWP6-XynlO hydrolyzed beechwood xylan;
[0027] Figure 10 Hydrolysis of CWP6-XynlO on agricultural waste; results of CWP6-XynlO hydrolysis on corn cob (blue area), corn stalk (green area) and wheat bran (red area); values represent the mean of three biological replicates; error bars represent the mean ± standard error (SEM) of three biological replicates;
[0028] Figure 11 Hydrolysis of CWP6-XynlO on corn cob Figure 11 a), corn stalk Figure 11 b) and wheat bran Figure 11 c); M, standard: X1 (xylose), X2 (xylose disaccharide), X3 (xylose trisaccharide), X4 (xylose tetrasaccharide); 1, control (without enzyme); 2, experimental group. DETAILED DESCRIPTION
[0029] The technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application.
[0030] Embodiment 1
[0031] 1. Materials and methods
[0032] 1.1 Culture medium, strains and vectors
[0033] Luria Broth (LB) medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, pH natural; solid medium added with 20 g / L agar. Kanamycin was used as an antibiotic, with a final concentration of 50 μg / mL.
[0034] E. coli DH5α strain (purchased from Shenzhen KT Life Technology Co., Ltd.,
[0035] The pEASY-Uni Seamless Cloning Kit (TransGen Biotech, Beijing, China) and the conventional expression plasmid pSHY211 vector (laboratory self-made) were used for gene cloning and expression. The EcoR I and Hind III enzymes used for double enzyme digestion were purchased from Thermo Fisher Scientific (New York, NY, USA). The pEASY-Uni Seamless Cloning Kit was purchased from TransGen Biotech (Beijing, China).
[0036] 1.2 Sample collection and metagenomic sequencing
[0037] The sample of the present application was collected from the saline-alkali soil of the Chaiwopu Lake in Urumqi City (43.4996°N, 87.9363°E). The total salt content of the Chaiwopu Lake was 57.5 mg / g, and the surface pH value was 9.07. The Power Soil Kit (MOBIO DNeasy PowerSoil Kit, USA) was used for the extraction of metagenomic DNA, and the operation manual was followed. The metagenomic sequencing was completed using the HiSeq 2500 instrument at GENWIZ (Suzhou, China). The Velvet assembly program (version 1.2.08) (Zerbino and Birney, 2008) was used for de novo assembly. All the generated sequences were investigated through the IMG server (https: / / img.jgi.doe.gov / cgi-bin / mer / main.cgi, accessed on 10 June 2024). The COG (Tatusov et al., 2001), KEGG (Nakaya et al., 2012), and Pfam (Finn et al., 2007) databases were used for further analysis of the potential functions of each gene and open reading frame (ORF).
[0038] 1.3 Xylanase gene prediction and sequence analysis
[0039] According to the functional prediction, 18 xylanase genes belonging to the GH10 family were obtained. The genes were amplified by PCR, cloned, sequenced, aligned with the metagenomic sequence, and then subjected to heterologous expression and enzyme activity determination using the metagenomic DNA as the template. Finally, one gene with high activity was selected for subsequent enzyme property research and named cwp6-xyn10.
[0040] The nucleic acid sequence of the complete cwp6-xyn10 gene has a full open reading frame length of 1140 base pairs (bp), and it is predicted to have a 24-amino-acid putative signal peptide at its N-terminus, encoding 379 amino acids. The theoretical molecular weight (Mw) predicted by EXPASY is 43.068 kDa, and the isoelectric point (pi) is 5.24. Homology alignment was performed on the amino acid sequence of CWP6-Xyn10 using NCBI BLASTp, which showed a sequence similarity of 75.00% with endo 1,4-beta-xylanase from Marinimicrobium agarilyticum (WP_036186400.1), 69.13% with endo 1,4-beta-xylanase from Marinimicrobium alkaliphilum (WP_111642553.1), and 67.20% with endo 1,4-beta-xylanase from Natronospirillum operosum (WP_135483376.1). Two glutamic acid catalytic residues, E142 and E247, were identified in CWP6-Xyn10 through multiple sequence alignment with GH10 xylanases (1a). Homology modeling was performed on the amino acid sequence of CWP6-Xyn10 using SWISS-MODEL online software (https: / / swissmodel.expasy.org, accessed on February 10, 2025). The amino acid sequence with the most similar tertiary structure to CWP6-Xyn10 had a sequence similarity of 73.24%, and the Global Model Quality Estimation was 0.94 Figure 1 b). CWP6-Xyn10 showed a typical triosephosphate isomerase (TIM) barrel structure in the GH10 family, including a peptide backbone composed of 8 external alpha helices and 8 internal parallel beta chains. The barrel structure provides the space and environment required for substrate binding and catalytic reaction for xylanase, while the combination of alpha-helices and beta-chains ensures the stability of the structure and enzyme activity.
[0041] The DNA sequence of cwp6-xyn10 (1140 bp) is shown in SEQ ID No: 1:
[0042]
[0043] The corresponding amino acid sequence of CWP6-Xyn10 (379 residues) is shown as SEQ ID No: 2:
[0044] MKQISRRKFLLGSAALATLANIKACAIHKAADATGLKDIYKDDFLVGTAISNKTLAERDQTMLGLISREFNSITAENCMKSGLIQPREGEWNWELPDRFVNFGTEHDMTILGHALVWHSQTPTDLFTDAGGDRISRARLLEKMETHIQTVVDRYKGRIAMWDVVNESIDEDKGWRKSPWYEIVGPEFQERAFQLTHEADPNAHLIYNDYNMHNPGKREFLVDVIKDYKKRGVPIHGVGLQSHVGLDYPDLREFEKSIEAYAAQGMRVHLTELEVDVLPVAWEHTGAEISSEFEYSDELNPYADGFPPEMEQKLTDRYVELFKLFLKHRDKIERVTFWGTHDGESWKNDFPVGGRTNYPLLFDRDLQPKPAYYAVANLRR.
[0045] The DNA and protein sequences were aligned using BLASTx and BLASTp programs (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi, accessed on August 10, 2024), respectively. Signal peptide prediction was performed using SignalP (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / , accessed on August 10, 2024). The protein molecular weight size of CWP6-Xyn10 was predicted using the EXPASY tool ((https: / / web.expasy.org / translate / , accessed on March 10, 2024). Multiple alignments of related protein sequences from the NCBI database were performed using Clustal X (Thompson et al., 1997) and images were generated by Espript 3 (Gouet et al., 2003) (http: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi, accessed on February 10, 2025). Phylogenetic analysis was performed using the MEGA 7 software package (Kumar et al., 2016) with the maximum likelihood method (ML) and Poisson correction model. The protein sequence was analyzed using the SWISS-MODEL online software (https: / / swissmodel.expasy.org, accessed on February 10, 2025), and the protein sequence with the highest sequence identity was selected for modeling.
[0046] 1.4 Gene amplification and recombinant vector construction
[0047] PCR amplification of the cwp6-xyn10 gene was performed using metagenomic DNA as a template, using the following primers:
[0048] cwp6-xyn10-F:
[0049] CATCATCATCATCATCATGAATGTGCCATCCATAAGGCCGC, as shown in SEQ ID No. 3;
[0050] cwp6-xyn10-R:
[0051] GTGCTCGAGTGCGGCCGCAAGTCAACGGCGCAGGTTGGCC, as shown in SEQ ID No. 4.
[0052] PCR program includes: denaturation at 95 °C for 3 min, followed by 30 cycles, each cycle is: denaturation at 98 °C for 20 s, annealing at 58 °C for 30 s, extension at 72 °C for 60 s, and finally extension at 72 °C for 5 min. The underlined part of the primer sequence indicates the homologous recombination fragment with the pSHY211 vector, which is previously digested with EcoR I and Hind III restriction enzymes. The PCR product is identified by 1.0% agarose gel electrophoresis. Specifically: observe the PCR product under ultraviolet light, and cut the bright band with correct bp size. Then use SanPrep Column DNA gel extraction kit (Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China) for gel recovery to obtain the target DNA.
[0053] The recovered DNA is ligated to the pSHY211 vector digested with EcoR I and Hind III, and the recombinant plasmid pSHY211-CWP6-Xyn10 is constructed using pEASY-Uni Seamless Cloning & Assembly Kit (TransGen Biotech, Beijing, China). The recombinant plasmid is heat shocked (42 °C, 60 s) to Ca 2+ The chemical transformation method is introduced into E. coli DH5α recipient cells for expression. Positive clones are screened in LB solid medium containing 50 μg / mL kanamycin, and the clones are screened by colony PCR and sequencing to obtain the recombinant plasmid pSHY211-CWP6-Xyn10.
[0054] E. coli clones containing the recombinant plasmid pSHY211-CWP6-Xyn10 are successfully screened by colony PCR verification and sequencing. The gene sequencing result of cwp6-xyn10 is consistent with the metagenomic sequencing data, and the amino acid sequence of CWP6-Xyn10 is compared using NCBI BLASTp software to construct a phylogenetic tree. The phylogenetic tree result shows that Figure 2 ) CWP6-Xyn10 is clustered with endo 1,4-β-xylanase from Marinimicrobium agarilyticum (WP_036186400.1).
[0055] 1.5 Heterologous expression and purification of CWP6-Xyn10
[0056] The recombinant plasmid was transformed into E. coli DH5a for heterologous expression of CWP6-XynlO. The recombinant E. coli was cultured in 200 mL LB medium containing 50 pg / mL kanamycin. The culture was incubated at 37 °C, 180 rpm for 8 h until the broth was turbid. Then, the culture was transferred to 20 °C and incubated at 180 rpm for 12 h to allow the protein to be fully expressed. The E. coli cells were harvested by centrifugation at 8000 x g for 20 min. The harvested E. coli cells were resuspended in 10 mM imidazole (pH 7.6) and sonicated in an ice-water mixture. The lysate was centrifuged at 12,000 x g for 20 min at 4 °C to obtain the supernatant, which was the crude enzyme solution. Then, the protein was purified using a Ni-NTA column. The protein concentration was determined using Bradford reagent (Sangon Biotech (Shanghai) Co., Ltd, Shanghai, China) with bovine serum albumin as the standard by measuring the OD595 absorbance value. The purified CWP6-XynlO was detected by 12% SDS-PAGE and compared with the predicted protein molecular weight. (The protein standards were purchased from Wuhan Saiweier Biotechnology Co., Ltd., Wuhan, China; Accurate Biology (Hunan) Co., Ltd., Hunan, China).
[0057] Results The signal sequence-free xylanase gene screened was expressed in E. coli DH5a, and the recombinant protein with His tag at the N terminus was successfully obtained. The signal peptide-free recombinant xylanase CWP6-XynlO was obtained using molecular cloning and heterologous expression, and was separated and purified using Ni-NTA affinity chromatography. 12% SDS-PAGE analysis showed that the purified recombinant xylanase CWP6-XynlO had a single band near 42-45 kDa, which was consistent with the theoretically predicted molecular weight (about 43 kDa) Figure 3 ).
[0058] 1.6 Biochemical characterization of xylanase
[0059] To determine the optimal pH, purified CWP6-XynlO was incubated with 1% (w / v) beechwood xylan in different pH buffers. The buffers used were Na2HPO4-citric acid buffer with pH ranging from 3.0 to 8.0 and glycine-NaOH buffer with pH ranging from 8.0 to 11.0. To assess the pH stability of CWP6-XynlO, the pure enzyme was incubated at different pH (3.0 to 10.0) for different time (12 h and 24 h) and then the residual activity was determined. Specifically, the pure enzyme solution was mixed with the buffer of different pH at a volume ratio of 1 :9, and the experimental groups were incubated at 4°C for 12 h and 24 h, while the control group was the enzyme solution mixed with PBS buffer at a volume ratio of 1 :9. Subsequently, 10 μL of the mixture was mixed with 90 μL of 1% (w / v) optimal pH beechwood xylan, and the residual enzyme activity was determined after 30 min of reaction. The reaction mixture with PBS buffer was used as a control (100%), and the residual activity of the enzyme at different pH was compared.
[0060] The results showed that the optimal pH of CWP6-XynlO was 7, and it maintained more than 60% relative activity in the pH range of 6.0 to 8.0 Figure 4 a) The optimal reaction temperature was 50°C, at which the highest activity was exhibited. CWP6-XynlO maintained more than 60% activity at 25-55°C Figure 4 b).
[0061] At the optimal pH, the optimal temperature was determined by measuring the activity of CWP6-XynlO at different temperatures (5°C to 80°C). The purified enzyme was incubated at different temperatures (45°C, 50°C and 55°C) for different time (0, 20, 40, 60, 80, 100 and 120 min), and then 10 μL of the incubated enzyme was mixed with 90 μL of 1% (w / v) optimal pH beechwood xylan and reacted for 30 min at the optimal temperature, and the residual enzyme activity was determined. The untreated enzyme was used as a control (100%), and the residual activity of the enzyme at different temperatures was compared.
[0062] The results of thermal stability analysis showed that CWP6-XynlO maintained more than 100% relative activity after 2 hours of incubation at 45°C, and more than 80% relative activity after 1 hour of incubation at the optimal temperature of 50°C, and its half-life at 50°C was about 79 min Figure 5 a). The results showed that CWP6-XynlO was not a thermophilic or thermotolerant xylanase. For example Figure 5As shown in Figure b, after incubation in buffers with pH values ranging from 3.0 to 11.0 for 12 hours, the enzyme activity of CWP6-Xyn10 increased with the increase of pH value, especially in buffers with pH values ranging from 4.0 to 8.0. It is worth noting that the relative activity of CWP6-Xyn10 still exceeded 70% in the alkaline pH value range of 8.0-11.0, and the relative activity at pH 8 was as high as about 80%, showing good pH stability. The trend after 24 hours of incubation was consistent with that of 12 hours, but the relative activity of CWP6-Xyn10 in the alkaline pH value range of 8.0-11.0 decreased compared with 12 hours, but its relative activity still exceeded 60%, and the relative activity at pH 8 was about 80%. The pH stability analysis showed that CWP6-Xyn10 had the characteristics of alkali-tolerant xylanase and broad pH tolerance.
[0063] To evaluate the effects of metal ions and chemical reagents on the activity of the recombinant enzyme, the enzyme activity was determined under different concentrations of metal ions and chemical reagents. The metal ions included K + , Ag + , Mg 2+ , Ca 2+ , Zn 2+ , Co 2+ , Cu 2 + , Mn 2+ , Pb 2+ , Ni 2+ , Ba 2+ , Al 3+ , Fe 2+ , Fe 3+ and Cd 2+ with final concentrations of 1 mM and 10 mM; the chemical reagents included DTT (Dithiothreitol), SDS, PMSF (Phenylmethylsufonyl Fluoride), Urea, CTAB (Cetyltrimethylammonium bromide), EDTA (Ethylene Diamine Tetraacetic Acid) with final concentrations of 1% and 0.1%; and Tween-80, Triton X-100, DMSO (Dimethyl sulfoxide), Ethanol, Methanol, β-ME (β-Mercaptoethanol), IPA (Isopropanol) with final concentrations of 10% and 1%. The reaction mixture without any metal ions and chemical reagents was used as a control (100%), and the effects of metal ions and chemical reagents on enzyme activity were determined under the optimal pH and temperature conditions.
[0064] The results of the effects of metal ions and chemical reagents on recombinant CWP6-XynlO are shown in Table 1. Figure 6 As shown in Table 1, CWP6-XynlO activity was significantly (p<0.01) activated by Co 2+ , Mn 2+ and Cu 2+ at 1 mM and 10 mM, especially Co 2+ and Mn 2+ , with higher activity at 10 mM than at 1 mM. In addition, Fe 3+ (113.49±3.88%) and K + (111.56±1.23%) at 10 mM also significantly (p<0.01) activated CWP6-XynlO activity. Mg 2+ , Cd 2+ had little effect on its activity, but Zn 2+ , Pb 2+ , Ni 2+ and Fe 2+ at 1 mM slightly inhibited it, and Pb 2+ , Fe 2+ , Ca 2+ and Ni + at 10 mM strongly inhibited it. In the presence of Ag + and Al 3+ at 1 mM and 10 mM, it almost lost all activity. Figure 7 The effects of chemical reagents on CWP6-XynlO activity are shown in Table 2. DMSO and Methanol at 0.1% significantly (p<0.01) activated it. Urea (107.72±3.14%), EDTA (103.57±7.42%) and IPA (106.96±8.24%) at 0.1%, and Urea (104.30±1.69%) at 1% slightly activated it. DTT (0.1%) and EDTA (1%) slightly inhibited CWP6-XynlO activity. The rest of the chemical reagents significantly (p<0.01) inhibited most of the enzyme activity, especially CTAB, which almost lost all activity.
[0065] To determine the optimal salt concentration of CWP6-XynlO, the enzyme activity was measured at different concentrations of NaCl (0-5 M) with a gradient of 0.5 M under the optimal temperature and pH. The NaCl tolerance of CWP6-XynlO was tested by incubating the enzyme with different concentrations of NaCl (1-5 M) for different time (12 h, 24 h and 108 h) at a ratio of 1:9 (enzyme: NaCl solution). The enzyme activity without NaCl reagent was considered as 100% and defined as the control.
[0066] The results of the effect of NaCl solution on the enzyme activity of CWP6-XynlO are shown in Figure 2. Figure 8 As shown in Figure 2a, the optimal salt concentration of CWP6-XynlO was 0.5 M, indicating that they belong to moderate salt-tolerant xylanases. Compared with the control, the enzyme activity of CWP6-XynlO was increased by 0.5 M and 1 M NaCl under the optimal conditions, especially when 0.5 M NaCl was added, the enzyme activity was increased by 9% compared with the control. With the increase of NaCl concentration, the enzyme activity of CWP6-XynlO was gradually reduced, and the activity of the recombinant enzyme was reduced to about 50% under 5 M NaCl. As shown in Figure 2b, the relative activity of CWP6-XynlO was still about 100% after 108 h of tolerance in 1-5 M NaCl, indicating that CWP6-XynlO has very strong salt tolerance and can maintain its structure and good enzyme activity under very high salt concentration. Figure 8
[0067] 1.7 Substrate specificity and kinetic parameters of CWP6-XynlO
[0068] To study the substrate specificity of CWP6-XynlO, beechwood xylan, corn cob xylan, bagasse xylan, Avicel, CMC were used as substrates (1%, w / v) to determine the enzyme activity. Under the optimal pH and temperature conditions, different concentrations of beechwood xylan (2-20 mg / ml) were used to react for 5 minutes to determine the kinetic constants of CWP6-XynlO. The Km (Michaelis-Menten constant) and Vmax (maximum velocity of the reaction) were calculated by Lineweaver-Burk plot.
[0069] The results of substrate specificity and kinetic analysis are shown in Table 1:
[0070] Table 1 shows the substrate specificity of CWP6-Xyn10. It exhibited the highest hydrolytic activity against beech xylan (256.05 ± 4.20 U / mg), and also showed high degradation activity against corn cob xylan (123.75 ± 5.35 U / mg) and bagasse xylan (142.89 ± 2.25 U / mg). However, it showed no activity against other substrates, including microcrystals, CMC, and cellobiose (see Table 1). The kinetic parameters of recombinant CWP6-Xyn10 were determined using the Michaelis-Menten equation. The Km and Vmax of CWP6-Xyn10 were 2.3 mg / mL and 555.56 μmol / min / mg, respectively.
[0071] Table 1. Substrate specificity of CWP6-Xyn10
[0072] Substrate Specific Activity (U / mg) CWP6-Xyn10 Beech xylan 256.05±4.20 Corncob xylan 123.75±5.35 Bagass xylan 142.89±2.25 Avicel 0 CMC-Na 0 Cellobiose 0
[0073] 1.8 Thin-layer chromatography (TLC) analysis of xylanase hydrolysis products
[0074] 1 mL of 2% (w / v) beech xylan was mixed with 10 μg of purified enzyme and incubated overnight at the optimal pH and temperature to ensure complete hydrolysis. The hydrolysis products of CWP6-Xyn10 were characterized by thin-layer chromatography (TLC) using Silica Gel 60 glass plates (Merck, Darmstadt, Germany). The mobile phase solvent was 1-butanol / acetic acid / water (2:1:1, v / v / v). The colorimetric reagent was 5% H₂SO₄ / ethanol (v / v). The mixture was treated at 120 °C for 10 min, and the hydrolysis products were detected by color development. Xylose (X1), xylose disaccharide (X2), xylose trisaccharide (X3), and xylose tetrasaccharide (X4) were used as sugar standards.
[0075] TLC analysis results are as follows Figure 9 As shown, the hydrolysis products of xylan were analyzed by thin-layer chromatography (TLC) using CWP6-Xyn10. The results showed that the major products of CWP6-Xyn10 were X2 and X4.
[0076] 1.9 Hydrolysis of agricultural waste by recombinant xylanase CWP6-Xyn10
[0077] To evaluate the hydrolytic ability of CWP6-XynlO on agricultural wastes, the present application detected the corn cob and wheat bran treated by hot water and alkali. The hot water treatment was: 10 g of the above substrate sieved by 80 mesh was treated in 100 mL of 95 °C hot water for 2 h, then the substrate was washed and filtered and dried at 80 °C. The alkali treatment was: 15 g of the above substrate sieved by 80 mesh was treated in 300 mL of 2% NaOH at 80 °C for 2 h, then the substrate was washed until colorless and filtered and dried at 80 °C.
[0078] 0.2 g of pretreated substrate was added into 5 mL of optimal pH buffer, 0.25 mg of (CWP6-XynlO) pure enzyme was added into the reaction system. The mixture was incubated at the optimal temperature. After the reaction started, samples were taken at 0, 2, 4, 6, 8, 10, 12, 24, 36 and 48 h respectively. The reducing sugar concentration in the reaction solution was determined by DNS hot activation method at OD540. The control condition was the reaction solution without adding enzyme. Three biological repeats were carried out for each group and the average value was calculated. Then the hydrolysis products of agricultural wastes were characterized by thin layer chromatography (TLC) using Silica gel 60 Glassplates (Merck, Darmstadt, Germany).
[0079] The hydrolysis results are shown in Figure 10 As shown in Figure 11 The hydrolysis results are shown in
[0080] 1.10 Statistical analysis
[0081] All experiments of the present application were carried out in triplicate, and all analyses were performed using the mean values. The results were statistically analyzed using SPSS 20.0, and the mean values ± SEM were used to represent the results. Single factor analysis of variance was used for statistical analysis, and Tukey's HSD test was used for multiple comparisons. In all comparisons, p < 0.05 was considered statistically significant.
[0082] The foregoing description of the disclosed embodiments enables a person skilled in the art to make or use the application. Modifications of these embodiments will occur to persons of skill in the art, and, while certain modifications are discussed, it is desired to be protected in accordance with the spirit and scope of the application. Therefore, the application is not limited to the specific embodiments shown and described, but only by the scope of the appended claims, unless otherwise specified.
Claims
1. A salt and alkali tolerant xylanase, characterized in that, The salt-tolerant and alkali-tolerant xylanase is CWP6-Xyn10, and the amino acid sequence is shown as SEQ ID NO:
2.
2. A DNA molecule encoding the salt and alkali tolerant xylanase of claim 1, characterized in that, The DNA molecule is (a) or (b): (a) the nucleotide sequence thereof is shown as SEQ ID NO: 1; (b) a DNA molecule encoding the salt-tolerant and alkali-tolerant xylanase as claimed in claim 1, which is formed by replacing, deleting or inserting one or several nucleotides in the nucleotide sequence shown as SEQ ID NO:
1.
3. A recombinant vector, characterized in that, The recombinant vector comprises the DNA molecule as claimed in claim 2 and a regulatory sequence for expression operably linked to the DNA molecule.
4. A host cell characterized in that, The host cell comprises the DNA molecule as claimed in claim 2 or the recombinant vector as claimed in claim 3.
5. Use of the salt-tolerant and alkali-tolerant xylanase as claimed in claim 1 in degrading hemicellulose.
6. Use of the salt-tolerant and alkali-tolerant xylanase as claimed in claim 1 in treating agricultural waste.