Application of folliclostatin in treatment of inflammatory bowel disease
By blocking the interaction between activin A and its receptor through follicle-stabilizing hormone (FST), the problem of insufficient efficacy and high safety risks in IBD treatment has been solved, achieving significant improvement in colitis symptoms and synergistic improvement in multiple indicators, and has clinical translation potential.
Patent Information
- Application Number
- CN202511437817.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-10
- Publication Date
- 2025-12-12
AI Technical Summary
Current treatments for IBD have insufficient efficacy and high safety risks. There is a lack of specific treatment strategies targeting activin A, and the application value of follicle-stimulating hormone in IBD treatment has not been fully recognized.
Using follicle-staphylin (FST) as a high-affinity neutralizer of activin A, various dosage forms of the drug were prepared to block the interaction between activin A and its receptor, intervene in acute and chronic colitis models, inhibit enteritis-related inflammatory molecules, improve mesenteric fat quality, and reduce Th17 cell levels.
It significantly improves symptoms of acute and chronic colitis, has a high safety profile, and shows synergistic improvement across multiple dimensions, demonstrating its potential for clinical translation. This confirms the therapeutic efficacy of FST by antagonizing the activator A-Th17 axis.
Smart Images
Figure CN121102444A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the application of follicle-stimulating hormone in the treatment of inflammatory bowel disease, and belongs to the field of biomedical technology. Background Technology
[0002] Inflammatory bowel disease (IBD) is a group of nonspecific, chronic, relapsing inflammatory bowel diseases of unknown etiology, primarily including ulcerative colitis (UC) and Crohn's disease (CD). Its clinical manifestations include abdominal pain, diarrhea, bloody stools, and weight loss. The disease is protracted and difficult to cure, with alternating periods of relapse and remission, and can lead to complications such as intestinal fistulas, strictures, and even cancer, placing a heavy physical and psychological burden on patients. Models suggest that the global burden of IBD is rapidly increasing, especially in newly industrialized countries like China, where the incidence rate is projected to double every decade, making it a serious public health problem.
[0003] Current clinical management strategies for IBD still face significant challenges. Traditional drugs such as aminosalicylate, glucocorticoids, and immunosuppressants often show insufficient efficacy or no response in moderate to severe patients. Although subsequent developments in biologics (such as anti-TNF-α monoclonal antibodies) and small molecule drugs (such as JAK inhibitors and S1P receptor modulators) have partially improved clinical outcomes, there are still safety risks such as primary non-response, secondary loss of response, and potential infection and thrombosis, indicating that there is still a large unmet treatment need in clinical practice.
[0004] Recent studies have revealed that activin A—an important member of the transforming growth factor-β (TGF-β) superfamily—plays a crucial role in the pathogenesis of intestinal inflammatory bowel disease (IBD). Activin A expression is significantly upregulated in the inflamed intestinal tissues of IBD patients and animals with experimental colitis, and its levels are positively correlated with disease severity. Activin A exacerbates the intestinal immune inflammatory response by promoting the release of pro-inflammatory factors, disrupting the integrity of the intestinal epithelial barrier, and particularly inducing the differentiation of pathogenic Th17 cells. However, specific therapeutic strategies targeting this key target are currently lacking.
[0005] Follicle-stabilizing factor (FST) is an endogenous secretory glycoprotein that acts as a high-affinity neutralizer of activin A, specifically binding to activin A and blocking its interaction with its receptor. Studies have shown that FST effectively neutralizes the biological activity of activin A by forming a stable, inactive complex with its specific domains. Although the functions of FST in areas such as muscle metabolism and embryonic development have been extensively studied, its direct application value in the treatment of IBD has not been fully recognized and developed. Currently, there is a lack of systematic evidence to prove: 1) the clear therapeutic efficacy and dose-response relationship of exogenous FST protein in acute and chronic colitis models; 2) its mechanism of action and its direct association with antagonizing local intestinal activin A signaling and correcting Th17 immune imbalance; and 3) its feasibility and advantages as a monotherapy for IBD.
[0006] In summary, given the urgent clinical needs for IBD and the limitations of existing therapies, this invention, based on a deep understanding of the "FST-activin A-Th17 cell" axis, proposes and validates a novel strategy for the direct application of recombinant FST protein to treat colitis, providing a solid basis for the development of a novel, efficient, and stable protein drug. Summary of the Invention
[0007] The purpose of this invention is to solve the technical problem of how to apply follicle-staphylin (FST) in the treatment of inflammatory bowel disease.
[0008] To achieve the objectives of this invention, the present invention provides the application of follicle-staphylin (FST) in the preparation of drugs for treating acute inflammatory bowel disease.
[0009] This invention provides the application of follicle-staphylin (FST) in the preparation of drugs that inhibit myeloperoxidase.
[0010] This invention provides the application of follicle-staphylin (FST) in the preparation of drugs that inhibit inflammatory molecules associated with enteritis.
[0011] This invention provides the application of follicle-staphylin (FST) in the preparation of drugs for treating chronic inflammatory bowel disease.
[0012] This invention provides the application of follicle-staphylin (FST) in the preparation of a drug that improves the quality of mesenteric fat in patients with inflammatory bowel disease.
[0013] This invention provides the application of follicle-staphylin (FST) in the preparation of a drug for treating inflammatory bowel disease by blocking the Th17-inducing effect of activin A.
[0014] This invention provides the application of follicle-staphylin (FST) in the preparation of a drug that reduces the level of Th17 cells in patients with inflammatory bowel disease.
[0015] This invention provides the application of activator A-Th17 axis as a target in the preparation of drugs for treating inflammatory bowel disease.
[0016] Preferably, the dosage form of the above-mentioned drug includes tablets, powders, granules, capsules, oral liquids, injections, or sustained-release formulations.
[0017] This invention provides a treatment system for inflammatory bowel disease, the treatment system comprising: a medication system; the medication system containing follicle-stimulating hormone (FST).
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] 1. This invention discloses the "FST-activator A-Th17" axis as a new therapeutic target for IBD.
[0020] 2. This invention not only confirms the therapeutic effect of FST, but also elucidates the molecular mechanism by which it works through the "antagonism of the activator A-Th17 axis", providing a solid theoretical basis for clinical application.
[0021] 3. Significant therapeutic effect: FST showed significant therapeutic effect in both acute and chronic colitis models.
[0022] 4. High safety: FST is an endogenous protein with low expected immunogenicity and good safety.
[0023] 5. It has high potential for clinical translation, with animal and clinical human studies showing consistent progress, and multiple indicators showing synergistic improvement, demonstrating strong operability and translational feasibility. Attached Figure Description
[0024] Figure 1 The figure shows the experimental results of how FST can improve acute colitis in mice.
[0025] Figure 2 The figure shows the experimental results of how FST can improve chronic colitis in mice.
[0026] Figure 3 The figure shows the experimental results of significantly elevated activin A expression levels in colitis.
[0027] Figure 4 This is a diagram showing the experimental results of FST treating enteritis by blocking the Th17-induced effect of activin A. Detailed Implementation
[0028] To make the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings:
[0029] The materials and methods involved in the embodiments are as follows:
[0030] 1. Experimental materials:
[0031] 1.1 Patient data and biological samples
[0032] The patient data used in these examples are all derived from microarray or sequencing data in the GEO public database. Database address: https: / / www.ncbi.nlm.nih.gov / geo /
[0033] Colonic biopsies were obtained from patients who underwent endoscopic biopsies at the Department of Gastroenterology or Endoscopy Center of Zhongshan Hospital affiliated with Fudan University between January and December 2024 and were diagnosed with or suspected of having Crohn's disease or ulcerative colitis. All samples were paired, with one sample taken from the mucosal area of the subject with abnormal appearance (such as ulcers or inflammatory polyps), and the other from the normal mucosal area near the aforementioned lesions of the same patient.
[0034] The criteria for sample inclusion and exclusion are as follows:
[0035] 1) The case has undergone pathological biopsy as required above;
[0036] 2) The final diagnosis of the case was ulcerative colitis or Crohn's disease, and there were no other known coexisting gastrointestinal diseases;
[0037] 3) The patient had no history of malignant tumors or abdominal radiation therapy;
[0038] 4) The lesion in the case did not involve the entire digestive tract, that is, there was a normal-looking mucosa area adjacent to the target area.
[0039] All patients selected for inclusion in this study have signed relevant informed consent forms, and the study protocol has been approved by the Ethics Committee of Zhongshan Hospital affiliated to Fudan University.
[0040] 1.2 Laboratory Animals
[0041] The experiments primarily used 7-8 week old male C57BL / 6J mice, all purchased from Shanghai Southern Model Biotechnology Co., Ltd., and housed in the pathogen-free animal housing area of the Department of Laboratory Animal Science, Fudan University. The housing facilities were equipped with a temperature-controlled and humidity-controlled environment to provide comfortable growth conditions. Mice feed met SPF standards and was regularly changed to maintain freshness. Drinking water was treated through a sterile filter to ensure sterility, and the waterers were kept clean and changed regularly. The light cycle simulated natural day-night cycles, generally using a 12-hour light / 12-hour dark cycle. The animal experimental protocol was approved in advance by the Animal Ethics Committee of Zhongshan Hospital affiliated with Fudan University and was conducted in accordance with laboratory animal care and usage guidelines.
[0042] 1.3 Cells
[0043] 1.3.1 Mouse mononuclear macrophages RAW264.7
[0044] The mouse mononuclear macrophages RAW264.7 used in the experiment were purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences / Chinese Academy of Sciences Type Culture Collection Committee. The cells were identified by STR and cultured at 37℃ in a 5% CO2 cell culture incubator.
[0045] 2. Experimental Methods
[0046] 2.1 Establishment and treatment of mouse colitis model
[0047] 2.1.1 Acute Model
[0048] An acute colitis model was induced in C57BL / 6J mice using dextran sulfate sodium (DSS). A 4% DSS solution was prepared by dissolving an appropriate amount of DSS in sterile water. At the start of modeling, the drinking water of mice in both the DSS and FST groups was replaced with a solution containing 4% DSS, changing it every two days to ensure free access to the DSS solution throughout the experiment. On Day 7, the solution was replaced with regular sterile water for continued feeding. The general condition of the mice, such as weight changes and fecal characteristics, was monitored daily. For treatment, on Days 3 and 5, mice in the FST group received an intraperitoneal injection of 200 ng / g body weight of FST, while the DSS group received an equal volume of phosphate-buffered saline (PBS).
[0049] 2.1.2 Chronic Model
[0050] A chronic colitis model was induced in C57BL / 6J mice using DSS. A 2% DSS solution was prepared by dissolving an appropriate amount of DSS in sterile water. The drinking water of mice in both the DSS and FST groups was replaced with the 2% DSS solution every two days to ensure access to DSS throughout the experiment. On Day 7, the water was replaced with regular sterile water, and the mice were allowed free access to water for two weeks. On Day 21, the drinking water was again replaced with the 2% DSS solution every two days. On Day 28, the water was replaced with regular sterile water again, and the mice were allowed free access to water for another two weeks. On Day 42, the drinking water was replaced with the 2% DSS solution again, continuing until Day 49, after which the water was replaced with regular sterile water for three days. The general condition of the mice, such as weight changes and fecal characteristics, was monitored daily. For treatment, on the third day of each DSS cycle, mice in the FST group received an intraperitoneal injection of 200 ng / g body weight of FSS, while mice in the DSS group received an equal volume of PBS. The experiment was terminated on Day 52, and all mice were euthanized and samples were collected in accordance with ethical procedures.
[0051] 2.2 Assessment of the severity of colitis
[0052] The severity of colitis is assessed using the classic Disease Activity Index, with a total score of 0-4. The scoring items are shown below:
[0053] score Percentage of weight loss fecal viscosity Blood in stool 0 0％-1％ normal none 0.5 1％-5％ Soft stools / perianal dampness Slight bloodstains 1 5％-10％ Loose, pasty stool / feces covering the anus Fresh blood in stool / bloodstains around the anus 1.5 10％-20％ / / 2 >20％ / /
[0054] 2.3 Mouse Tissue Sampling
[0055] After euthanizing the mice, they were fixed on a control panel. The abdominal cavity was opened with scissors and forceps, and the entire colon was carefully removed, severing it at the ileocecal junction and anus. If the intestinal contents did not need to be extracted in subsequent steps, the colon was temporarily placed in a culture dish containing PBS, and the dish was placed on ice. After collecting colon samples from all mice, photographs were taken for documentation. After photographic documentation, the colon was dissected or cut into the required size pieces according to experimental needs. The colon was gently rinsed with PBS to remove residual blood and feces. After rinsing, the colon was either fixed with 4% paraformaldehyde or transferred to cryovials and stored in liquid nitrogen. Detailed information for each sample was recorded, including the mouse number and the date of collection.
[0056] 2.4 Tissue embedding and sectioning
[0057] Fresh tissue was immersed in 4% paraformaldehyde for at least 24 hours. The tissue was then removed from the fixative, cleaned, and cleaned of impurities. The target area was then trimmed. After trimming, the tissue was placed in a dehydration box and rinsed to remove the fixative. It was then dehydrated with a series of alcohols and embedded in paraffin wax. The wax-soaked tissue was embedded in an embedding machine. After solidification, the wax block was removed from the embedding frame and placed on a paraffin microtome for sectioning, setting the section thickness to 3 μm. The sections were floated on a slide and flattened in 42°C warm water. The tissue was then lifted onto a glass slide and placed in a 60°C oven to bake until the paraffin wax melted. The sections were then removed and stored at room temperature for later use.
[0058] 2.5 Histochemical staining / fluorescent staining
[0059] 2.5.1 HE staining: Place the sections on a slide holder and heat in a 50℃ oven for 2 hours. Dewax the paraffin sections to hydration using the following density gradient: xylene-I 15 min; xylene-II 15 min; anhydrous ethanol-I 10 min; anhydrous ethanol-II 5 min; 95% ethanol 5 min; 90% ethanol 5 min; 80% ethanol 5 min; 70% ethanol 5 min; finally rinse with distilled water. Circle the target area with a histochemical pen, place horizontally in a humidified chamber, add hematoxylin for staining for 5 min, then rinse with pure water for 3 min, repeat three times; differentiate with 1% hydrochloric acid alcohol for a few seconds, rinse for 5 min, add 1% ammonia for blue reversion, and rinse with running water. Add eosin staining solution, stain for 5 min, rinse under running water for 3 min, repeat three times. Return the slides to the slide holder and sequentially immerse them in 95% ethanol-II for 15 min; anhydrous ethanol-I for 10 min; anhydrous ethanol-II for 5 min; and xylene-III for 5 min to dehydrate and clear them. Remove the slides from the xylene and allow them to dry slightly. Add a drop of neutral resin and mount with a coverslip. Examine the slides under a microscope and then use a scanner to acquire and analyze the images.
[0060] 2.5.2 AB-PAS Staining: Dewaxing and Hydration. Using a histochemical pen, draw a circle around the target area, place horizontally in a humidified chamber, add a few drops of Alcian Blue, and incubate for 10 min. Wash with distilled water for 3 min, repeating 3 times. Slightly dry the section, add hydrogen peroxide solution to the circled area for oxidation for 5 min. Wash with distilled water for 3 min, repeating 3 times. Add Schefflera stain and incubate for 15 min, then rinse with pure water for 10 min. Next, add sodium sulfite for differentiation for 2 min, then rinse with pure water for 15 min. Add hematoxylin, counterstain for 2 min, then rinse with pure water for 3 min, repeating 3 times. Add hydrochloric acid alcohol for differentiation, and allow the solution to return to blue. Mount and examine under a microscope.
[0061] 2.5.3 Immunofluorescence: Dewaxing and hydration. After thorough hydration, add 250 mL of antigen retrieval solution to the histochemistry chamber, microwave (boil on high for 5 min, then simmer on low for 30 min), and then cool to room temperature. Wash with TBST for 5 min, repeat twice. Draw a circle around the target area using a histochemistry pen, place horizontally in a humidified chamber, add hydrogen peroxide solution to inactivate endogenous enzymes, and incubate in the dark for 15 min. Wash with TBST for 5 min, repeat three times. Slightly dry the sections, prepare 5% BSA, add it to the circle to fully cover the tissue, and block at room temperature for 1 h. Dilute the primary antibody with 5% BSA, add the diluted primary antibody, and incubate overnight at 4°C in the dark. The next day, remove the sectioning chamber from the refrigerator, equilibrate the sections to room temperature, discard the incubation solution, wash with TBST for 5 min, repeat three times. Add fluorescent secondary antibody to fully cover the histochemistry circle and incubate in the dark for 1 h, wash with TBST for 5 min, repeat three times. Add DAPI and incubate in the dark for 15 minutes, then wash with TBST for 5 minutes. Repeat three times. After the sections have dried slightly, mount them with an anti-fluorescence quencher, taking care to avoid air bubbles. Examine under a microscope, then use a scanner for image acquisition and analysis.
[0062] 2.6 Histochemical IRS score
[0063] 1) Positive cell percentage score: The score is based on the percentage of positive cells, and is divided into five levels: 0 (<1%), 1 (1-10%), 2 (11-50%), 3 (51-80%) and 4 (>80%).
[0064] 2) Staining intensity rating: The staining intensity is rated according to the staining intensity and is divided into four levels: 0 (no staining), 1 (weak staining), 2 (medium staining) and 3 (strong staining).
[0065] 3) Calculate the IRS score: Multiply the percentage of positive cells score and the staining intensity score to obtain the final IRS score for each sample.
[0066] 2.7 Western Blot Detection
[0067] Tissue samples were collected in 1.5 mL centrifuge tubes and lysed thoroughly using a tissue lysis buffer supplemented with protease / phosphatase inhibitors to extract proteins. The samples were then allowed to stand briefly on ice to defoam, centrifuged, and the supernatant was collected. Loading buffer was added, and the mixture was boiled for 25 min, then cooled to room temperature. An appropriate concentration of SDS-PAGE gel was prepared. After the gel solidified, the SDS-PAGE gel was placed in the electrophoresis tank, the comb was removed, protein markers and samples were loaded, and electrophoresis was performed. The voltage was adjusted to 70 V, and after bromophenol blue passed the stacking gel interface, the voltage was adjusted to 120 V to separate the proteins according to size. The gel was removed from the tank, and a transfer sandwich was constructed in transfer buffer. The separated proteins were transferred to a polyacrylamide membrane using a transfer apparatus. The sandwich was removed, and the membrane was transferred to 5% BSA or 10% skim milk powder and placed on a low-speed shaker at room temperature for at least 1 h to block non-specific binding. The membrane was simply rinsed with TBST, then placed inside a cut PE glove. Target region bands were cut according to the size of the target protein. Antibody of appropriate concentration was prepared using antibody dilution buffer, and the membrane was incubated overnight at 4°C. The next day, the incubation solution was discarded or recovered. The membrane bands were washed with TBST solution on a shaker for 10 min, repeated three times, to remove unbound primary antibody. Secondary antibody of the corresponding species was prepared and incubated at room temperature for 1 h. The membrane bands were then thoroughly washed with TBST solution for 10 min, repeated three times, to remove unbound secondary antibody. Chemiluminescence was initiated by adding chemiluminescence solution to the chemiluminescence analyzer, and the results were recorded.
[0068] 2.8 MPO (myeloperoxidase) activity assay
[0069] Prepare reagents one through seven according to the kit instructions. Accurately weigh 50 mg of colon tissue and add it to the prepared reagent two solution at a weight-to-volume ratio of 1:19. Use a tissue homogenizer to prepare a 5% tissue homogenate. Take 180 μL of the above tissue homogenate and place it into two new centrifuge tubes. Add 20 μL of reagent three to each tube and label them as control and experimental tubes, respectively. Mix thoroughly and incubate at 37°C for 15 min. Add 200 μL of reagent four to each tube. Then add 3 mL of double-distilled water to the control tube and 3 mL of chromogenic reagent to the experimental tube. Mix well and incubate at 37°C for 30 min. Add 50 μL of reagent seven to each tube, invert and mix. Incubate at 60°C for 10 min. After incubation, transfer the liquid to a 96-well plate and measure the absorbance at 460 nm using a microplate reader.
[0070] 2.9 RNA Extraction and Reverse Transcription
[0071] Weigh an appropriate amount of tissue into a 2 mL centrifuge tube, add 1 mL of TRIzol for complete lysis, and then homogenize using a homogenizer. Transfer the homogenate to a new tube and sonicate, then centrifuge at 12000 rpm and 4°C for 10 min to collect the supernatant. Add 200 μL of chloroform to the supernatant, vortex vigorously to mix, and let stand at room temperature for 3 min. After centrifugation, carefully aspirate the colorless aqueous phase to a new tube. Add 500 μL of isopropanol, mix, and let stand at room temperature for 10 min to precipitate RNA. Centrifuge and discard the supernatant, retaining the precipitate. Add 1 mL of 75% ethanol, vortex to wash, centrifuge at 7500 rpm and 4°C for 5 min, discard the supernatant, and air dry at room temperature for about 10 min. Add an appropriate amount of RNase-free water to dissolve the RNA according to the amount of precipitate. Prepare the reaction mixture in an RNase-free centrifuge tube according to the system requirements, add gDNA wiper, and heat at 42°C for 2 min to remove gDNA. Add HiScript III Enzyme Mix and incubate at 37°C for 15 min, followed by heating at 85°C for 5 s to complete the reverse transcription reaction.
[0072] 2.10 Real-time quantitative PCR
[0073] The cDNA obtained from reverse transcription was diluted with DEPC water at an appropriate ratio, and several unit volumes of reaction mixture were prepared in an octet as follows:
[0074] Components Volume (μL) 2×ChamQUniversalSYBRqPCRMasterMix 5 Primer1 (10μM) 0.2 Primer2 (10μM) 0.2 TemplatecDNA 1 ddH2O 3.6
[0075] Transfer the above reaction system to a 96 or 384-well plate for PCR, avoiding the generation of air bubbles. After sealing with the matching film, centrifuge to ensure that the reaction solution adheres tightly to the bottom of the plate.
[0076] Run the qPCR reaction under the following conditions.
[0077]
[0078] Data Analysis: This section uses mouse Actin as an internal reference and utilizes 2 -ΔΔCt The relative mRNA level was calculated using this method.
[0079] This section involves primer sequences:
[0080] Gene ForwardPrimer ReversePrimer Actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT Il-1β GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG Il-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC TNF-α CTGAACTTCGGGGTGATCGG GGCTTGTCACTCGAATTTTGAGA Nos-2 GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC IL-17α TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC Rorc GACCCACACCTCACAAATTGA AGTAGGCCACATTACACTGCT Csf GGCCTTGGAAGCATGTAGAGG GGAGAACTCGTTAGAGACGACTT
[0081] 2.11 Enzyme-linked immunosorbent assay
[0082] In this study, commercially available pre-coated ELISA plates were used. Before the trial, the required number of wells was determined, and the necessary solutions were prepared. 100 μL each of the standard and the test sample were added sequentially to the wells. The plate was sealed with a sealing film and incubated at 37°C for 90 min. After the reaction, the liquid in the plate was removed, and the plate was tapped several times against absorbent paper. 100 μL of the prepared biotin-anti-mouse antibody working solution was added to each well. The sealing film was added, and the plate was incubated at 37°C for 60 min. 300 μL of wash buffer was added to each well using a multi-pipette, and the plate was soaked for 1 min. This washing process was repeated three times. 100 μL of the prepared ABC working solution was added to each well. The sealing film was added, and the plate was incubated at 37°C for 30 min. 300 μL of wash buffer was added to each well using a multi-pipette, and the plate was soaked for 1 min. This washing process was repeated five times. 90 μL of TMB chromogenic solution was added to each well, and the plate was incubated at 37°C in the dark for 15 min. Add 100 μL of stop solution to each well sequentially, and measure the absorbance at 450 nm using an ELISA reader.
[0083] 2.12 Colon tissue transcriptome sequencing
[0084] Total RNA was extracted from colon samples. The concentration and purity of the extracted RNA were assessed using Nanodrop, and RNA integrity was detected by agarose gel electrophoresis. RQN values were determined using an Agilent 5300 fragment analyzer. The following parameters were ensured to meet library construction requirements: total RNA volume 1 μg, concentration ≥30 ng / μl, RQN > 6.5, and OD260 / 280 between 1.8 and 2.2. Based on the polyA-tail complementary binding principle, Oligo(dT) magnetic beads were used to specifically capture mRNA from the total RNA for transcriptome sequencing library construction. Fragmentation buffer was added, and under thermodynamic regulation, the mRNA was randomly cleaved into short fragments with an average length of 300 bp. Using the fragmented mRNA as a template, reverse transcription was performed using random primers to generate single-stranded cDNA. Subsequently, DNA polymerase I was used to synthesize complementary strands to form double-stranded cDNA. The double-stranded cDNA was end-trimmed using an end-repair enzyme system, and a single deoxyadenosine nucleotide was added to the 3' end to facilitate subsequent adapter ligation. Aptamer sequences were ligated into cDNA fragments, purified with magnetic beads, and fragments were screened (300-500 bp). Sequencing libraries were constructed using high-fidelity PCR amplification and purified to obtain the final library. Library concentration was measured using a Qubit 4.0 quantitative PCR instrument. Library samples were mixed in equimolar proportions and bridged amplification was performed using an Illumina cBot system to generate DNA clusters. Finally, sequencing was performed on the NovaSeq X Plus platform.
[0085] 2.13 Extraction of primary mouse cells
[0086] 2.13.1 Colonic lamina propria lymphocytes
[0087] Mice were euthanized, and their colons were dissected and removed. The colon was rinsed with PBS to remove feces and mucus; then, the colon was cut open longitudinally and thoroughly washed with PBS. The colon tissue was placed in sterile PBS containing 2 mM EDTA and incubated in a 37°C water bath for 30 min, gently shaking the tissue as much as possible during incubation. The centrifuge tube containing the colon tissue was removed, vortexed at high speed for 15 s, and then the tissue was removed and further rinsed with sterile PBS to remove as many epithelial cells and mucosal layers as possible. The remaining tissue was cut into small fragments of approximately 0.5 cm in length. The tissue fragments were placed in a digestion solution containing collagenase IV and DNase I and incubated at 37°C for 45 min, gently shaking the tissue as much as possible during incubation. The digested tissue suspension was filtered through a 100 μm cell sieve, and the single-cell suspension was collected. The suspension was centrifuged at 1200 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in sterile PBS, centrifuged and washed again, and then lymphocytes were separated using Percoll separation solution. Resuspend the cells in RAPI 1640 complete medium, count the cells, and adjust the cell concentration to the desired density.
[0088] 2.13.2 Primary spleen cells
[0089] After euthanizing the mice, the spleen was removed and placed in a culture dish containing pre-chilled PBS. The spleen was gently crushed using a syringe plunger and filtered through an 80 μm cell sieve. The filtrate was collected into a centrifuge tube. Red blood cell lysis buffer was added to the centrifuge tube, and the mixture was incubated at room temperature for 10 min. The reaction was then terminated by adding PBS. The cells were centrifuged at 1200 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in RAPI 1640 complete medium, counted, and the cell concentration was adjusted to the desired density.
[0090] 2.14 Cell Culture
[0091] 2.14.1 Macrophage Culture and Stimulation Protocol
[0092] Mouse monocyte-macrophage RAW264.7 cells were cultured and passaged in DMEM medium supplemented with 100 U / mL penicillin, 100 μg / mL streptomycin, and 10% fetal bovine serum. Upon stimulation, cells were initially cultured at 5 × 10⁻⁶ cells / mL. 5 Cells were seeded at a density of 6-well plates. After adhesion, the medium was replaced with serum-free medium containing 1 μg / mL LPS for 24 h. The medium was then discarded, and the cells were washed twice with pre-cooled PBS. The cells were then harvested for protein or RNA extraction.
[0093] 2.14.2 Primary cell culture and stimulation protocols
[0094] The extracted primary cells were seeded in RPMI 1640 medium. Upon stimulation, the cells were initially inoculated at a rate of 5 × 10⁶ cells / mL.5 Cells were seeded at a density per well in 24-well plates pre-coated with 10 μg / mL anti-CD3 and 10 μg / mL anti-CD28. 20 ng / mL IL-6 was added to each well, and 30 ng / mL activin A and 100 ng / mL rFST were added to some groups as shown in the figure. After incubation at 37°C for 48 h, cells were collected for subsequent detection.
[0095] 2.15 CD4+ T cell sorting
[0096] Collect the extracted primary spleen cells and adjust the cell concentration to 1×10⁻⁶ using HBSS. 8 cells / mL. Add the biotin-labeled antibody mixture (targeting non-CD4+ cell surface markers such as CD8 and CD56) according to the kit instructions, and incubate at 4°C for 15 min. Add CD4+ streptavidin magnetic beads, mix well, and incubate at 4°C for 10 min to allow the magnetic beads to bind to the antibody-labeled non-target cells. Place the cell-magnetic bead mixture in a sorting tube, place it on a magnetic sorting rack, and let it stand for 5 min. Tilt the sorting rack along with the sorting tube to allow unbound cells to flow out with the buffer. Remove the sorting tube, resuspend the cells in the tube using HBSS, centrifuge at 1200 rpm for 3 min, discard the supernatant, resuspend in culture medium, and count the cells.
[0097] 2.16 Flow cytometry
[0098] Take approximately 100 μL of primary colonic lamina propria lymphocytes after extraction (containing approximately 1 × 10⁻⁶ cells). 6 Add cells to a flow cytometry tube. Add antibody according to the recommended concentration and order in the kit instructions, mix well, and incubate at 4°C in the dark for 30 min. Wash three times with HBSS, centrifuge at 1200 rpm for 5 min, and discard the supernatant. Resuspend the cells in 300 μL of HBSS, filter through an 80 μm filter to remove cell clumps, store in the dark, and wait for flow cytometry.
[0099] 2.17 Image Processing and Statistical Analysis
[0100] Image processing and manipulation were performed using Adobe Illustrator and ImageJ in the embodiments. Statistical analysis was performed using Excel and GraphPad Prism. Except for the weight and DAI (Disease Activity Index) change graphs, data conforming to a normal distribution were described as mean ± standard deviation; otherwise, they were described as mean ± standard error. T-tests were used to compare two independent, normally distributed samples with equal variances. For multiple group tests, a one-way ANOVA was used, followed by post-hoc pairwise comparisons. Unless otherwise specified, the DSS group was used as the control in the post-hoc analysis.
[0101] For quantitative calculations using Western blotting data, the Western blotting image file was opened in ImageJ software. Brightness and contrast were adjusted to ensure clear bands and minimal background noise. Then, the elliptical selection tool was used to draw the region of interest around each band, ensuring complete coverage. The "Measure" option was selected from the "Analyze" menu to obtain information such as average density and pixel values in the target region. The same steps were repeated for other bands in the same image. The results were then exported for further statistical analysis and graphical visualization.
[0102] Example 1
[0103] Intraperitoneal injection of recombinant FST protein improves acute colitis in mice
[0104] This embodiment involves intervention using exogenous recombinant FST (rFST) protein, as detailed in the attached protocol. Figure 1 As shown in Figure a. During the 7-day DSS modeling period, one mouse in the DSS group died due to severe colitis, while all mice in the rFST treatment group survived. During symptom monitoring, the weight changes in the mice receiving rFST treatment initially showed a similar downward trend to the colitis group, but the rate of decline slowed in the following days. After DSS was removed, the weight loss stopped and the weight began to recover (e.g., ...). Figure 1 (See Figure b). In the final stage of modeling, the rFST-treated mice showed a significant difference in symptom severity compared to the enteritis group (e.g., ...). Figure 1 (Figure c). The overall specimen results showed similar trends; the degree of colonic shortening in mice treated with rFST was significantly improved (e.g., ...). Figure 1 (Figure d). At the tissue level, the colonic structure of mice in the FST treatment group was significantly more intact and the degree of inflammatory infiltration was milder compared with that in the DSS group; the intestinal mucus barrier was only slightly damaged; and the expression levels of tight junction molecules ZO1 and Claudin-1 were partially restored (e.g., Figure 1 (Figure e). Histological scoring quantifies the degree of epithelial damage and inflammatory infiltration. Results showed that the degree of histological damage in the FST treatment group was significantly less than that in the DSS group, confirming that FST significantly alleviates epithelial integrity disruption and inflammatory infiltration depth (e.g., Figure 1 (Figure f). We also performed myeloperoxidase (MPO) detection, and the results showed that the colonic MPO level in the FST treatment group was significantly lower than that in the DSS group (e.g., Figure f). Figure 1 (See Figure g). RT-qPCR results showed that the transcriptional levels of some classic enteritis-associated inflammatory molecules, such as IL-1β, Nos2, TNFα, and IL-6, were significantly decreased in the FST treatment group (e.g., ...). Figure 1(See figure h). Finally, we used ELISA to quantify the levels of inflammatory factors in the colon, and the results indicated a significant decrease in IL-6 and TNFα in the colonic homogenate after rFST intervention in the treatment group (e.g., ...). Figure 1 (Image from the middle of the image).
[0105] like Figure 1 As shown in the figure, Figure a illustrates the grouping of mice, the establishment of the enteritis model, and the administration of rFST; Figure b is a line graph of mouse weight loss (DSS vs FST); Figure c is a line graph of the mouse disease activity index (DAI) (DSS vs FST); Figure d shows images and statistical graphs of colon length in each group of mice; Figure e shows representative images of colon histochemical and immunofluorescence staining in each group of mice (overview scale bar: 500μm, local area scale bar: 125μm); Figure f shows the histological score of mouse colitis stained with HE; Figure g shows the comparison of myeloperoxidase activity in colon samples from each group of mice; Figure h shows the RT-qPCR results of the transcriptional levels of classic enteritis-related molecules in colon samples from each group of mice; Figure i shows the expression of inflammatory proteins in colon samples from each group of mice detected by ELISA. *: p < 0.05, **: p < 0.01.
[0106] Example 2
[0107] Intraperitoneal injection of recombinant FST protein improves chronic colitis in mice
[0108] To further characterize the therapeutic effect of FST, we also conducted a treatment test in a chronic DSS colitis model, reducing the number of FST injections to only one intraperitoneal injection on the third day of each DSS cycle (e.g., Figure 2 (Figure a). The results indicate that the therapeutic effect of FST is quite significant and durable. Differences in mouse weight changes were observed after the first FST injection, and FST treatment almost completely eliminated the weight loss caused by DSS modeling. Throughout the modeling process, the weight of mice in the FST group remained above baseline and steadily increased, while in the DSS group, significant weight fluctuations were observed with each DSS intervention (e.g., ...). Figure 2 (See Figure b). During sample collection, it was observed that the chronic model achieved more stable results compared to the acute enteritis model, with the degree of colonic shortening in mice controlled at a similar level. The FST treatment group significantly improved the degree of colonic shortening in mice (e.g., ...). Figure 2 (See Figure C). We subsequently created a colon Swiss roll to assess colonic damage in each group of mice from a more comprehensive perspective. The results showed that in the chronically modeled mice, there was significant necrosis and shedding of the colonic mucosal epithelium, and marked inflammatory cell infiltration. In the FST treatment group, the colonic structure was generally intact, with scattered small ulcer foci and milder inflammatory infiltration (e.g., [Figure C]). Figure 2(Figure d in the middle). Since the chronic model is milder than the acute model, the experimental results suggest that the amount of mesenteric fat in the chronic DSS mouse group was significantly reduced compared to the Ctrl group. FST treatment salvaged the quality of mesenteric fat in the mice, maintaining it at a level similar to that of the Ctrl group (e.g., ...). Figure 2 Figure e shows that the overall "consumption" state of mice with chronic enteritis has been improved, which also suggests that FST treatment has a significant impact on lipid metabolism.
[0109] like Figure 2 As shown in the figures, Figure a illustrates the grouping of chronic model mice, the establishment of enteritis modeling, and rFST administration. Figure b is a line graph showing the weight loss of mice (DSS vs FST). Figure c shows images and statistical charts of colon length in each group of mice. Figure d is a representative image of Swiss roll HE staining of the colon in each group of mice (overview scale bar: 2mm, local area scale bar: 400μm). Figure e is a representative image and statistical chart of mesenteric fat mass in each group of mice. *: p < 0.05, **: p < 0.01, ***: p < 0.001.
[0110] Example 3
[0111] Activin A levels are significantly elevated in colitis.
[0112] The most important known function of FST is as a natural antagonist of activin A; therefore, we hypothesized that the therapeutic effect of FST on colitis might be related to antagonism of activin A. Thus, we investigated activin A signaling in the colitis environment.
[0113] We used LPS (lipopolysaccharide)-stimulated macrophages to simulate the immune inflammatory state caused by antigen exposure following intestinal barrier disruption. The results showed that LPS-stimulated macrophages rapidly increased INHBA transcription levels (e.g., Figure 3 (Figure a) and protein levels (e.g.) Figure 3 (Figure b) Activin A is the active component of INHBA protein (inhibin βA subunit); this suggests that immune cells in the colonic lamina propria may be the main force in upregulating activin A during colonic inflammation. We performed Western blot analysis on colonic samples from experimental mice, and the results showed that the level of INHBA in the colon of mice affected by DSS was significantly higher than that in Ctrl mice (e.g., ...). Figure 3 (Figure c). Immunohistochemistry of colon tissue also showed the same results, namely, INHBA levels were significantly upregulated in the colon of mice with induced inflammation (e.g., ...). Figure 3(Figure d). We collected biopsy control samples from 15 patients with inflammatory bowel disease, taken from the inflammatory lesion area (IR) and adjacent normal mucosa (NR). Immunohistochemical IRS scores indicated a more significant INHBA level in the inflammatory lesion area (IR) (e.g., ...). Figure 3 (See figure 'e'). Simultaneously, analysis of intestinal mucosal transcriptome data from healthy controls and patients with inflammatory bowel disease in the GEO database revealed that in multiple datasets, compared to healthy individuals, mucosal INHBA levels in patients with enteritis were significantly upregulated (e.g., ...). Figure 3 The severity of the disease as determined endoscopically (as shown in Figure f) is positively correlated to some extent with the severity of the disease as determined endoscopically (e.g., Figure 3 (Figure g in Chinese)
[0114] like Figure 3 As shown in the figures, Figure a shows the level of INHBA mRNA expression in macrophages after LPS stimulation detected by qPCR. Figure b shows the level of INHBA protein expression in macrophages after LPS stimulation detected by Western blotting. Figure c shows the levels of INHBA and FST proteins in colon samples from mice in each group detected by Western blotting. Figure d shows the expression levels of INHBA and FST proteins in colon samples from mice in each group detected by immunohistochemistry. Figure e shows the expression level of INHBA protein and IRS score in colon samples from inflammatory bowel disease patients' colonic lesions and adjacent non-accumulated areas detected by immunohistochemistry. Figure f shows the transcription level of INHBA in colon samples from inflammatory bowel disease patients and healthy controls in a public database. Figure g shows the correlation between INHBA expression level in colon tissue of inflammatory bowel disease patients and Mayo endoscopic scores in a public database. *: p < 0.05, **: p < 0.01, ****: p < 0.0001
[0115] Example 4
[0116] FST treats enteritis by blocking the Th17-inducing effect of activator A.
[0117] We validated the abnormally elevated expression levels of activin A in cell, mouse, and human tissue samples. Immunofluorescence assays revealed extensive co-localization of INHBA and FST in the colon of treated mice (e.g., ...). Figure 4 Figure a shows that FST can reach the intestine and antagonize the elevated activin A signaling in areas of enteritis.
[0118] We further performed transcriptome sequencing on colon samples from mice in the FST treatment group and the DSS group, and the results identified 764 increasing transcripts and 1382 decreasing transcripts (e.g., ...). Figure 4(Figure b). Our enrichment analysis of significantly decreased genes revealed that, after FST treatment, classical inflammatory signaling pathways widely activated in enteritis, such as the IL-17 and TNFα pathways, were significantly enriched, with the IL-17 signaling pathway being particularly significant (e.g., ...). Figure 4 (Figure c). We hypothesize that activin A may drive inflammation by inducing the IL-17 signaling pathway, while FST treatment blocks this effect.
[0119] We extracted lymphocytes from the lamina propria of the mouse colon for flow cytometry, and the results showed that FST treatment significantly reduced the elevated Th17 cell levels (e.g., in mice with DSS colitis) in the DSS colitis group. Figure 4 (Figure d in the middle). In vitro, activin A can also stimulate T cells to differentiate into Th17 cells, but the addition of FST blocks this effect (e.g., ...). Figure 4 (See figure e). We also tested inflammatory macrophages, which may be contributors to activin A, with FST treatment to explore the possibility of feedback regulation, but the results showed that FST treatment had no significant effect on macrophage M1 / 2 markers after LPS stimulation (e.g., Figure 4 (Figure f in the middle)
[0120] like Figure 4 As shown in the figures, Figure a shows a significant co-localization of INHBA and FST signals in the inflamed colon of mice. Figure b is a volcano plot of transcriptome sequencing of colon samples from the FST and DSS groups. Figure c shows the KEGG enrichment results of downregulated genes in the colon tissue of the FST treatment group (sorted according to the corrected p-value). Figure d is a representative graph and statistical bar chart of the percentage of Th17 lymphocytes in the lamina propria of the colon in each group detected by flow cytometry. (Gate logic: mononuclear cells → lymphocytes → CD3+ / CD4+ → IL17+); Figure e shows the RT-qPCR detection of activin A and FST intervention-related indicators of CD4+ T cell Th17 differentiation. Figure f shows the RT-qPCR detection of LPS-induced inflammation and FST intervention-related indicators of RAW264.7 cell M1 / 2 differentiation. ns: no statistical difference, *: p < 0.05, **: p < 0.01, ***: p < 0.001
[0121] This invention is based on a deep understanding and experimental verification of the "FST-activin A-Th17" axis in the pathogenesis of colitis. In both DSS-induced mouse colitis models and clinical IBD patient samples, significantly upregulated activin A (INHBA) expression was observed, and its level was positively correlated with disease severity. As a member of the TGF-β superfamily, activin A can promote the release of pro-inflammatory factors, disrupt the integrity of the intestinal epithelial barrier, and crucially induce pathogenic Th17 cell differentiation, thereby exacerbating the intestinal immune inflammatory response.
[0122] To verify the hypothesis that FST exerts its therapeutic effect by antagonizing this pathway, this study used recombinant FST protein to intervene in colitis mice. The results showed that exogenous supplementation with rFST not only effectively improved the clinical symptoms of acute colitis (including reducing DAI scores, alleviating colonic shortening, repairing the mucus barrier, and increasing tight junction protein expression), but also maintained the therapeutic effect more stably and persistently in the chronic model, even completely reversing the DSS-induced weight loss trend.
[0123] Mechanistic studies have shown that FST, as a natural high-affinity antagonist of activin A, can specifically bind to and neutralize its biological activity. In vitro and in vivo experiments confirmed that rFST treatment significantly inhibits activin A-driven T cell differentiation into a pro-inflammatory Th17 phenotype, manifested by a significant decrease in the proportion of IL-17+ Th17 cells in the colonic lamina propria, and simultaneous downregulation of genes related to the IL-17 signaling pathway and TNFα pathway. Transcriptome sequencing analysis further revealed that key inflammatory pathways, such as the Th17 cell differentiation pathway and the cytokine-cytokine receptor interaction pathway, were significantly inhibited in inflamed colon tissue after FST treatment.
[0124] In summary, this invention is based on the following continuous chain of evidence: 1) Activin A is abnormally overexpressed in colitis and is positively correlated with disease severity; 2) Exogenous FST supplementation can significantly improve symptoms of acute and chronic colitis; 3) FST restores intestinal immune homeostasis by specifically antagonizing activin A, inhibiting Th17 cell differentiation and downstream inflammatory pathways. Therefore, this invention discloses a novel strategy with a clear mechanistic basis for the treatment of colitis, which can antagonize the overactivated activin A signaling pathway through the intake of recombinant FST protein.
[0125] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. Application of follicle-staphylin (FST) in the preparation of drugs for the treatment of acute inflammatory bowel disease.
2. Application of folliculostatin (FST) in the preparation of drugs that inhibit myeloperoxidase.
3. Application of follicle-staphylin (FST) in the preparation of drugs that inhibit inflammatory molecules associated with enteritis.
4. Application of follicle-staphylin (FST) in the preparation of drugs for the treatment of chronic inflammatory bowel disease.
5. Application of follicle-staphylin (FST) in the preparation of drugs to improve mesenteric fat quality in patients with inflammatory bowel disease.
6. Application of follicle-staphylin (FST) in the preparation of drugs for treating inflammatory bowel disease by blocking the Th17-inducing effect of activin A.
7. Application of follicle-staphylin (FST) in the preparation of drugs that reduce Th17 cell levels in patients with inflammatory bowel disease.
8. Application of activator A-Th17 axis as a target in the preparation of drugs for treating inflammatory bowel disease.
9. The application according to any one of claims 1-8, characterized in that, The dosage forms of the drug include tablets, powders, granules, capsules, oral liquids, injections, or sustained-release formulations.
10. A treatment system for inflammatory bowel disease, characterized in that, The treatment system includes a medication system containing follicle-stimulating hormone (FST).