Application of combination of STM2457 and gefitinib in preparation of medicine for preventing and treating lung cancer

Abstract

The invention relates to application of a combination of STM2457 and gefitinib in preparation of a medicine for preventing and treating lung cancer, and belongs to the technical field of biological medicines. The invention provides an application of an METTL3 inhibitor and gefitinib in preparation of a medicine for preventing and treating lung cancer. In a cell experiment, the expression of METTL3 is inhibited and then Gefitinib is used, so that the killing effect of the Gefitinib on lung cancer cells is promoted, and the drug resistance of the lung cancer cells on the Gefitinib is reduced. The small molecule inhibitor STM2457 of the METTL3 and the Gefitinib are combined for medication, so that the killing effect on cancer cells can be synergistically improved. In a mouse experiment, compared with a single drug, the drug combination has the advantages that the growth of tumors is more effectively inhibited, the lymph node metastasis of lung cancer cells can be effectively prevented, no obvious side effect exists, and a good treatment effect is shown. Therefore, the drug combination of the METTL3 inhibitor and the Gefitinib has a remarkable treatment effect on the NSCLC.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of STM2457 and gefitinib combination in preparation of drugs for preventing and treating lung cancer. BACKGROUND

[0002] Lung cancer is a primary bronchogenic lung cancer, which is originated from bronchial epithelial or alveolar epithelial cells. Lung cancer is one of the malignant tumors with high mortality in the world, and the survival time of lung cancer patients is more than 5 years, accounting for only 15%. It is a serious challenge to human health. About 2.5 million people are diagnosed with lung cancer every year, accounting for 1 / 8 of all malignant tumors, ranking first in newly diagnosed malignant tumors. Nearly 1.4 million patients die of lung cancer every year. Lung cancer is mainly divided into non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) according to pathological type. Among them, the proportion of non-small cell lung cancer (NSCLC) patients is about 80%, and one third of NSCLC patients are diagnosed as lung cancer at advanced stage, accompanied by metastasis. The survival time of patients with metastasis is very low, generally less than two years. The common treatment methods of lung cancer include surgery, chemotherapy, radiotherapy, ablation therapy, targeted therapy, immunotherapy, interventional therapy, traditional Chinese medicine treatment and adjuvant therapy, etc. Among them, surgery assisted by radiotherapy and chemotherapy is still the main treatment method, but the median survival time of radiotherapy and chemotherapy drugs is only 8-11 months, and the 1-year and 2-year survival rates are 35%-40% and 10%-20%, respectively. In addition, the prognosis of such drugs is poor, and is accompanied by serious cytotoxicity. Therefore, the treatment of lung cancer is facing serious challenges, and it is urgent to find new effective intervention strategies.

[0003] With the in-depth study of the pathological characteristics and biochemical characteristics of lung cancer, molecular targeted therapy of NSCLC has become a hot research field. There are epidermal growth factor receptor (EGFR) activating mutations in NSCLC patients, which play a very key role in the proliferation, differentiation, invasion and metastasis of tumor cells, so inhibiting the EGFR signal transduction pathway is an effective strategy for treating NSCLC, making the treatment of NSCLC from traditional chemotherapy to EGFR signal transduction pathway and tyrosine kinase (TK) targeted therapy. Gefitinib (Gefitinib) as the first generation of small molecule targeted drugs opens up a new field of non-small cell lung cancer treatment, which is an oral small molecule quinoline compound, which competitively binds to the magnesium-adenosine triphosphate (Mg-ATP) binding site in the catalytic region of intracellular EGFR-TK, specifically inhibits the activity of tyrosine kinase and then blocks cell proliferation and angiogenesis, promotes tumor cell apoptosis, and is mainly used for the treatment of SCLC patients in the advanced stage who have received platinum-based chemotherapy drugs, especially for female, non-smoking, Asian, adenocarcinoma or EGFR mutation positive patients. However, with the extension of treatment time, the tumor cells will produce new gene mutations or new epigenetic modification changes to enhance their drug resistance, and the increase of drug dose will also cause damage to other tissues and organs of the body, resulting in a decrease in treatment value, and there is a lot of controversy about the clinical benefit of its combination with radiotherapy and chemotherapy drugs, so real-time accurate monitoring of tumor changes and adjusting the treatment plan, and using new combined drug regimen are expected to alleviate these clinical pressures. SUMMARY

[0004] The purpose of the present application is to overcome the shortcomings of the prior art and provide the use of STM2457 and gefitinib in combination in the preparation of drugs for preventing and treating lung cancer.

[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is: In a first aspect, the present application provides the use of a METTL3 inhibitor and gefitinib in the preparation of a drug for preventing and treating lung cancer, wherein the METTL3 inhibitor is STM2457 or shRNA, the CAS number of the STM2457 is 2499663-01-1, and the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1-3.

[0006] The present application can inhibit the expression of METTL3 by RNAm 6 The inhibitor of methyltransferase METTL3 and gefitinib further enhance the anti-NSCLC effect.

[0007] Further, the lung cancer includes non-small cell lung cancer.

[0008] Further, the drug inhibits the growth of lung cancer tumor.

[0009] Further, the drug inhibits lung cancer tumor metastasis.

[0010] Further, the drug inhibits lung cancer cell growth and proliferation.

[0011] Further, the drug inhibits lung cancer cell colony formation ability.

[0012] Further, the drug inhibits lung cancer cell invasion and / or migration ability.

[0013] Further, the drug promotes lung cancer cell apoptosis.

[0014] Further, the lung cancer cells include at least one of A549 cells, H1299 cells, H1650 cells, H1792 cells, H1944 cells, H1975 cells and H3122 cells.

[0015] In a second aspect, the present application provides a drug for preventing and treating lung cancer, wherein the drug contains a METTL3 inhibitor and Gefitinib, the METTL3 inhibitor is STM2457 or shRNA, the CAS number of the STM2457 is 2499663-01-1, and the nucleotide sequence of the shRNA is shown as SEQ ID NO: 1-3.

[0016] Further, the drug further contains a pharmaceutically acceptable excipient and / or carrier.

[0017] Compared with the prior art, the present application has the following beneficial effects: RNAm 6 A methyltransferase METTL3 is abnormally highly expressed in a plurality of NSCLC cell lines, lung cancer clinical samples and TCGA lung cancer data, and is closely related to poor prognosis. In cell experiments, inhibiting the expression of METTL3 and then using Gefitinib can promote the killing effect of Gefitinib on lung cancer cells and reduce the drug resistance of lung cancer cells to Gefitinib. At the same time, the small molecule inhibitor STM2457 of METTL3 and Gefitinib combined can synergistically increase the killing effect on cancer cells. In the xenotransplantation NSCLC mouse experiment using the intragastric administration method, the combined use of drugs is more effective than single drug in inhibiting tumor growth, and can effectively prevent lymph node metastasis of lung cancer cells, and has no obvious side effects, showing good therapeutic effect. Therefore, the combined use of METTL3 inhibitor and Gefitinib has a significant therapeutic effect on NSCLC, and has no obvious side effects, which provides a new treatment strategy for the clinical treatment of NSCLC. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1Expression characteristics of METTL3 and EGFR in NSCLC tumor cells. Among them, A is the expression of METTL3 in TCGA database NSCLC-seq analysis compared with adjacent tissues and NSCLC cells; B is the expression of EGFR in TCGA database NSCLC-seq analysis compared with adjacent tissues and NSCLC cells; C is the expression of METTL3 and EGFR at the transcriptional level in 7 lung cancer cell lines; D is the expression of METTL3 and EGFR at the transcriptional level in clinical lung tissue; E is the expression of METTL3 and EGFR at the protein level in 7 lung cancer cell lines; F is the expression of METTL3 and EGFR at the protein level in clinical lung tissue; G is the correlation analysis of the expression of METTL3 and EGFR in lung adenocarcinoma (LUAD) cells; H is the correlation analysis of the expression of METTL3 and EGFR in lung squamous carcinoma cells; I is the survival analysis of EGFR expression in lung squamous carcinoma; J is the survival analysis of EGFR expression in lung adenocarcinoma; K is the IHC staining result of human lung cancer tissue.

[0019] Figure 2 It is a map of overexpression plasmid.

[0020] Figure 3 Knocking out METTL3 gene can promote the killing effect of Gefitinib on lung cancer cells. Among them, A is the expression of EGFR in H1944 cells with METTL3 gene knocked out; B is the IC 50 of Gefitinib on H1944 cells with METTL3 gene knocked out; C is the effect of Gefitinib on the growth and proliferation of H1944 cells with METTL3 gene knocked out; D is the effect of Gefitinib on the clonogenic ability of H1944 cells with METTL3 gene knocked out; E is the effect of Gefitinib on the invasion ability of H1944 cells with METTL3 gene knocked out; F is the effect of Gefitinib on the migration ability of H1944 cells with METTL3 gene knocked out; G is the effect of Gefitinib on the apoptosis of H1944 cells with METTL3 gene knocked out.

[0021] Figure 4 Overexpression of METTL3 gene can enhance the drug resistance of lung cancer cells to Gefitinib. Among them, A is the protein of EGFR in H1975 cells with METTL3 gene overexpressed; B is the IC 50The influence of Gefitinib on the growth and proliferation of H1975 cells overexpressing METTL3 gene; D is the influence of Gefitinib on the clonogenic ability of H1975 cells overexpressing METTL3 gene; E is the influence of Gefitinib on the invasion ability of H1975 cells overexpressing METTL3 gene; F is the influence of Gefitinib on the migration ability of H1975 cells overexpressing METTL3 gene; G is the influence of Gefitinib on the apoptosis of H1975 cells overexpressing METTL3 gene.

[0022] Figure 5 The inhibitory effect of the small molecule inhibitor of METTL3 STM2457 on lung cancer cells. Among them, A is the IC 50 of STM2457 on 7 lung cancer cell lines; B is the cell survival experiment result of STM2457 on 7 lung cancer cell lines; C is the cell survival experiment result of STM2457 and Gefitinib combined use on 7 lung cancer cell lines; D is the influence of STM2457 and Gefitinib combined use on the clonogenic ability of 7 lung cancer cell lines.

[0023] Figure 6 The killing effect of STM2457 and Gefitinib combined use on lung cancer cells. Among them, A is the IC 50 of STM2457 and Gefitinib combined use on H1299 cells; B is the IC 50 of STM2457 and Gefitinib combined use on H1944 cells; C is the influence of STM2457 and Gefitinib combined use on the growth and proliferation of H1299 cells; D is the influence of STM2457 and Gefitinib combined use on the growth and proliferation of H1944 cells; E is the influence of STM2457 and Gefitinib combined use on the migration ability of H1299 cells; F is the influence of STM2457 and Gefitinib combined use on the invasion ability of H1299 cells; G is the influence of STM2457 and Gefitinib combined use on the migration ability of H1944 cells; H is the influence of STM2457 and Gefitinib combined use on the invasion ability of H1944 cells; I is the influence of STM2457 and Gefitinib combined use on the apoptosis of H1299 cells and H1944 cells.

[0024] Figure 7Synergy of STM2457 and Gefitinib combination on lung cancer cells. Wherein, A is the heat map result calculated by SynergyFinder+ model (H1299 cells); B is the heat map result calculated by SynergyFinder+ model (H1944 cells); C is the synergy coefficient of the drug on H1299 cells calculated by the four mathematical models in the SynergyFinder+ model; D is the synergy coefficient of the drug on H1944 cells calculated by the four mathematical models in the SynergyFinder+ model; E is the synergy effect of the drug on H1299 cells in the CompuSyn model; F is the synergy effect of the drug on H1944 cells in the CompuSyn model.

[0025] Figure 8 STM2457 and Gefitinib combination can effectively inhibit the tumorigenesis and tumor growth of lung cancer cells in mice. Wherein, A is the mouse modeling and drug administration process; B is the growth rate of subcutaneous lung cancer cell tumors in mice after STM2457 and Gefitinib combination administration; C is the size of subcutaneous lung cancer cell tumors in mice after STM2457 and Gefitinib combination administration; D is the final tumor weight after STM2457 and Gefitinib combination administration; E is the final tumor volume after STM2457 and Gefitinib combination administration; F is the expression of METTL3, EGFR, Ki67 and Caspase3 after STM2457 and Gefitinib combination administration shown by histological staining (H&E) and immunohistochemical staining (IHC); G is the expression of pan-CK after STM2457 and Gefitinib combination administration shown by H&E and IHC experiments of submandibular lymph nodes of mice. DETAILED DESCRIPTION

[0026] In order to better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in combination with specific examples. Unless otherwise specified, other materials, reagents, etc. used in the examples can be obtained from commercial channels.

[0027] Statistical method: all data were statistically analyzed by Graphpad prism 8.3 software.

[0028] Kolmogorov-Smirnov test and Shapiro-Wilk test were used to determine whether the data was normally distributed. For non-paired comparison between two groups of normally distributed data, ordinary unpaired t test was used if the variances were equal, and Welch t test was used if the variances were unequal; for paired comparison between two groups of normally distributed data, paired t test was used. For non-paired comparison between two variables of non-normally distributed data, Mann-Whitney test was used, and for paired comparison, Wilcoxon signed rank test was used. All statistical methods were considered to have statistically significant differences at P < 0.05.

[0029] Example 1 Expression characteristics of METTL3 and EGFR in NSCLC cell lines and tissues I. Experimental methods 1. Revive 7 NSCLC cell lines (A549, H1299, H1650, H1792, H1944, H1975, H3122) in the laboratory: take out the cells stored in liquid nitrogen, quickly thaw in a 37°C constant temperature water bath, and transfer the cell suspension to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 2 min, discard the supernatant, and gently resuspend the cells with complete medium (1640 medium containing 10% v / v fetal bovine serum) and transfer to a culture dish, shake in a "cross" or "8" shape, and incubate in a 37°C, 5% CO2 incubator. Record as P1 generation cells. When the P1 generation cells grow to 80% confluence, use a negative pressure pump to remove the culture medium, wash with PBS twice, aspirate the PBS, add 0.25% (w / v) trypsin to digest the cells, add an equal volume of complete medium to terminate digestion, and transfer to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 2 min, discard the supernatant. Resuspend the cells with complete medium, transfer to a new culture dish at a volume ratio of 1:4, and incubate, record as P2 generation cells. When the P2 generation cells reach 80% confluence, collect the cells, wash them twice with pre-cooled PBS, scrape the cells, and use one portion of the cells for Western blotting to analyze METTL3 and EGFR protein expression, and use another portion of the cells for TRIZol extraction of RNA and reverse transcription to cDNA for qPCR to detect METTL3 and EGFR mRNA levels.

[0030] The qPCR system is: 2x ChamQ SYBR qPCR Master Mix (Without ROX) 10 μL, upstream primer (10 μM) 0.4 μL, downstream primer (10 μM) 0.4 μL, and cDNA 2 μL, supplemented with ddH2O to a total qPCR system of 20 μL. The qPCR program is 95°C for 2 min; 95°C for 5 s, 40 cycles; 60°C for 30 s.

[0031] qPCR primers: METTL3 forward primer: CTATCTCCTGGCACTCGCAAGA; METTL3 reverse primer: GCTTGAACCGTGCAACCACATC; EGFR forward primer: AACACCCTGGTCTGGAAGTACG; EGFR reverse primer: TCGTTGGACAGCCTTCAAGACC.

[0032] 2. After approval by the hospital ethics committee, the informed consent of the patient or family members was obtained, and the tumor and cancer-adjacent tissue of lung cancer patients in the Affiliated Hospital of Guangdong Medical University were collected. The tissues were washed several times with pre-cooled PBS buffer (1% BSA was added) in a clean bench to remove blood stains and other impurities. Then the tissues were divided into three parts with sterile surgical scissors. One part of the tissue was lysed by RIPA for Western blot experiment to analyze the expression of METTL3 and EGFR protein. One part of the tissue was extracted by TRIZol method to obtain RNA for qPCR to detect the mRNA level of METTL3 and EGFR. The third part of the tissue was fixed with 4% (w / v) paraformaldehyde for 24 h, then dehydrated, embedded, sectioned, and stained with H&E and IHC to analyze the expression characteristics of METTL3 and EGFR.

[0033] II. Experimental results TCGA database analysis of NSCLC-seq showed that METTL3 ( Figure 1 A) and EGFR ( Figure 1 B) were abnormally highly expressed in NSCLC cells compared with cancer-adjacent tissues; WB results of lung cancer cell lines and clinical lung tissues also confirmed that METTL3 and EGFR were significantly higher than normal lung epithelial cells BEAS-2B and cancer-adjacent tissues at the transcription level ( Figure 1 C and Figure 1 D) and protein level ( Figure 1 E and Figure 1 F); correlation analysis showed that the expression of METTL3 and EGFR in lung cancer cells was positively correlated ( Figure 1 G and Figure 1 H); EGFR high expression group was closely related to poor prognosis ( Figure 1 I and Figure 1 J); IHC results of human lung cancer tissues showed that the expression of METTL3 and EGFR in tumor tissues was significantly higher than that in surgical margin tissues ( Figure 1 K).

[0034] Example 2 Knockout or overexpression of METTL3 and combination with Gefitinib administration on NSCLC cell lines I. Experimental methods 1. Design 3 shRNAs to knock out METTL3 gene in H1944 cell line, obtain H1944 cells with METTL3 gene knocked out, and the shRNA sequences are shown in Table 1.

[0035] Table 1 shRNA number shRNA sequence Sequence number shRNA 1 AATTCGTCTGAAGTGCAGC SEQ ID NO: 1 shRNA 2 ATAGTCACAGAATTCTTGC SEQ ID NO: 2 shRNA 3 TAGTACGGGTATGTTGAGC SEQ ID NO: 3 shNC ACGTTGACACGTTCGGAGAA SEQ ID NO: 4 It is found through screening that shRNA1 (M3sh1) and shRNA3 (M3sh3) have obvious knock-out effect, and are used in subsequent experiments.

[0036] Overexpress METTL3 gene in H1975 cell line (experimental group: pCMV2-METTL3; control group: pCMV2), and the overexpression plasmid map is shown in Figure 2 , and obtain H1975 cells with METTL3 gene overexpressed.

[0037] 2. Gefitinib is administered to H1944 cells with METTL3 gene knocked out or H1975 cells with METTL3 gene overexpressed, and the IC 50 , growth and proliferation, clonogenicity, invasion, migration and apoptosis of each cell after administration are detected to evaluate the effect of Gefitinib on cells with METTL3 gene knocked out or overexpressed. The transcription and protein expression of EGFR are detected by Western blot and qPCR to determine the effect of METTL3 on EGFR expression and the effect on Gefitinib efficacy.

[0038] (1) IC 50 determination: 50mM Gefitinib stock solution is prepared with DMSO. P2 cells of cells with METTL3 gene knocked out or overexpressed are counted without counting. When the cells reach 80% confluence, the cells are trypsinized at 0.25% (w / v), centrifuged, the supernatant is discarded, PBS is added for resuspension and cell counting. Cells are inoculated in 96-well plates at 5000 / 100μL / well, and the cells are cultured at 37℃ and 5% CO2 for 12h, then the complete medium containing different concentrations of Gefitinib (0μM, 0.01μM, 0.1μM, 1μM, 5μM, 10μM, 20μM, 40μM, 60μM and 100μM) is replaced, 3 replicate wells are set for each concentration, and the cells are further cultured for 72h. The supernatant is aspirated, 100μL CCK8 detection solution (containing 10μL CCK8 reagent + 90μL serum-free 1640 medium) is added to each well, and the cells are incubated at 37℃ for 2h. The OD 450 and OD 620 values (normalized well background) are detected and calculated by enzyme-labeled instrument, and the IC 50 value of Gefitinib on cells is calculated.

[0039] (2) CCK8 experiment: P2 generation cells of METTL3 gene knockout or overexpression cells without counting were inoculated into 96-well plates at an amount of 1000 cells / 100 μL, and groups were set: control group and 5 μM Gefitinib group, each group was allocated 3 repeats, after 12 h of cell culture at 37°C, 5% CO2, according to the grouping, the 1640 complete medium containing the corresponding drug concentration was replaced, recorded as 0 days (day, d), 37°C, 5% CO2 continued to culture, and the OD 450 and OD 620 of cells at 0d, 1d, 2d, 3d, 4d, 5d and 6d were detected by enzyme-labeled instrument, the net OD value was calculated and the growth curve was drawn, and the effect of Gefitinib on the proliferation of cells with METTL3 gene knockout or overexpression was determined.

[0040] (3) Cell survival experiment: P2 generation cells of METTL3 gene knockout or overexpression cells without counting were inoculated into 12-well plates at an amount of 3000 cells / well, and control group and 10 μM Gefitinib group were set, each group was allocated 3 repeats, after 12 h of cell culture at 37°C, 5% CO2, according to the grouping, the 1640 complete medium (containing 2% v / v FBS) containing the corresponding drug concentration was replaced, and the culture was continued for 72 h, the culture medium was aspirated, the cells were washed with 2 mL PBS for 3 times, 1 mL 4% (w / v) paraformaldehyde (fixing solution) was added to fix the cells at room temperature for 15 min, the fixing solution was removed, 500 μL 1% (w / v) crystal violet solution was added to stain the cells at room temperature for 20 min, the cells were washed with distilled water, and after air-drying, the photograph was observed to observe the effect of the drug on the survival ability of each cell line.

[0041] (4) Cloning experiment: P2 generation cells of METTL3 gene knockout or overexpression H1944 cells without counting were inoculated into 12-well plates at an amount of 500 cells / well, and groups were set: control group and 10 μM Gefitinib group, each group was allocated 3 repeats, after 24 h of cell culture at 37°C, 5% CO2, according to the grouping, the 1640 complete medium containing the corresponding drug concentration was replaced, and the culture was continued for 10d-15d until the cells grew into multicellular groups, the culture medium was aspirated, the cells were washed with 2 mL PBS for 3 times, 1 mL 4% (w / v) paraformaldehyde (fixing solution) was added to fix the cells at room temperature for 30 min, the fixing solution was removed, 500 μL 1% (w / v) crystal violet solution was added to stain the cells at room temperature for 20 min, the cells were washed with distilled water, and after air-drying, the photograph was observed to observe the effect of Gefitinib on the cloning ability of H1944 cells with METTL3 gene knockout or overexpression.

[0042] (5) Transwell assay: P2 generation cells of H1944 cells with knockout or overexpression of the METTL3 gene were used to count the amount of METTL3. 4 Cells were seeded in clean chambers or with Material gel (2 hours in advance) and placed in chambers at 37°C. Groups were set up: control group and 10 μM Gefitinib group, with 3 replicates in each group. 750 μL of 1640 complete culture medium containing the corresponding drug concentration was added to the outer layer of the chamber. After 12 hours, the chamber was removed and fixed and stained according to step (3). The cells were photographed and observed, and the cell count was counted and plotted to observe the effect of Gefitinib on the migration and invasion ability of H1944 cells with knockout or overexpression of METTL3 gene.

[0043] (6) Cell cycle and apoptosis assays: P2 generation H1944 cells with knockout or overexpression of the METTL3 gene were used to determine the cell cycle and apoptosis count, and were then subjected to a cell cycle and apoptosis assay at a rate of 1×10⁻⁶ cells / year. 5 Cells were seeded at a rate of 2 mL / well in 6-well plates and divided into two groups: a control group and a 10 μM Gefitinib group, with three replicates for each group. Cells were treated according to the kit instructions, and apoptosis (Cat#: AT101C, Lianke Biotechnology) and cell cycle (Cat#: CCS012, Lianke Biotechnology) were detected by flow cytometry to observe the effects of Gefitinib on cell cycle and apoptosis in H1944 cells with knockout or overexpression of the METTL3 gene.

[0044] II. Experimental Results 1. Knocking out the METTL3 gene promotes the killing effect of Gefitinib on lung cancer cells. In H1944 cells, knocking out the METTL3 gene also significantly inhibited EGFR expression. Figure 3 A) After knocking out the METTL3 gene, Gefitinib showed an IC50 effect on H1944 cells. 50 Significantly lower than the control ( Figure 3 B); Knocking out the METTL3 gene can effectively enhance the effect of Gefitinib on the growth and proliferation of H1944 cells. Figure 3 C) Cloning ability ( Figure 3 D) Invasion capability ( Figure 3 E) and migration ability ( Figure 3 The inhibitory effect of F); in addition, administration of Gefitinib to H1944 cells with knockdown of the METTL3 gene increased apoptosis. Figure 3 G).

[0045] 2. Overexpression of the METTL3 gene can enhance the resistance of lung cancer cells to Gefitinib. Overexpression of the METTL3 gene in H1975 cells can increase the protein expression level of EGFR (…). Figure 4 A) Overexpression of the METTL3 gene, Gefitinib's effect on the IC50 of H1975 cells 50 Significantly increased compared to the control ( Figure 4 B); Overexpression of the METTL3 gene can effectively weaken the effect of Gefitinib on the growth and proliferation of H1975 cells. Figure 4 C) Cloning ability ( Figure 4 D) Invasion capability ( Figure 4 E) and migration ability ( Figure 4 The inhibitory effect of Gefitinib (F); in addition, H1975 cells overexpressing the METTL3 gene can effectively resist the apoptotic effect of Gefitinib (F). Figure 4 G).

[0046] Example 3: Synergistic killing effect of STM2457 combined with Gefitinib on NSCLC cells I. Experimental Methods 1. The specific small molecule inhibitor STM2457 (CAS No.: 2499663-01-1) of METTL3 was detected according to the method in Example 2, and its effect on the IC50 of the seven NSCLC cell lines in Example 1 was evaluated. 50 Values. Seven NSCLC cell lines were treated with STM2457 according to the method in Example 2, and cell survival experiments were performed. The groups were set as follows: control group, 10 μM STM2457 group, and 20 μM STM2457 group.

[0047] 2. The IC50 of the combined use of STM2457 and Gefitinib on the seven NSCLC cell lines in Example 1 was detected according to the method in Example 2. 50 Value. Seven NSCLC cell lines were treated with a combination of STM2457 and Gefitinib according to the method in Example 2, and cell survival and cell colony formation experiments were performed. The groups were set as follows: control group, 10 μM STM2457, 10 μM Gefitinib and 10 μM STM2457+10 μM Gefitinib group.

[0048] 3. The inhibitory effect of the combined administration of STM2457 and Gefitinib on H1299 and H1944 cells was detected according to the method in Example 2, including the IC50 values ​​after administration to each cell type. 50, growth proliferation, colony formation ability, invasion ability, migration ability and apoptosis. The growth proliferation detection groupings are set as follows: control group, 2.5 μM STM2457 group, 5 μM STM2457 group, 5 μM Gefitinib group, 10 μM Gefitinib group and combined drug group (5 μM STM2457+2.5 μM Gefitinib, 5 μM STM2457+5 μM Gefitinib, 10 μM STM2457+2.5 μM Gefitinib, 10 μM STM2457+5 μM Gefitinib); other experimental groupings are set as follows: control group, 10 μM STM2457 group, 10 μM Gefitinib group and combined drug group (10 μM STM2457+10 μM Gefitinib).

[0049] 4. After confirming the inhibitory effect of METTL3 on NSCLC cells, STM2457, as a specific small molecule inhibitor of METTL3, is combined with EGFR inhibitor Gefitinib in the present application, and the synergy coefficient is calculated.

[0050] DMSO was used to prepare 50 mM STM2457 and 100 mM Gefitinib stock solutions. P2 generation H1299 cells and H1944 cells were taken, and when the cells reached 80% confluence, the cells were trypsinized at 0.25% (w / v), centrifuged, the supernatant was discarded, PBS was added for resuspension and cell counting. The cells were inoculated in a 96-well plate at 5000 cells / 100 μL / well, and after 12 h of 37°C, 5% CO2 culture, the medium containing STM2457, Gefitinib and combined drugs (2% v / v FBS) was replaced, and the final concentrations of single drugs were 0 μM, 1 μM, 5 μM, 10 μM, 20 μM, 40 μM, 60 μM and 100 μM, respectively. In the combined drug group, the concentrations of STM2457 and Gefitinib were the same, which were 0 μM+0 μM, 1 μM+1 μM, 5 μM+5 μM, 10 μM+10 μM, 20 μM+20 μM, 40 μM+40 μM, 60 μM+60 μM and 100 μM+100 μM, respectively. Each concentration was set in triplicate, and the culture was continued for 72 h. The supernatant was aspirated, 100 μL CCK8 detection solution (containing 10 μL CCK8 reagent+90 μL serum-free medium) was added per well, 37°C was kept for 2 h, and the OD 450 and OD 620 values (normalized well background) were detected and calculated by enzyme-labeled instrument. SynergyFinder+ and CompuSyn models were used to calculate the synergy coefficient, respectively.

[0051] II. Experimental results 1. Inhibitory effect of STM2457, a small molecule inhibitor of METTL3, on lung cancer cells. The IC50 of STM2457 in seven lung cancer cell lines... 50 The values ​​ranged from 14.67 to 20.77 μM. Figure 5 A); Cell survival experiments showed that STM2457 inhibited lung cancer cells in a concentration-dependent manner, meaning that the survival rate of lung cancer cells decreased significantly with increasing drug concentration. Figure 5 B); Cell survival and cell colony formation assays showed that the combination of STM2457 and the EGFR inhibitor Gefitinib had a synergistic inhibitory effect on lung cancer cell survival and cell colony formation. Figure 5 C and Figure 5 D).

[0052] 2. The killing effect of STM2457 and Gefitinib combined on lung cancer cells. After STM2457 administration, Gefitinib showed reduced activity against H1299 (… Figure 6 A) and H1944 Figure 6 B) IC50 of two lung cancer cell lines 50 Compared with the control, it showed a decreasing trend, and its IC50 decreased with increasing STM2457 concentration. 50 The value also gradually decreased; the combination of STM2457 and Gefitinib effectively inhibited the growth and proliferation of H1299 and H1944 cells compared with single drug therapy. Figure 6 C and Figure 6 D) Transferability Figure 6 E and Figure 6 G) and invasive capabilities ( Figure 6 F and 6H); after dual-drug combination therapy, apoptosis of lung cancer cells was significantly increased (F and 6H); Figure 6 I).

[0053] 3. For example Figure 7 As shown, the heatmap results calculated by the SynergyFinder+ model (synergy value meaning: synergy value > 10 indicates synergistic effect between drugs, i.e., the combined drug effect is better than the expected effect of the single drug; synergy value of -10 to 10 indicates that the drug effects may be additive or there is no obvious interaction; synergy value < -10 indicates antagonistic effect, i.e., the combined drug effect is lower than the expected effect of the single drug) show that STM2457 and Gefitinib have a synergistic inhibitory effect in the higher concentration range, with an average value of 61.67 for H1299 cells. Figure 7 A), the average value of H1944 cells was 56.62 ( Figure 7B). In addition, the synergy coefficients were calculated by four mathematical models in the SynergyFinder+ model, respectively. In H1299 cells, the synergy coefficients calculated by HAS (13.48) and Loewe (10.44) were greater than 10, showing synergistic inhibition to cells, and the synergy coefficients calculated by ZIP (4.45) and Bliss (3.98) were between -10 and 10, showing additive inhibition effect Figure 7 C). In H1944 cells, only HAS (13.23) showed synergistic inhibition, and the other three models (Loewe (7.66), ZIP (7.73), and Bliss (7.58)) showed additive inhibition effect Figure 7 D). In the CompuSyn model (CI value less than 1 indicates drug synergy; CI value greater than 1 indicates drug antagonism; the greater the absolute value, the stronger the effect), in H1299 cells, the synergy coefficient CI value of the two drugs was <1, 0.6079 at ED50, 0.4093 at ED75, 0.2986 at ED90, and 0.2520 at ED50; the visualization results of dose-effect diagram, Fa-CI diagram, and polygon diagram all showed that STM2457 and Gefitinib had strong synergistic inhibition effect on H1299 cells Figure 7 E). In H1944 cells, the synergy coefficient CI value of the two drugs was <1, 0.5742 at ED50, 0.3397 at ED75, 0.2020 at ED90, and 0.1423 at ED50; similarly, the visualization results of dose-effect diagram, Fa-CI diagram, and polygon diagram all showed that STM2457 and Gefitinib had strong synergistic inhibition effect on H1944 cells Figure 7 F).

[0054] Example 4: STM2457 and Gefitinib combination therapy for NSCLC cell xenograft mice I. Experimental methods 1. Cell expansion culture: P2 generation H1299 cells were taken and inoculated into a new culture dish at a cell to complete medium volume ratio of 1:3 for cell expansion culture, which was recorded as P3 generation cells. When the cell confluence reached 80%, the culture medium was removed by negative pressure pump, the cells were washed with PBS twice, the PBS was aspirated, 0.25% (w / v) trypsin was added to digest the cells, an equal volume of complete medium was added to terminate digestion, and the cells were transferred to a 15 mL centrifuge tube and centrifuged at 1000 rpm for 2 min. The cells were resuspended with PBS-Matrigel mixture (volume ratio of PBS to Matrigel was 1:1) and counted, and the cell concentration was adjusted to 10 x 10 7 6 / mL.

[0055] 2, Construction of mouse lung cancer tumor model. Subcutaneously inject P3 cells into nude mice at a dose of 1 x 10 7 mm when the tumor volume is about 50mm 3 (about 7-10 days), and obtain the mouse lung cancer tumor model.

[0056] 3, Drug administration. Prepare 50 mg / mL STM2457 and 100 mg / mL gefitinib stock solutions with 0.5% (w / v) sodium carboxymethyl cellulose (CMC-Na) solution. Divide the mouse lung cancer tumor model into four groups: Ctrl group (0.5% CMC-Na solution), STM2457 group (50 mg / kg), Gefitinib group (100 mg / kg), and combination group (STM2457 (50 mg / kg) + Gefitinib (100 mg / kg)). Weigh the mice, and prepare the appropriate volume of drug according to the inoculation amount and supplement with 0.5% CMC-Na solution to a total volume of 200 μL. The drug administration volume for each mouse is 200 μL, and the drug is administered by gavage. For example, if the mouse weighs 20 g, then the volume of STM2457 stock solution is V = 50 mg / mL ÷ (50 mg / kg x 0.02 kg) = 0.02 mL, and the single-drug group needs to supplement 180 μL of 0.5% CMC-Na solution to a total volume of 200 μL. The drug is administered every other day for 21 consecutive days.

[0057] 4, Record the mouse state and tumor growth. Weigh the mice and record the body weight at each drug administration, and measure the size of the tumor with a vernier caliper and record the length (Length, L) and width (Width, W) of the tumor. Calculate the tumor volume V according to the following formula: V = 1 / 2 x L x W2.

[0058] 5, Collect mouse-related tissues and perform paraffin-embedded sectioning.

[0059] (1) Paraffin block preparation ① Washing and fixing: after the end of administration, the mice were sacrificed by decapitation, and the subcutaneous tumor and submandibular lymph node tissue blocks of the mice were collected, washed with pre-cooled PBS for 3 times, and immersed in 4% (w / v) paraformaldehyde for 24 h to obtain fixed tissue blocks; ② Dehydration and transparency: the fixed tissue blocks were placed in a full-automatic dehydration instrument and sequentially subjected to the following dehydration treatment: 70% (v / v) ethanol for 1 h, 85% (v / v) ethanol for 1 h, 95% (v / v) ethanol for 30 min x 2 times, 100% (v / v) ethanol for 30 min x 2 times, environmental protection dewaxing agent for 30 min x 2 times, 60°C paraffin for 1 h, to obtain dehydrated tissue blocks; ③ Embedding: the dehydrated tissue blocks were placed in embedding molds, 60°C paraffin was added, and the tissue blocks were adjusted to be centered and embedded completely. After the molds were taken out after the freezing table was placed to solidify, paraffin blocks were obtained and stored in a -20°C refrigerator for standby.

[0060] (2) Paraffin sectioning ① Pre-cooling: the paraffin block was pre-cooled on ice for 1 h, and a water bath was preheated at 42°C; ② Sectioning: the direction of the paraffin block was adjusted on the sectioning machine, the section was trimmed to be flat, and the sectioning thickness was 5 μm; ③ Unrolling, dividing and fishing: the section was carefully transferred to a 42°C water bath for unrolling, and when the section was flat and the tissue was not wrinkled, the section was fished on a glass slide and drained (the sectioning speed should not be too fast, and the sectioning speed should be uniform); ④ Baking: the section was baked in a 65°C oven for about 1-2 h, the solid wax was melted, and the paraffin section was obtained, which was stored in a 4°C or -20°C refrigerator for standby after cooling.

[0061] (3) Pathological staining a. Hematoxylin-eosin (H&E) staining of paraffin sections: ① De-waxing: environmental protection dewaxing agent was treated for 10 min x 2 times; ② Sequentially subjected to the following hydration treatment: 100% (v / v) ethanol for 5 min x 2 times, 95% (v / v) ethanol for 5 min, 85% (v / v) ethanol for 5 min, 70% (v / v) ethanol for 5 min, and water for 10 min; ③ Sequentially subjected to the following nuclear staining treatment: hematoxylin staining for 1-2 min, water washing for 5 min, differentiation solution differentiation for 30 s, and water washing for 10 min; ④ Sequentially subjected to the following cytoplasmic staining treatment: eosin staining solution for 30 s, and water washing for 10 min; ⑤ Sequentially subjected to the following dehydration and mounting treatment: anhydrous ethanol for 2 min x 2 times, environmental protection dewaxing agent for 5 min x 2 times, air drying, and neutral resin mounting.

[0062] b. Immunohistochemical staining (IHC): ① De-waxing and hydration: same as the method of de-waxing and hydration in step (3); ② Antigen retrieval: antigen retrieval was performed using microwave retrieval method. The sections were placed in 1x EDTA antigen retrieval solution and treated with high fire in the microwave oven for 5 min, stopped for 3 min, then treated with medium fire for 5 min, and naturally cooled to room temperature, PBS rinsed the sections for 5 min x 3 times. 3% (v / v) H2O2 was incubated in the dark for 10 min to inactivate endogenous peroxidase, and the sections were rinsed with PBS for 5 min x 3 times. ③ Blocking: draw a circle along the tissue periphery with a brush, and drop 5% (v / v) BSA (blocking solution) for blocking, incubate at 37°C for 30 min or at room temperature for 2 h. ④ Incubate primary antibody: shake off the blocking solution, drop 20 μL of diluted primary antibody working solution (diluted with 5% BSA according to the corresponding instructions of each antibody) to completely cover the tissue, incubate at 4°C overnight or at 37°C for 1-3 h; the primary antibody working solution contains anti-METTL3 (Cat#: 67733-1-Ig, Proteintech), anti-EGFR (Cat#: 66455-1-Ig, Proteintech), anti-Ki67 (cell proliferation marker) (Cat#: 28074-1-AP, Proteintech), anti-Cleaved Caspase3 (cell apoptosis marker) (Cat#: 25128-1-AP, Proteintech), and anti-pan-Cytokeratin (epithelial cell marker) (Cat#: ab7753, Abeam). ⑤ Incubate secondary antibody: PBS rinse the sections for 5 min x 3; drop 20 μL of secondary antibody working solution, incubate at 37°C for 30 min; PBS rinse the sections for 5 min x 3; ⑥ DAB color development: prepare DAB color development working solution according to the instructions of the kit (Cat#: AR1027, Boster), mix well and drop onto the tissue, observe under a microscope to control the color development time, after color development, rinse with deionized water to stop color development; ⑦ Counterstaining and blueing back: use hematoxylin counterstaining for 5-10 s, rinse with running water for 15 min to blue back; ⑧ Dehydration and mounting: immerse the sections in 70% (v / v), 85% (v / v), 95% (v / v) and 100% ethanol for 2 min each, use environmental protection de-waxing agent for 5 min x 2 times, mount with neutral resin, dry and store for use.

[0063] c. Quantitative Statistical Analysis of Staining Results: Immunohistochemical staining employed a semi-quantitative scoring method to determine staining intensity and the proportion of positive cells. The proportions of positive cells were 0%, <10%, 10%–50%, and >50%, respectively scored as 0, 1, 2, and 3 points. Staining intensity was scored as 0 (negative), 1 (weakly positive), 2 (moderately positive), and 3 (strongly positive). The immunoreactivity score (IHS) was calculated by multiplying the positive cell proportion score by the staining intensity score. Tissue with an IHS of 0 was defined as unstained, while tissues with IHS scores of 1, 2, and ≥3 were defined as weakly stained, moderately stained, and strongly stained, respectively.

[0064] II. Experimental Results The combined use of STM2457 and Gefitinib effectively inhibited tumorigenesis and growth of lung cancer cells in mice. Figure 8 A. The tumor formation and drug administration process in mice were investigated; after combined administration of STM2457 and Gefitinib, the growth rate and size of subcutaneous lung cancer cells in mice were significantly reduced compared to the control group. Figure 8 B and Figure 8 C); final tumor weight after combined administration ( Figure 8 D) and tumor volume ( Figure 8 E) were significantly lower than those in the control group and the single-drug group; tissue staining (H&E) and immunohistochemical staining (IHC) showed that the expression of METTL3, EGFR and Ki67 (cell proliferation markers) was significantly decreased and the expression of Caspase3 (apoptosis marker) was significantly increased after combination therapy. Figure 8 F); H&E and IHC experiments on the submandibular lymph nodes of mice showed that the pan-CK (epithelial cell marker) in the control group and the single-drug group was significantly positive compared with that in the combination drug group, indicating that the combination drug effectively inhibited the metastasis of lung cancer cells. Figure 8 G).

[0065] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. The application of METTL3 inhibitors and gefitinib in the preparation of drugs for the prevention and treatment of lung cancer, characterized in that, The METTL3 inhibitor is STM2457 or shRNA, the CAS number of STM2457 is 2499663-01-1, and the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1-3.

2. The application as described in claim 1, characterized in that, The lung cancers mentioned include non-small cell lung cancer.

3. The application as described in claim 1, characterized in that, The drug inhibits the growth of lung cancer tumors.

4. The application as described in claim 1, characterized in that, The drug inhibits lung cancer tumor metastasis.

5. The application as described in claim 1, characterized in that, The drug inhibits the growth and proliferation of lung cancer cells.

6. The application as described in claim 1, characterized in that, The drug inhibits the formation of lung cancer cell clones.

7. The application as described in claim 1, characterized in that, The drug inhibits the invasive and / or migratory abilities of lung cancer cells.

8. The application as described in claim 1, characterized in that, The drug promotes apoptosis in lung cancer cells.

9. A drug for the prevention and treatment of lung cancer, characterized in that, The drug contains a METTL3 inhibitor and gefitinib. The METTL3 inhibitor is STM2457 or shRNA. The CAS number of STM2457 is 2499663-01-1. The nucleotide sequence of the shRNA is shown in SEQ ID NO: 1-3.

10. The medicament as claimed in claim 9, characterized in that, The drug also contains pharmaceutically acceptable excipients and / or carriers.

Images