Application of SatIII RNA detection reagent and septicopyemia detection product comprising detection reagent

By using a SatⅢRNA detection reagent to detect the expression level of SatⅢRNA in patients with sepsis, combined with NFIL3 gene expression, the problem of existing biomarkers being unable to perform clustering was solved, enabling accurate diagnosis and treatment of sepsis and improving the sensitivity and specificity of detection.

CN121087151APending Publication Date: 2025-12-09CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410721485.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-06-04
Publication Date
2025-12-09

AI Technical Summary

Technical Problem

Existing diagnostic markers for sepsis, such as PCT and CRP, cannot meet the needs for further patient segmentation, leading to difficulties in the discovery of therapeutic targets and molecular markers.

Method used

The detection reagents using SatⅢ RNA, including quantitative detection reagents, specific detection primer pairs, and targeting probes, are used to prepare sepsis detection products to detect the expression level of SatⅢ RNA in tissue or cell samples and, in conjunction with the NFIL3 gene expression level, predict patient prognosis.

Benefits of technology

It improves the sensitivity and specificity of sepsis detection, enables precise patient segmentation and treatment, provides better prognostic assessment, and offers a reference for the development of biomarkers for other diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121087151A_ABST
    Figure CN121087151A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology, in particular to application of a detection reagent of SatIII RNA and a septicopyemia detection product comprising the detection reagent. The invention particularly relates to application of a detection reagent of SatIII RNA in preparation of a septicopyemia detection product. The invention discloses a brand new biomarker, namely SatIII RNA, which is different from traditional protein markers such as procalcitonin and C-reactive protein. The RNA marker is stable, detection belongs to minimally invasive detection, detection is easy, quantification is accurate, and due to the advantages, the sensitivity and specificity of septicopyemia detection can be improved. The successful development of the RNA marker contributes to the diagnosis, grouping, precise treatment and prognosis of septicopyemia, and also provides reference significance for the research and development of biomarkers of other diseases.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, in particular to an application of a Sat III RNA detection reagent and a sepsis detection product comprising the same. BACKGROUND

[0002] Sepsis is a life-threatening condition caused by a dysregulated response to infection. Sepsis often causes complex immune responses, including pro- and anti-inflammatory mechanisms, whose interplay often determines the clinical outcome. Early death from sepsis is usually due to an excessive inflammatory response, "cytokine storm", manifested as fever, shock, acidosis and abnormal catabolism. The heterogeneity of multiple pathophysiological pathways and host responses often hinders the progress of disease treatment, and this complexity prompts people to try to develop precision medicine methods to divide patients into more homogeneous subgroups with common biological characteristics for better diagnosis and targeted treatment, while the current molecular markers such as procalcitonin (PCT) and C-reactive protein (CRP) cannot meet the needs of further subgrouping of patients. Therefore, the challenge of future sepsis treatment is how to find more therapeutic targets and molecular markers. SUMMARY

[0003] Therefore, one or more embodiments of the present application provide a use of a biomarker Sat III RNA, and the technical solution comprises:

[0004] One or more embodiments of the present application provide an application of a Sat III RNA detection reagent in the preparation of a sepsis detection product.

[0005] In some embodiments of the present application, the Sat III RNA detection reagent comprises a quantitative detection reagent.

[0006] In some embodiments of the present application, the Sat III RNA detection reagent comprises a specific detection primer pair shown in SEQ ID NO. 129 and SEQ ID NO. 130.

[0007] In some embodiments of the present application, the Sat III RNA detection reagent comprises a targeting probe shown in SEQ ID NO. 3 or / and SEQ ID NO. 4; optionally, the targeting probe is a fluorescently labeled probe; further optionally, the fluorescent label on the fluorescently labeled probe comprises any one of cy3 and cy5.

[0008] In some embodiments of the present application, the Sat III RNA detection reagent comprises MhdCas13c.

[0009] In some embodiments of the present application, the sample detected by the sepsis detection product is a tissue sample or a cell sample.

[0010] In some embodiments of the present application, the tissue sample is a blood sample or an intestinal tissue sample.

[0011] In some embodiments of the present application, the cell sample includes peripheral blood mononuclear cells.

[0012] One or more embodiments of the present application also provide a sepsis detection product, which includes a detection reagent of Sat III RNA defined above.

[0013] In some embodiments of the present application, the sepsis detection product further includes one or more of an RNA extraction reagent, a reverse transcription reagent, a fluorescent quantification reagent, and a hybridization reagent.

[0014] Compared with the conventional technology, the embodiments of the present application have the following beneficial effects:

[0015] The present application finds a brand-new biomarker, Sat III RNA, which is different from the conventional protein markers such as procalcitonin (PCT) and C-reactive protein (CRP). The RNA marker is not only stable, but also belongs to minimally invasive detection, is easy to detect, and is quantitatively accurate. These advantages will improve the sensitivity and specificity of sepsis detection. The successful development of the RNA marker will help the diagnosis, grouping, precise treatment, and prognosis of sepsis, and also provides a reference for the research and development of biomarkers for other diseases. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application, more completely understand the present application and its beneficial effects, the drawings needed to be used in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0017] Figure 1Figure 1. The flowchart and results of the SatIII DNA and RNA dynamic changes in HeLa cells under SA and HS stimulation. A. The flowchart of the SatIII DNA and RNA dynamic changes in HeLa cells under SA and HS stimulation. B. The SatIII DNA and RNA dynamic changes in HeLa cells under SA and HS stimulation. C. The SatIII DNA and RNA dynamic changes in HeLa cells under SA and HS stimulation. D. The SatIII DNA and RNA dynamic changes in HeLa cells under SA and HS stimulation. E. The SatIII DNA and RNA dynamic changes in HeLa cells under SA and HS stimulation. F. The SatIII DNA and RNA dynamic changes in HeLa cells under SA and HS stimulation.

[0018] Figure 2 Figure 2. The dynamic observation results of item 2 in Example 1. A. The real-time microscopic image shows the dynamic changes of SatIII DNA labeled by CRISPR-HyperdLbCas12a system in HeLa cells after SA stimulation. B. The real-time microscopic image shows the dynamic transcription changes of SatIII RNA labeled by CRISPR-dPspCas13b system in HeLa cells after SA stimulation. C. The real-time microscopic image shows the dynamic changes of SatIII DNA labeled by CRISPR-HyperdLbCas12a system in HSF1-mScarlet stable HeLa cells after SA stimulation. D. The volume change curve of SatIII DNA and RNA labeled in A and B. E. The representative image of SatIII DNA FISH in HeLa cells at different time points after SA stimulation. F. The volume change curve of SatIII DNA at different time points after SA stimulation in E.

[0019] Figure 3 Figure 3. The results of items 3, 4 and 5 in Example 1. A. The representative image of HAP, HSF1 and SatIII RNA three-color imaging localization in HeLa cells under SA and HS stimulation and the distribution graph of corrected relative fluorescence value and position. B. The screening schematic diagram of 30 nuclear stressosome candidate proteins localization. C. The representative image of fluorescence imaging localization of 30 nuclear stressosome candidate proteins and HSF1. D. The classification of relative localization relationship of 30 candidate proteins and HSF1. E. The representative image of real-time microscopic imaging of HAP, BRD4, THRAP3 and HSF1. F. The representative image of HeLa cell nuclear stressosome immunofluorescence after ASO knockdown of SatIII.

[0020] Figure 4Figure for item "6" and "7" under Example 1, wherein: A. a flow chart of screening key proteins affecting the ordered hierarchy of nuclear stress granules; B. a histogram of the proportion of abnormal nuclear stress granule structures after knockdown of different proteins; C. a flow chart of CRISPR-dPspCas13b system labeling SatIII RNA and real-time imaging after DMSO and JQ1 treatment (left); a curve of real-time changes in the volume of SatIII RNA after DMSO and JQ1 treatment (middle); a curve of changes in the expression level of SatIII RNA detected by RT-qPCR after DMSO and JQ1 treatment (right); D. representative images of three-color fluorescence imaging of HAP, HSF1 and SatIII RNA after DMSO and JQ1 treatment;

[0021] Figure 5 Figure for item "8" under Example 1, wherein: A. Northern blot detection of SatIII expression in different cells under SA stimulation; B. representative fluorescence imaging showing the hierarchical structure of nuclear stress granules formed in HUVEC and THP-1 cells after SA and HS stimulation; C. representative fluorescence imaging showing the hierarchical structure of nuclear stress granules formed in human peripheral blood mononuclear cells (PBMCs) after SA and HS stimulation;

[0022] Figure 6 Figure for item "9" under Example 1, wherein: A. heat map of 46 and 30 genes found after combined analysis of TSA-seq and RNA-seq under SA and HS stimulation; B. qPCR detection of the expression level of part of the genes in A after ASO knockdown of SatIII in HeLa and THP-1 cells;

[0023] Figure 7 Figure for item "10" under Example 1, wherein: A. statistical diagram of the three-dimensional distance of SatIII-NFIL3 after standardization; B. DNA FISH representative image (left) and corresponding distance statistical results (right) of the relative position relationship of SatIII-NFIL3 in HeLa and THP-1 cells under different stimulations (UN, SA and HS); C. schematic diagram (left), fluorescence representative image (middle) and distance statistical results (right) of labeling SatIII and NFIL3 sites by combining CRISPR-HyperdLbCas12a system and CRISPR-dCas9 system in living cells; D. ATAC-seq results of THP-1 cells under different stimulations (UN, SA and HS): peak map centered on transcription start site (TSS) (left), volcano plot of differences in gene openness changes (middle) and track map of NFIL3 site (right);

[0024] Figure 8Figure for the results under item "11" in Example 1, wherein: Figure A. HSF1 and BRD4 ChIP-qPCR results show that HSF1 and BRD4 bind to the NFIL3 promoter region after SA stimulation; Figure B. Dual luciferase reporter assay results show that the transcriptional activity of the NFIL3 promoter is reduced after HSF1 and BRD4 knockdown; Figure C. RT-qPCR results show that the mRNA expression level of NFIL3 is reduced after HSF1 and BRD4 knockdown;

[0025] Figure 9 Figure for the results under item "12" in Example 1, wherein: Figure A. Live cell fluorescence representative graph of HSF1 protein and NFI3L site under different treatment conditions in HeLa cells; Figure B. Statistics of the proportion of HSF1 protein spatially adjacent to the NFIL3 site before and after SA stimulation; Figure C. Statistics of the change in the spatial distance between HSF1 and NFIL3 after SA stimulation and SA+JQ1 stimulation; Figure D. RT-qPCR detection of the mRNA expression level of NFIL3 under different treatment conditions;

[0026] Figure 10 Figure for the results under item "13" in Example 1, wherein: A. Expression levels of SatIII and NFIL3 in THP-1 cells under different stimulation; B. Schematic diagram of PBMCs isolation, differentiation and in vitro stimulation process; C. Expression levels of SatIII and NFIL3 in PBMCs under HS, LPS, HS+LPS stimulation; D. Expression levels of SatIII and NFIL3 in PBMCs under different temperatures (37℃, 41℃, 41.5℃ and 42℃) + LTA-SA stimulation; E. Changes in the expression levels of inflammatory factors (TNF, IL-1β and IL-8) in PBMCs after knockdown of NFIL3 under HS+LTA-SA stimulation; F. Changes in the expression levels of inflammatory factors (TNF, IL-1β and IL-8) in PBMCs after knockdown of NFIL3 under HS+LPS stimulation;

[0027] Figure 11 Detection results of SatIII molecular marker expression in peripheral blood mononuclear cells of control group and sepsis group patients under item "14" in Example 1;

[0028] Figure 12 Correlation curve of SatIII and NFIL3 expression in peripheral blood mononuclear cells of sepsis patients under item "14" in Example 1;

[0029] Figure 13 Correlation curve of NFIL3 and pro-inflammatory factors (TNF-α, IL-1β, IL-8) expression in peripheral blood mononuclear cells of sepsis patients under item "14" in Example 1;

[0030] Figure 14 ROC curve of Sat III in predicting 28-day mortality risk of sepsis in Example 1 under item "14";

[0031] Figure 15 Comparison of 28-day survival curves between sepsis patients with high expression of Sat III and sepsis patients with low expression of Sat III in Example 1 under item "14";

[0032] Figure 16 Sat III was significantly highly expressed in macrophages (CD68 labeled) in intestinal tissues of sepsis in Example 1 under item "15";

[0033] Figure 17 Results of MhdCas13c detecting Sat III expression level in Example 1 under item "16". DETAILED DESCRIPTION

[0034] The present application will be further described below in conjunction with the accompanying drawings, embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present application and not intended to limit the scope of the present application, and the purpose of providing these embodiments and examples is to make the disclosure of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein, and those skilled in the art can make various modifications or changes without departing from the spirit of the present application, and the equivalent forms obtained thereby also fall within the scope of protection of the present application. In addition, in the following description, a large number of specific details are given in order to provide a more complete understanding of the present application, and it should be understood that the present application can be implemented without one or more of these details.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the specification of the present application herein is only for the purpose of describing the embodiments and examples and is not intended to limit the present application.

[0036] Terminology

[0037] Unless otherwise stated or contradictory, the terms or phrases used herein have the following meanings:

[0038] The selection range of the terms "and / or", "or / and", "and / or" used in the present application includes any one of two or more relevant listed items, and also includes any and all combinations of the relevant listed items, which includes any two relevant listed items, any more relevant listed items, or all relevant listed items. It should be noted that when at least two conjunctions selected from "and / or", "or / and", "and / or" are combined to connect at least three items, it should be understood that in the present application, the technical solution undoubtedly includes the technical solution connected by "logical and", and also undoubtedly includes the technical solution connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C and D (i.e. the technical solution connected by "logical or"), and also includes any and all combinations of A, B, C and D, i.e. includes the combination of any two or any three of A, B, C and D, and also includes the four-item combination of A, B, C and D (i.e. the technical solution connected by "logical and").

[0039] In the present application, "multiple", "various", "multiple times", "multiple" and the like are used without specific limitation, which means greater than or equal to 2 in quantity. For example, "one or more" means one or greater than or equal to two.

[0040] As used herein, "combinations thereof", "any combination thereof", "any combination manner thereof" and the like include all suitable combination manners of any two or more listed items.

[0041] As used herein, "suitable combination manner", "suitable manner", "any suitable manner" and the like mean that the technical solution of the present application can be implemented, the technical problem of the present application can be solved, and the expected technical effect of the present application can be achieved.

[0042] As used herein, "preferably", "better", "better", "as appropriate" only describe the implementation manner or embodiment with better effect, and it should be understood that it does not constitute a limitation on the protection scope of the present application.

[0043] In the present application, "further", "more further", "in particular" and the like are used for description purposes, indicating differences in content, but should not be understood as a limitation on the protection scope of the present application.

[0044] In the present application, "optionally", "optional", "optional" means optional, i.e. selected from two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, and there is no specific description, and there is no contradictory relationship or mutual restriction, each "optional" is independent.

[0045] In the present application, the terms "first", "second", "third", "fourth" and the like in the "first aspect", "second aspect", "third aspect", "fourth aspect" and the like are used only for descriptive purposes, and cannot be construed as indicating or implying relative importance or quantity, nor can they be construed as implicitly indicating the importance or quantity of the technical features indicated. Moreover, "first", "second", "third", "fourth" and the like only serve the purpose of non-exhaustive enumeration and description, and should be understood as not constituting a closed limitation on the quantity.

[0046] In the present application, among the technical features described in an open manner, a closed technical solution consisting of the listed features is also included, as well as an open technical solution containing the listed features.

[0047] In the present application, with respect to a numerical interval (i.e. a numerical range), if no specific description is provided, the optional numerical distribution within the above-mentioned numerical interval is considered to be continuous, and includes the two numerical end points (i.e. the minimum value and the maximum value) of the numerical range, as well as every numerical value between the two numerical end points. If no specific description is provided, when a numerical interval only refers to integers within the numerical interval, including the two end point integers of the numerical range and every integer between the two end points, in this document, it is equivalent to directly listing every integer, for example, t is an integer selected from 1 to 10, which means that t is any integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe a feature or a characteristic, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed in this document should be understood to include any and all sub-ranges encompassed therein.

[0048] In the present application, the temperature parameter, if not specifically limited, allows both constant temperature treatment and variation within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. It is allowed to fluctuate within the range of, for example, ±5°C, ±4°C, ±3°C, ±2°C, ±1°C.

[0049] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0050] All the documents mentioned in the present application are incorporated by reference into the present application as if each document was individually incorporated. The cited documents are incorporated by reference in their entirety, for all purposes, unless and to the extent that the cited documents conflict with the present application, the present application shall control. When the present application refers to the cited documents, the definitions of the relevant technical features, terms, names, phrases, etc. in the cited documents are also incorporated by reference into the present application. When the present application refers to the cited documents, the examples and preferred modes of the relevant technical features cited are also incorporated by reference into the present application, provided that the present application can be implemented. It should be understood that when the cited content conflicts with the description in the present application, the present application shall control or be modified according to the description in the present application.

[0051] In order to overcome the problems existing in the current diagnosis and treatment of sepsis, the purpose of the embodiments of the present application is to provide a long non-coding RNA marker and potential therapeutic target and detection product for sepsis.

[0052] In a first aspect of the embodiments of the present application, an application of a detection reagent for SatⅢ RNA in the preparation of a sepsis detection product is provided.

[0053] SatelliteⅢ (SatⅢ) is a satellite repeat sequence specific to primates, which is mainly located in the pericentromeric region of the chromosome. Under normal circumstances, the location of SatⅢ is a transcriptionally silent heterochromatin region; under some extreme physiological and pathological conditions, the chromatin state of this region is activated, and non-coding SatⅢ RNA mainly composed of GGAAU repeat sequences is transcribed.

[0054] In the present application, the sepsis detection product prepared by using the detection reagent for SatⅢ RNA can effectively distinguish between healthy people and sepsis patients through the detection of SatⅢ RNA. Further, for sepsis patients, the SatⅢ RNA expression level can be detected to divide the sepsis patients into a high expression group and a low expression group to effectively predict the prognosis of the patients.

[0055] In one embodiment, the detection reagent for SatⅢ RNA includes a quantitative detection reagent.

[0056] The application does not particularly limit the type of the Sat III RNA detection reagent, which can achieve effective detection and can make diagnosis and prognosis according to the detection result. In one embodiment, the Sat III RNA detection reagent comprises a specific detection primer pair shown in SEQ ID NO. 129 and SEQ ID NO. 130. In another embodiment, the Sat III RNA detection reagent comprises a targeting probe shown in SEQ ID NO. 3 and / or SEQ ID NO. 4. Optionally, the targeting probe is a fluorescently labeled probe. The application does not particularly limit the type of the fluorescent label on the fluorescently labeled probe, which can be selected from, but is not limited to, cy3 and cy5. In still another embodiment, the Sat III RNA detection reagent comprises MhdCas13c.

[0057] The application does not particularly limit the type of the sample suitable for the sepsis detection product, as long as Sat III RNA is stably present, including but not limited to tissue samples (such as blood samples, intestinal tissue samples, etc.), cell samples (such as peripheral blood mononuclear cells).

[0058] In the second aspect of the application, a sepsis detection product is provided, which comprises the Sat III RNA detection reagent defined in the first aspect.

[0059] The application does not particularly limit the form of the sepsis detection product, which can be a reagent or a kit comprising the Sat III RNA detection reagent defined in the first aspect. It can be understood that the reagent can be packaged separately, ready to use, or partially or completely configured.

[0060] In one embodiment, the sepsis detection product can further comprise other matching detection reagents, and the application does not particularly limit the type of the other matching detection reagents, such as RNA extraction reagents, reverse transcription reagents, fluorescent quantitative reagents, and hybridization reagents, etc.

[0061] The embodiments of the application will be described in detail below with reference to the examples. It should be understood that the examples are only used to illustrate the application and not to limit the scope of the application. The experimental methods not specified in the following examples are preferably referred to the guidance given in the application, and can also be performed according to the experimental manuals or conventional conditions in the art, or according to the conditions suggested by the manufacturers, or according to the known experimental methods in the art.

[0062] In the following specific examples, the measurement parameters of the raw material components may, without specific instructions, have slight deviations within the weighing accuracy range. With respect to temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operation accuracy are allowed.

[0063] Repeat sequences are mainly located in the constitutive heterochromatin region, which is generally transcriptionally silent. When the cell responds to external stimuli, the region activates transcription to produce Sat III and other highly repetitive sequence RNAs. Sat III RNA is a type of RNA containing repetitive sequences, and its DNA is widely present in the human genome, mainly in the 9q12 region of chromosome 9.

[0064] The characteristic of the change in the expression amount of the RNA from nothing to something can be used as a good molecular marker to provide an effective basis for the grouping and precise treatment of diseases such as sepsis.

[0065] The inventors found through long-term research that when the cell responds to external stimuli, Sat III activates transcription, and HSF1, BRD4 and other proteins are assembled into a nucleic stressosome, thereby increasing the openness and transcription level of the surrounding chromatin genes, and NFIL3 is an important downstream gene. As a transcriptional repressor, NFIL3 can effectively regulate the expression of TNF-alpha, IL-1 beta, IL-8 and other pro-inflammatory factors when responding to stimuli, thereby avoiding an inflammatory storm. Further, the inventors found that Sat III is significantly highly expressed in patients with sepsis, and the expression amount of NFIL3 is positively correlated with the expression amount of Sat III, and the corresponding inflammatory factors are negatively correlated, and the prognosis of sepsis patients with high expression of Sat III is better than that of patients with low expression of Sat III. If Sat III is combined with the current sepsis diagnostic standard SOFA score to predict the 28-day mortality risk of sepsis, the accuracy is better than using SOFA score alone.

[0066] The embodiments of the present application are related to the following contents:

[0067] 1. Nanopore third-generation full-length transcriptome sequencing RNA extraction, library construction, third-generation sequencing and analysis, including:

[0068] After HeLa cells stimulated by sodium arsenite (SA, 100 μM, 5h) or heat shock (HS, 42℃, 2h; 37℃, 1h) were added with 1 mL TRIZOL reagent (Invitrogen), and repeatedly blown to lyse the cells. Then 0.2 mL chloroform was added, and after centrifugation, the RNA was in the upper aqueous phase, which was transferred to an RNase-free 1.5 mL EP tube, and an equal volume of isopropanol was added and mixed, then centrifuged, and the RNA formed a sheet-shaped precipitate at the bottom of the tube. After two 75% ethanol rinses, it was air-dried at room temperature, and an appropriate amount of RNase-free water was added to dissolve it. Subsequent library construction and third-generation sequencing and analysis were then performed. For example, Figure 1SatIII is one of the transcripts with the most obvious up-regulation among the transcripts expressed under SA and HS stimulation. SatIII is transcribed widely in the whole genome, and is transcribed in all chromosomes where SatIII DNA is distributed, with the most obvious expression in the 9q12 region, which is consistent with the most abundant distribution of SatIII DNA on chromosome 9.

[0069] 2. SatIII DNA, SatIII RNA and HSF1 protein dynamic observation in living cells

[0070] 2.1 CRISPR-HyperdLbCas12a DNA and CRISPR-dPspCas13b RNA labeling technology in living cells

[0071] HyperdLbCas12a and sgRNA plasmid targeting SatIII DNA were transiently transfected in HeLa cells, and after replacing the culture medium with SA-containing living cell medium, real-time tracking and photographing were performed under structured illumination microscopy (HIS-SIM), and the real-time changes in the volume of SatIII DNA were counted.

[0072] dPspCas13b and gRNA plasmid targeting SatIII RNA were transiently transfected in HeLa cells, and after replacing the culture medium with SA-containing living cell medium, real-time tracking and photographing were performed under structured illumination microscopy (HIS-SIM), and the real-time changes in the volume of SatIII RNA were counted.

[0073] SatIII DNA was labeled by CRISPR-HyperdLbCas12a system in HSF1-mScarlet stable-transfected HeLa cells, and then long-time live cell time-lapse imaging was performed after SA stimulation to observe the changes in the localization of SatIII DNA and HSF1 protein. The specific sgRNA and gRNA sequences are shown in Table 1.

[0074] Table 1

[0075] Detection object Primer name Sequence (5'-3') Number SatIII DNA SatIII-sgRNA-spacer CATGGATTGGAATGGAATGGAAT SEQ ID NO. 1 SatIII RNA SatIII-gRNA-spacer GGTCCATTCCATTCCATTCCAT SEQ ID NO. 2

[0076] 2.2 SatIII DNA FISH

[0077] HeLa cells at different time points after SA stimulation were fixed with 1 mL fixative (900 μL 4% PFA + 100 μL acetic acid) for 10 min, then washed with DPBS for 3 times, 5 min each time. Then Triton permeabilization was added for 5 min, followed by DPBS wash for 3 times, 5 min each time. 2X SSC wash for 5 min for 2 times. Cells were treated with RNase at 37 °C for 1 h. 70% formamide / 2X SS was introduced into a metal bath and heated to 85 °C. Slides were placed in a staining jar at 85 °C for 7 min, then the slides were placed in a pre-cooled 2X SSC glass dish for probe denaturation at 95 °C for 8 min, then placed on ice. Incubate at 37 °C for 12-16 h. 2X SSC wash for 20 min for 2 times; DAPI staining, 4X SSC wash for 10 min for 2 times, mount, and microscopy.

[0078] As shown in Figure 2 , the volume of SatIII DNA increased rapidly after SA stimulation, and the volume increased by nearly 2-fold around 300 min, which might be related to the change of chromatin state and the initiation of SatIII DNA transcription. The results of DNA FISH were consistent with the results of live cell labeling. SatIII RNA transcription started around 100 min after SA stimulation, and then the volume of SatIII RNA increased rapidly. These results showed that SatIII DNA sites located in heterochromatin regions gradually expanded after stimulation, and then a large amount of RNA was transcribed. Within 20 min of SA stimulation, the dispersed HSF1 signals rapidly gathered to SatIII sites, and then the HSF1 protein signals also increased gradually with the gradual increase of SatIII DNA volume, and gradually assembled into mature nuclear stressosome structures.

[0079] 3. SatIII RNA single molecule fluorescence in situ hybridization (smFISH) and HSF1, HAP immunofluorescence staining (IF) results

[0080] 3.1 SatIII RNA single molecule fluorescence in situ hybridization (smFISH)

[0081] SatIII monomolecular fluorescent probe is designed according to Stellaris Probe Designer website and labeled with fluorescent cy3 or cy5 at 3' end. After HeLa cells are stimulated by SA or HS, they are washed twice with DPBS, fixed with fixing solution (4% PFA) at room temperature for 10 min, washed with DPBS for 3 times, each for 5 min, treated with membrane permeation buffer (0.5% Triton X-100, 2mM MgCl2, DPBS) for 5 min, washed with DPBS for 3 times, each for 5 min, washed with 2xSSC+10%formamide (formamide) at room temperature for 2 times, each for 10 min, incubated with probe and chip in a wet box at 37°C for 16 h, washed with 2xSSC+10%formamide at room temperature for 2 times, each for 10 min, stained with DAPI for 2 min, washed with 2xSSC+10%formamide at room temperature for 3 times, each for 5 min, and sealed with Prolong for imaging by fluorescence microscope.

[0082] The sequences of the probes involved in the embodiments of the present application are all the same, and the specific sequences are shown in Table 2.

[0083] Table 2

[0084] Detection object Primer name Sequence (5'-3') Number SatIII SatIII-sm-1 GTTGAATCCATTCCATTGCATTCCATTCAT SEQ ID NO. 3 SatIII SatIII-sm-2 GATTCCAATCCATGCCATTCCAC SEQ ID NO. 4

[0085] 3.2 HSF1, HAP immunofluorescence staining (IF)

[0086] After hybridization, the tissue is blocked with 1% BSA for 1 h, and then incubated with HSF1 primary antibody, HAP primary antibody and fluorescently labeled secondary antibody in turn, each for 1 h at room temperature. Finally, the tissue is washed with DPBS and sealed.

[0087] As shown in Figure 3 , after HS and SA stimulation, SatIII RNA is located in the central region, covered with HSF1 protein in the middle and HAP protein in the periphery.

[0088] 4. Screening of candidate proteins of nuclear stress granules

[0089] Clone 30 candidate protein genes respectively, and construct N-terminal fusion green fluorescent protein target protein expression plasmid, then transiently into HSF1-mScarlet stable HeLa cells, after SA stimulation treatment, observe the structure of the nuclear stress granule in the GE DeltaVision Elite micro-imaging system, finally through the ratio of the diameter of the level of the candidate protein and the diameter of the level of HSF1 (Relative Score = d (candidate protein) / d (HSF1)) to evaluate the relative position relationship of the two proteins, the value more than 1 indicates that the candidate protein is in the relative outer layer of HSF1, and the value less than 1 indicates that the candidate protein is in the relative inner layer of HSF1.

[0090] Among them, HAP, BRD4 and THRAP3 are respectively subjected to live cell super-resolution real-time imaging with HSF1, and the dynamic changes of different level proteins are observed.

[0091] As shown in Figure 3 , different proteins have different relative position relationships with HSF1, that is, different proteins have different positions in the nuclear stress granule, which can be summarized into three categories: (1) the candidate protein is inside the HSF1 ring structure; (2) the candidate protein is in the same ring structure with HSF1; (3) the candidate protein is outside the HSF1 ring structure.

[0092] With the extension of SA stimulation time, HAP, BRD4 and THRAP3 proteins gradually aggregate, and then correspondingly locate on the outside, the same layer and the inside of the HSF1 protein.

[0093] 5. Observation of nuclear stress granule structure changes after ASO knockdown of SatIII

[0094] HeLa cells are plated in a 6-well plate, 3 μg of SatIII ASO is transfected by liposome, and the cells are passaged and plated on an 18 mm x 18 mm coverslip 24 h after transfection. The third day, the cells are subjected to SA stimulation, and then smFISH and IF are performed. The specific steps and conditions are the same as in item “3”.

[0095] As shown in Figure 3 , when SatIII RNA, a key component in the nuclear stress granule, is knocked down by ASO, the hierarchical positioning of HSF1 and HAP proteins tends to be chaotic, and the structure of the nuclear stress granule collapses.

[0096] The specific sequences of SatIII ASO and Scramble ASO are shown in Table 3.

[0097] Table 3

[0098] Detection object Primer name Sequence (5'-3') Number control Scr ASO mA*mA*mU*mG*mG*AATGGAATGGmA*mA*mU*mG*mG* SEQ ID NO. 5 SatIII SatIII ASO mC*mC*mA*mU*mU*CCATTCCATTmC*mC*mA*mU*mU* SEQ ID NO. 6

[0099] 6. Screening of key proteins affecting the ordered hierarchical structure of nuclear stressosome

[0100] A HeLa stable cell line of HAP-BFP / HSF1-Emerald was constructed, and then the previously screened 30 proteins in the nuclear stressosome were knocked down one by one, with 2 shRNAs designed for each protein.

[0101] The specific sequences of shRNA are shown in Table 4.

[0102] Table 4

[0103]

[0104]

[0105]

[0106]

[0107]

[0108] After knocking down, the cells were plated and SatIII smFISH was performed (the specific steps and conditions are the same as in item 3), so there were three colors to represent the different hierarchical positions of the nuclear stressosome. Microscopic imaging was performed and the proportion of structurally abnormal nuclear stressosomes after protein knockdown was calculated. The higher the proportion of structurally abnormal nuclear stressosomes, the more critical the protein is to the ordered hierarchical structure of the nuclear stressosome.

[0109] As shown in Figure 4 , the proportion of structurally abnormal nuclear stressosomes after knocking down THRAP3, HSF2 and BRD4 was the highest, indicating that these three proteins may be more critical to maintaining the ordered hierarchical structure of the nuclear stressosome.

[0110] 7. Effect of JQ1 on BRD4 on nuclear stressosome

[0111] 7.1 Real-time observation of SatIII RNA in live cells after JQ1 inhibits BRD4

[0112] dPspCas13b and gRNA plasmids targeting SatIII RNA were transiently transfected in HeLa cells, and then the live cell culture medium containing SA+DMSO or SA+JQ1 (SA, 100 μM; JQ1, 1.5 μM) was replaced. Real-time tracking and photographing were performed under a structured illumination microscope (HIS-SIM), and the real-time changes in the volume of SatIII RNA in the two different treatment groups were calculated.

[0113] 7.2 Changes in SatIII RNA expression levels after JQ1 inhibits BRD4

[0114] 7.2.1 RNA extraction and reverse transcription

[0115] HeLa cells were plated on 6-well plates and divided into two treatment groups, SA+DMSO and SA+JQ1. At different time points (0, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h) after SA stimulation, 1 mL of TRIZOL was added to collect the cells, and the cells were repeatedly blown until they were completely lysed. Then 0.2 mL of chloroform was added, and after centrifugation, the RNA was in the upper aqueous phase, which was transferred to an RNase-free 1.5 mL EP tube. An equal volume of isopropanol was added, mixed, and centrifuged, and the RNA formed a sheet of precipitate at the bottom of the tube. After two 75% ethanol rinses, it was air-dried at room temperature, and an appropriate amount of RNase-free water was added to dissolve it.

[0116] During reverse transcription, DNase I (Ambion) was used to remove genomic contamination, and then the PrimeScript Reverse Transcription Kit (Takara) was used for reverse transcription to obtain cDNA, which was diluted 3-4 times with ultrapure water and stored at -20°C. The specific DNase I treatment and reverse transcription process is as follows:

[0117] DNase-treated RNA, the reaction system is as follows:

[0118] Table 5

[0119] RNA 0.5 μg DEPC-H2O to 10 μL 10×DNase buffer 1 μL RNase-free DNase 1 μL

[0120] 37°C for 30 min, add 1 μL stop reagent, centrifuge and take the supernatant.

[0121] (2) Reverse transcription, the reaction system is as follows:

[0122] Table 6

[0123] Supernatant 8 μL PrimeScript RT Mix 2 μL

[0124] 37°C for 25 min, 85°C for 5 min.

[0125] 7.2.2 Fluorescence quantitative PCR

[0126] The reaction steps are as follows:

[0127] Using cDNA as a template, the specific PCR primers Sat III-qF and Sat III-qR in Table 8 were used to amplify the DNA fragments to be tested. Real-time quantitative PCR was performed in an ABI real-time PCR instrument, and the reaction system was as follows:

[0128] Table 7

[0129] cDNA template 0.5 μL SatIII-qF / qR 0.8 μL 2×SYBR Green Taq mix 5.2 μL ddH2O 3.5 μL

[0130] Table 8

[0131]

[0132] Reaction conditions are as follows:

[0133] Table 9

[0134]

[0135] Data were analyzed according to 2 -ΔΔCT Methods.

[0136] 7.3 JQ1 inhibits the structural changes of nuclear stress granules after BRD4 inhibition

[0137] HeLa cells were plated on 18 mm x 18 mm coverslips and divided into SA+DMSO and SA+JQ1 groups, followed by smFISH and IF. The specific steps and conditions were the same as those in item 3.

[0138] As shown in Figure 4 , the expression of SatIII was significantly reduced in the JQ1 treatment group, and further staining also observed that the hierarchical structure of nuclear stress granules was significantly changed. These results indicate that BRD4 maintains the ordered hierarchical structure of nuclear stress granules by promoting SatIII transcription.

[0139] 8. Expression of nuclear stress granules in stimulated primary endothelial cells and macrophages

[0140] 8.1 Northern blot

[0141] HEK293FT, AoSMC, AC-16, HUVEC, SH-SY5Y, THP-1, these six cell lines or primary cells, each cell was divided into two groups: untreated group and SA stimulated group, and RNA was extracted. Northern blot was operated according to the Roche DIG Northern Starter Kit instruction. After 3 μg of RNA was prepared, it was denatured at 100°C for 5 min and quickly placed on ice to prevent renaturation; the denatured RNA was electrophoresed on a 1% agarose gel at low temperature at 120V constant voltage for 2h; then the RNA was transferred to a nylon membrane at low temperature at 25V constant voltage for 16h; after the membrane was transferred, 180mJ / cm 2RNA was cross-linked to nylon membrane by UV; pre-hybridization for 3h at 68°C with hybridization buffer; new hybridization buffer was added with 100 ng Dig-labeled probe denatured at 100°C, hybridization at 68°C overnight (more than 16h); 2xSSC+0.1%SDS room temperature for 5min twice; 0.2xSSC+0.1%SDS 68°C for 30min twice; 1xBlocking buffer for 30min; Anti-Dig antibody for 30min; 1xWashing buffer for 15min twice; 1xDetection buffer for 5min; add CDP-Star to the membrane, expose X-ray film in dark room for several minutes and develop.

[0142] 8.2 SatIII smFISH with HSF1 IF

[0143] HUVECs, THP-1 cells, PBMCs were plated on 18mm x 18mm coverslips, stimulated with SA or HS the next day, then SatIII smFISH and HSF1 IF were performed, the detailed steps were the same as item 3.

[0144] As shown in Figure 5 , SatIII expression was induced very obviously in HeLa, HUVEC and THP-1 cells after stimulation, and hierarchical structure of nuclear stress granules could be observed after SA and HS stimulation, which was consistent with the structure in HeLa cells. The staining results in PBMCs suggested that the nuclear stress granules produced after stimulation might be involved in the regulation of immune response.

[0145] 9. TSA-seq & RNA-seq to enrich genes differentially expressed in nuclear stress granules

[0146] 9.1 TSA-seq

[0147] DIG-modified probes targeting SatIII transcripts were incubated with cells for hybridization, then the excess probes were washed away, anti-DIG antibody labeled with HRP was incubated, the excess antibody was washed away and then biotin-phenol (BP) was added, in the presence of H2O2, HRP catalyzed BP to generate biotin-coupled phenoxy radicals, which could be connected to adjacent DNA, thereby labeling adjacent DNA with biotin, finally the DNA was obtained by streptavidin magnetic bead affinity enrichment, and then library construction and sequencing were performed.

[0148] 9.2 RNA-seq

[0149] HeLa cells after sodium arsenite (SA, 100 mM, 5 h) or heat shock (HS, 42 °C, 2 h; 37 °C, 1 h) stimulation were added with 1 mL TRIZOL reagent (Invitrogen) and pipetted repeatedly until the cells were completely lysed. Then 0.2 mL chloroform was added, and after centrifugation, the RNA was in the upper aqueous phase, which was transferred to an RNase-free 1.5 mL EP tube. After adding an equal volume of isopropanol and mixing, the RNA formed a sheet-shaped precipitate at the bottom of the tube. After two 75% ethanol rinses, it was air-dried at room temperature, and an appropriate amount of RNase-free water was added for dissolution. The RNA library was constructed, and second-generation sequencing and analysis were performed.

[0150] 9.3 Detection of gene expression changes after ASO knockdown of SatIII

[0151] The specific steps and conditions of ASO knockdown are the same as those in item “5”. Then RNA was extracted, and RT-qPCR was used to detect gene expression changes. As shown in Table 10, through joint analysis of TSA-seq and RNA-seq data, 46 genes were found to be located near the nuclear stressosome after SA (HS) stimulation and up-regulated in expression. RT-qPCR results showed that in the control group, the corresponding 6 genes were up-regulated after SA or HS stimulation, and the qPCR primers of the genes are shown in Table 10; while in the SatIII knockdown group, the up-regulation trend of these genes was significantly weakened, indicating that the expression of these genes was likely to be regulated by the formation of the nuclear stressosome. Figure 6

[0152] Table 10

[0153]

[0154] 10. Changes in the spatial distance between SatIII-NFIL3 sites before and after stimulation

[0155] 10.1 DNA FISH to statistically analyze the spatial distance between SatIII-NFIL3

[0156] After SA and HS stimulation of HeLa and THP-1 cells, SatIII and NFIL3 dual-color labeling DNA FISH was performed, and the specific steps were the same as those in item “2”. Then the distance changes between the two sites before and after stimulation were statistically analyzed.

[0157] 10.2 Live cell labeling of SatIII and NFIL3 sites and statistical analysis of spatial distance

[0158] The CRISPR-HyperdLbCas12a system and the CRISPR-dCas9 system were used to label SatIII and NFIL3 sites in live cells, respectively, and the distance changes between the two sites before and after stimulation were statistically analyzed.​

[0159] 10.3 ATAC-seq analysis of chromatin opening changes in THP-1 cells after stimulation

[0160] ATAC-seq was performed in THP-1 cells after SA and HS stimulation to analyze changes in chromatin accessibility.

[0161] like Figure 7 As shown, after stimulation by HS and SA, the spatial distance between the two sites became closer, suggesting that the enlargement of the SatIII DNA site after stimulation may lead to a closer relative spatial relationship with neighboring genes, further affecting the chromatin openness of the genes. The chromatin of the NFIL3 site was significantly open, which is consistent with the upregulation of NFIL3 transcription after stimulation.

[0162] 11. Transcription factor HSF1 binds to BRD4 at the NFIL3 promoter.

[0163] 11.1 HSF1 / BRD4 Chromatin Immunoprecipitation (CHIP) qPCR

[0164] Cells were divided into two groups: control 1 and SA stimulation group, each group of 2 10cm dishes with 90% confluency, washed twice with DPBS; cross-linked with 1% formaldehyde for 5min at room temperature, quenched with 0.25M glycine for 5min at room temperature; washed twice with DPBS; collected and resuspended in 1 mL ChIP buffer (1% Triton X-100, 0.1% sodium deoxycholate, 50mM Tris pH 8.0, 150mM NaCl, 5mM EDTA, 1mM PMSF, protease inhibitor cocktail); cells were broken by contact sonication to fragment DNA to 300-500bp; centrifuged for 15min (4°C, 17000g), and 100μL supernatant was taken as Input DNA; the rest of the supernatant was added with 10μL protein G Dynabeads and incubated at 4°C for 30min; removed Dynabeads, and the supernatant was equally divided into two parts, added with 2μg ATF2 (or p71-ATF2) antibody or rabbit IgG and 20μL protein G Dynabeads; incubated at 4°C overnight; washed once with ChIP buffer, high salt ChIP buffer (1% Triton X-100, 0.1% deoxycholate, 50mM Tris pH 8.0, 500mM NaCl, 5mM EDTA), LiCl wash buffer (0.25M LiCl, 0.5% Igepal, 0.5% deoxycholate, 10mM Tris pH 8.0, 1mM EDTA) each for 5min at 4°C; washed twice with lx TE buffer (10mM Tris pH 8.0, 1mM EDTA) for 5min at low temperature; eluted with 200μL ChIP elution Buffer (1% SDS, 0.1M NaHCO3) for 20min at room temperature; added with 200mM NaCl and incubated at 65°C for 4h for de-cross-linking; added with 10mM EDTA and 0.5μg / μL proteinase K and incubated at 55°C for 2h; extracted DNA with phenol chloroform and subjected to further detection.

[0165] 11.2 Dual luciferase reporter assay

[0166] shRNA knockdown cells and control cells were pre-plated in 96-well plates, each well was transfected with 100 ng pGL3-NEAT1-promoter and 10 ng Renilla luciferase vector using lipofectamine, 24 h after transfection, the Dual-Gloluciferase assay system (Promega) kit was used for detection, and Renilla luciferase activity was used as an internal reference for correction in the analysis.

[0167] 11.3 RT-qPCR detection of NFIL3 expression level

[0168] BRD4 and HSF1 shRNA knockdown cells and control cells were pre-plated in 6-well plates, and the cells were divided into two groups: control group and SA stimulation group, and then RNA was extracted to detect NFIL3 expression. The detection system and procedure refer to Table 7 and Table 9, and the detection primers are shown in Table 11.

[0169] Table 11

[0170]

[0171] As shown in Figure 8 , the two transcription factors HSF1 and BRD4 bind to the NFIL3 promoter region, and the binding is significantly enhanced after SA stimulation. After HSF1 or BRD4 knockdown, the expression of NFIL3 in the two knockdown groups is also reduced compared with the control cells, and this trend is more obvious after SA stimulation. These data show that the transcription factors HSF1 and BRD4 effectively bind to the NFIL3 promoter after stimulation, promoting its transcription.

[0172] 12. Effect of inhibiting the transcriptional regulation of BRD4 NFIL3

[0173] 12.1 BRD4 inhibits the relationship between nuclear stressosome and NFIL3 position change

[0174] The NFIL3 site in HSF1-mScarlet stable HeLa cells was labeled with the CRISPR-HyperdLbCas12a system, and the change in the spatial distance between HSF1 and NFIL3 was counted after SA stimulation and SA+JQ1 stimulation.

[0175] 12.2 BRD4 inhibition RT-qPCR detection of NFIL3 expression

[0176] HeLa cells were pre-plated in 6-well plates, and the cells were divided into four groups: UN+DMSO, UN+JQ1, SA+DMSO and SA+JQ1, and then RNA was extracted to detect NFIL3 expression. The detection system and procedure refer to Table 7 and Table 9, and the detection primers are shown in Table 11.

[0177] As shown in Figure 9 After SA stimulation, about 74% of NFIL3 sites interacted with the nuclear stressosome in space. Further treatment with JQ1, HSF1 morphology was more condensed, the three-dimensional spatial distance between HSF1 and NFIL3 sites increased, and qPCR detection of NFIL3 mRNA levels was also significantly down-regulated.

[0178] 13. Nuclear stressosome inhibits excessive inflammation activation through NFIL3

[0179] 13.1 SatIII and NFIL3 expression in sepsis cell model

[0180] In THP-1 cells and PBMCs, LPS, LTA-SA, Pam3Csk4 and Salmonella were added to the basis of HS stimulation to detect SatIII and NFIL3 expression.

[0181] In PBMCs, a temperature gradient of 37°C, 41°C, 41.5°C, and 42°C was set for stimulation, and then LTA-SA stimulation was sequentially combined, followed by RT-qPCR detection of SatIII and NFIL3 expression.

[0182] 13.2 Expression level of inflammatory factors after NFIL3 inhibition in sepsis cell model

[0183] In PBMCs, 3μg of NFIL3 siRNA was transfected using liposomes, the specific sequence of siRNA is shown in Table 12, and after 24h of transfection, the cells were stimulated with HS+LPS or HS+LTA-SA, followed by RT-qPCR detection of NFIL3 and inflammatory factors TNF-α, IL-1β, and IL-8 expression levels. The detection system and procedure are referred to Tables 7 and 9, and the detection primers are shown in Table 13.

[0184] Table 12

[0185]

[0186] Table 13

[0187]

[0188] As shown in Figure 10As shown in the THP-1 cells, the expression of SatIII and NFIL3 showed a tendency to increase on the basis of HS stimulation with the addition of PAMPs and Salmonella, and the same conclusion was consistent in PBMCs. The expression of SatIII gradually increased with the increase of temperature, and the expression of NFIL3 also increased accordingly. Knockdown of NFIL3 significantly increased the expression of pro-inflammatory factors TNF, IL-1β and IL-8, and these data indicated the important role of nuclear stressosome in inhibiting excessive inflammatory activation through NFIL3.

[0189] 14. Clinical detection results of SatIII, NFIL3, TNF-α, IL-1β and IL-8 expression in peripheral blood mononuclear cell samples of normal people and sepsis patients using the above specific PCR primers

[0190] The present application obtained 20 normal people and 59 sepsis patients from Changhai Hospital. The above all samples were obtained with the consent of the test subjects and were approved by the ethics committee. Peripheral blood mononuclear cells were obtained by density gradient centrifugation, and subsequent RT-qPCR detection was performed, and the steps and conditions were the same as in item "7".

[0191] As can be seen from Figure 11 , the expression of SatIII in peripheral blood mononuclear cells of sepsis patients was significantly higher than that of normal people. Using independent sample t-test (t-test), the P value was less than 0.05, which proved to have significant difference.

[0192] As shown in Figure 12 , Figure 13 , the expression of SatIII in peripheral blood mononuclear cells of sepsis patients was positively correlated with NFIL3, and was negatively correlated with inflammatory factors TNF-α, IL-1β and IL-8, suggesting that the expression of SatIII was negatively correlated with the level of inflammation.

[0193] As shown in Figure 14 , the receiver operating characteristic curve (ROC curve) of SatIII was used as the test subject, and the area under the curve (AUC) was 0.701. SatIII was combined with the existing sepsis evaluation standard SOFA score (AUC: 0.856), which was higher than the use of SOFA score alone (AUC: 0.775). It was shown that SatIII RNA as a marker would help to improve the diagnostic sensitivity and diagnostic specificity of identifying sepsis through peripheral blood mononuclear cell samples.

[0194] As shown in Figure 15As shown, based on the expression level of SatIII, patients with sepsis were divided into a high SatIII expression group (expression level >2) and a low SatIII expression group (expression level ≤2). Comparison of the 28-day survival curves revealed that the high SatIII expression group had better survival outcomes.

[0195] 15. Results of single-molecule fluorescence in situ hybridization (smFISH) and CD68 immunofluorescence staining (IF) of SatIII RNA from intestinal tissues of patients with sepsis.

[0196] 15.1 SatIII RNA Single-Molecular Fluorescence In Situ Hybridization (smFISH)

[0197] This application obtained intestinal tissue from six patients with sepsis at Changhai Hospital. All specimens were obtained with the consent of the subjects and approved by the ethics committee. Formaldehyde-fixed small intestinal tissue was embedded in OCT, and sections with a thickness of 6–8 μm were prepared. The sections were treated with 0.5% Triton permeabilization buffer for 10 min, then with 10% formamide / 2×SSC for 10 min, and finally hybridized overnight at 37°C with a fluorescently labeled (Cy3) SatIII probe.

[0198] 15.2 CD68 Immunofluorescence Staining (IF)

[0199] After hybridization, the tissue was blocked with 1% BSA for 1 hour, and then incubated sequentially with CD68 primary antibody (Cell Signaling Technology) and fluorescently labeled secondary antibody at room temperature for 1 hour each; finally, it was washed with DPBS and mounted.

[0200] like Figure 16 As shown, SatIII RNA exhibits significant punctate aggregation in CD68-labeled macrophages, indicating high expression of SatIII RNA in macrophages derived from intestinal tissue of patients with sepsis.

[0201] These results indicate that SatIII is significantly overexpressed in monocytes of patients with sepsis. SatIII RNA, as a biomarker, will help improve the diagnostic sensitivity and specificity of sepsis identification using peripheral blood monocyte samples.

[0202] 16. MhdCas13c detection of SatIII expression levels

[0203] HeLa cells were divided into four groups: Control, cell control (cells were not stimulated by SA / HS), SA stimulation group (SA) and HS stimulation group (HS), and DNase digestion after RNA extraction. The MhdCas13c system was used to detect fluorescence values: the reporter RNA was pre-labeled with a 6-FAM fluorescent group at the 5' end and a BHQ-1 quencher group at the 3' end (synthesized by Jinisi Company), and then different components (SatIII-gRNA sequence reference Table 15) were added according to Table 14:

[0204] Table 14

[0205] gRNA / MhdCas13c complex 200 nM Total RNA 500 ng Reporter RNA 66.7 nM Cleavage buffer 40 mM Tris-HCl (PH 7.4), 10 mM MgCl2 ddH2O To 60 μL

[0206] Table 15

[0207] Detection object Primer name Sequence (5'-3') Number SatIII SatIII-gRNA-2 GTTGAATCCATTCCATTGCATTCCATTCAT SEQ ID NO. 153

[0208] The fluorescence change of the substrate was detected by a multifunctional microplate detector (BioTek SynergyNEO) (excitation light: 490 nm; emission light: 520 nm), and read every 5 min for about 90 min.

[0209] As shown in Figure 17 , the HS stimulation group and the SA stimulation group have obvious fluorescence curves, while in the cell control group and the blank control group, the fluorescence signal is basically at the baseline, indicating that MhdCas13c can effectively detect the expression amount of SatIII through fluorescence detection.

[0210] Overall, SatIII RNA can be used as a molecular marker for sepsis. Such RNA markers are not only stable, minimally invasive, easy to detect, but also accurate in quantification. These characteristics will improve the sensitivity and specificity of sepsis detection and treatment, and further provide effective diagnostic basis for sepsis patient subgroups and precision treatment. The RNA detection reagent is a specific primer pair. The RNA detection reagent has the advantages of specificity, sensitivity, rapidness and simplicity.

[0211] Each technical feature of the above-described embodiments and examples can be combined in any suitable manner. In order to make the description concise, not all possible combinations of the technical features in the above-described embodiments and examples are described, however, as long as the combination of the technical features does not exist contradictory, it should be considered within the scope of the present disclosure.

[0212] The above-described embodiments only express several implementation manners of the present application, facilitate specific and detailed understanding of the technical solutions of the present application, but cannot be understood as a limitation on the patent protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. In addition, it should be understood that, after reading the above teaching content of the present application, the skilled person in the art can make various modifications or modifications to the present application, and the equivalent forms obtained are also within the protection scope of the present application. It should also be understood that, on the basis of the technical solutions provided by the present application, the skilled person in the art obtains the technical solutions through logical analysis, reasoning or limited experiments, and all of them are within the protection scope of the appended claims of the present application. Therefore, the protection scope of the patent of the present application should be based on the content of the appended claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. Application of SatIII RNA detection reagents in the preparation of sepsis detection products.

2. The application according to claim 1, characterized in that, The detection reagents for SatⅢ RNA include quantitative detection reagents.

3. The application according to claim 2, characterized in that, The detection reagent for the SatⅢ RNA includes the specific detection primer pairs shown in SEQ ID NO. 129 and SEQ ID NO.

130.

4. The application according to claim 2, characterized in that, The detection reagent for SatⅢ RNA includes the targeting probe shown in SEQ ID NO. 3 or / and SEQ ID NO. 4; optionally, the fluorescent label on the targeting probe includes either cy3 or cy5.

5. The application according to claim 2, characterized in that, The detection reagent for SatⅢ RNA includes MhdCas13c.

6. The application according to any one of claims 1 to 5, characterized in that, The sepsis detection product is used to detect tissue or cell samples.

7. The application according to claim 6, characterized in that, The tissue sample is a blood sample or an intestinal tissue sample.

8. The application according to claim 6, characterized in that, The cell sample included peripheral blood mononuclear cells.

9. A sepsis detection product, characterized in that, The sepsis detection product includes: a detection reagent for SatⅢ RNA as defined in any one of claims 1 to 8.

10. The sepsis detection product according to claim 9, characterized in that, The sepsis detection product also includes one or more of the following: RNA extraction reagent, reverse transcription reagent, quantitative fluorescence reagent, and hybridization reagent.