DNA aptamer for identifying microbial transglutaminase and screening method thereof

Abstract

The invention discloses a DNA aptamer for recognizing microbial transglutaminase and a screening method of the DNA aptamer, and belongs to the technical field of molecular biological detection. According to the invention, the high-affinity and high-specificity DNA aptamer aiming at microbial transglutaminase (MTGase) is obtained through screening for the first time, and the blank of the target in the aptamer recognition field is filled. The reverse screening step is introduced in the screening process, so that non-specific binding sequences with coexisting proteins are effectively removed, and the selectivity of the aptamer is remarkably improved. By combining multiple means such as FP, ITC, CD and molecular docking, the binding capacity and mechanism of the aptamer are systematically verified, and the reliability and scientificity of a screening result are ensured. The obtained aptamer has excellent affinity with MTGase, the dissociation constant can reach the nanomole level, and a molecular basis is provided for subsequent development of related recognition and detection technologies.

Description

Technical Field

[0001] This invention relates to a DNA aptamer for identifying microbial transglutaminase and a screening method thereof, belonging to the field of molecular biological detection technology. Background Technology

[0002] Microbial transglutaminase (MTGase) is a calcium-independent acyltransferase that catalyzes the formation of amide bonds between protein molecules, promoting cross-linking reactions between glutamine and lysine residues, thereby improving protein structural stability, gelation properties, water retention, and thermal stability. MTGase is widely used in the food industry, such as for reconstituted meat, enhancing gluten structure, and improving dairy product texture, and has high commercial value. However, recent studies have indicated that the use of MTGase in food may pose a series of safety risks. First, the protein cross-linking structure induced by MTGase may affect the normal digestion and absorption of proteins by the human body, increasing the risk of potential immune responses. Second, its structure has certain similarities to human transglutaminase, and some studies suggest a possible correlation with certain autoimmune diseases (such as celiac disease). Furthermore, MTGase in products such as "reconstituted meat" may mask raw material quality problems, leading to consumer fraud. Currently, the detection of MTGase mainly relies on HPLC-MS / MS and ELISA. The former (high sensitivity) method is expensive, complex to operate, and has a long detection cycle; the latter (simple operation) method is costly to prepare antibodies, has poor stability, and is easily affected by complex matrices. Therefore, there is an urgent need to develop a detection method that is highly sensitive, low-cost, and suitable for complex samples to meet practical needs.

[0003] Nucleic acid aptamers are single-stranded DNA or RNA molecules with specific spatial structures obtained through in vitro screening. They can recognize various targets, including proteins, small molecules, and cells, with high affinity and high specificity. Compared with traditional antibodies, aptamers have several significant advantages: their synthesis is entirely chemically based, avoiding animal immune responses and batch-to-batch variability; they are structurally stable and not easily inactivated; they are easy to modify and label, adaptable to various detection platforms; and they have short synthesis cycles and low costs, making them suitable for large-scale preparation. Furthermore, aptamers maintain strong functional activity under conditions of high temperature, high salt, and high pH, ​​and exhibit good stability and adaptability in complex samples (such as food matrices). Currently, there are no publicly reported nucleic acid aptamers that can efficiently recognize microbial transglutaminase. Therefore, developing a high-affinity, high-specificity MTGase aptamer molecule is helpful in constructing a sensitive biological detection platform, possessing clear scientific value and application prospects. Summary of the Invention

[0004] To address the shortcomings of the prior art, this invention provides a DNA aptamer for identifying microbial transglutaminase and a screening method thereof, aiming to solve the problem of the lack of nucleic acid aptamers that can specifically recognize MTGase in the prior art.

[0005] The first technical solution provided by the present invention is a microbial transglutaminase aptamer, wherein the aptamer contains a polynucleotide with a nucleotide sequence as described in SEQ ID NO.1.

[0006] In some embodiments, the aptamer may be connected to a functional group or molecule.

[0007] Optionally, the functional group or molecule may be attached to the 5' end or 3' end of the aptamer.

[0008] In some embodiments, the functional group or molecule may be an isotope, a fluorescent marker, a chemiluminescent marker, a bioluminescent marker, an enzyme marker, a magnetic substance, biotin, an affinity ligand, and / or a thiol group.

[0009] The second technical solution provided by this invention is a method for screening microbial transglutaminase-specific aptamers, specifically including the following steps:

[0010] (1) An immobilized library was prepared by using biotin-labeled capture sequences and streptavidin magnetic beads;

[0011] (2) The immobilized library was incubated with the target and eluted for positive and negative screening;

[0012] (3) Perform PCR amplification, purification and enzyme digestion on the elution supernatant from step (2) to prepare a single-stranded DNA library;

[0013] (4) The single-stranded DNA library was screened in multiple rounds and enrichment rate was monitored and high-throughput sequencing was performed to obtain candidate sequences;

[0014] (5) Verify the affinity and specificity of the candidate sequences to obtain microbial transglutaminase-specific aptamers.

[0015] In some embodiments, step (1) specifically involves linking a random ssDNA library with a fixed region to streptavidin magnetic beads using a biotin-labeled capture sequence to obtain an immobilized ssDNA library. The ssDNA library is: 5′-AATCAAACGCTAAGG-N10-GTGCACCCATTCTTG-N30-AAGCTTGGTACCCGTATCGT-3′, and the biotin-labeled capture sequence is 5′-biotin-CAAGAATGGGTGCAC-3′.

[0016] In some embodiments, step (2) specifically involves fully incubating the MTGase protein solution with the immobilized ssDNA library to allow it to bind to a specific sequence, followed by elution, magnetic separation, and collection of the supernatant as a template for PCR amplification.

[0017] In some embodiments, step (3) specifically involves performing PCR amplification on the elution supernatant and purifying the PCR product, preparing a single-stranded DNA library using Lambda exonuclease, and using the following PCR amplification conditions: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 2 min, and storage at 4°C.

[0018] In some implementations, step (4) specifically involves performing multiple rounds of screening on the single-stranded DNA library. After reverse screening in rounds 9 and 11, the enrichment rate approaches 70% in round 12, at which point the screening is terminated. The enriched libraries from rounds 10 and 12 are then subjected to high-throughput sequencing, and candidate aptamers are determined based on the sequencing results for subsequent functional verification.

[0019] In some implementations, step (5) specifically involves analyzing the affinity and specificity of candidate aptamers based on isothermal titration calorimetry and fluorescence polarization method, and selecting the sequence with the strongest affinity and the best specificity as the aptamer for the target.

[0020] In some implementations, step (6) is specifically a study of the binding mechanism: using circular dichroism spectroscopy and molecular docking simulation, the conformational changes and binding regions of the aptamer binding to microbial transglutaminase are studied.

[0021] Using the above method, the present invention successfully screened out MTGase aptamers with high affinity and specificity, the sequence of which is 5'-AATCAAACGCTAAGGCCCATCCGGGGTGCACCCATTCTTGGTACTCCCATTCCGGTGA TTGAGGTGTAGAAAGCTTGGTACCCGTATCGT-3' (SEQ ID NO.1).

[0022] The third technical solution provided by the present invention is a probe, wherein the probe is a substance obtained by labeling the microbial transglutaminase aptamer described in the first technical solution with a labeling agent.

[0023] In some implementations, a marker refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) signal and can be linked to a nucleic acid aptamer. Markers include, but are not limited to, dyes; radioactive markers, such as... 32P; conjugated coupling groups, such as biotin; haptens, such as digoxigenin (DIG); chemiluminescent, phosphorescent, or fluorescent portions; fluorescent dyes alone or in combination with portions that can inhibit or shift the emission spectrum via fluorescence resonance energy transfer (FRET). Labels can provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric analysis, quantum dots, electrochemistry, X-ray diffraction or absorption, magnetism, enzyme-linked immunosorbent assays (ELISA), filter paper-based immunoassays, affinity precipitation, affinity chromatography, enzyme activity, projection microscopy or scanning imaging, super-resolution imaging, cell tracing, in vivo nanoparticle tracing imaging in animals or humans, nanoflow cytometry, tunable resistance pulse sensing, fluorescence-correlated spectroscopy, surface plasmon resonance, fluorescence polarization, surface-enhanced Raman spectroscopy, electrochemical sensing, microfluidics or microfluidics, microarray analysis, proteomics, genomics, metabolomics, microbiomics, RNA (mRNA, inRNA, snRNA, miRNA), etc. Labels can be charged portions (positive or negative) or selected as needed, and can be charge-neutral. The label may include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without a label (e.g., direct sequence reading). The label may also be used for targeted drug delivery.

[0024] In some embodiments, the label is a fluorophore, colorimetric label, quantum dot, biotin, and other tag molecules that can be used for detection (such as alkyne groups for Raman scattering imaging, cycloalkenes for click chemistry, and initiating groups for polymer labeling). It can also be selected from peptide / protein molecules, LNA / PNA, non-natural amino acids and their analogs (such as peptides), non-natural nucleic acids and their analogs (nucleotides), and nanostructures (including inorganic nanoparticles, NV centers, aggregation / assembly-induced luminescent molecules, rare earth ion ligand molecules, polyoxometalates, etc.).

[0025] In some embodiments, the fluorophore may be selected from fluorescein dyes, rhodamine dyes, and other common dyes.

[0026] In some embodiments, fluorescein dyes include standard fluorescein and its derivatives, such as fluorescein isocyanate (FITC), fluorescein hydroxyapatite (FAM), tetrachlorofluorescein (TET), Cy5, Cy3, Quasar 670, Alexa Fluor 488 / 647, etc.

[0027] In some embodiments, the rhodamine dyes include R101, tetraethylrhodamine (RB200), or carboxytetramethylrhodamine (TAMRA), etc.

[0028] In some embodiments, the dyes are mainly selected from two categories: one is the thiazole orange (TO), oxazole orange (YO) series and their dimer dyes, and the other is the polymethyl cyanine dye series.

[0029] In some embodiments, the fluorophore may also be selected from the following dyes: stilbene, naphthaleneimide, coumarin, acridine, pyrene, etc.

[0030] The fluorophore is usually labeled at the 5' end of the probe sequence, but it can also be placed at the 3' end by changing the modifying bond (e.g., -OH or -NH bond).

[0031] The fourth technical solution provided by the present invention is a cell containing the aptamer described in the first technical solution or the probe described in the third technical solution.

[0032] In some embodiments, the cell may be an animal cell, a plant cell, or a microbial cell.

[0033] The fifth technical solution provided by the present invention is a biosensor, wherein the biosensor contains the aptamer described in the first technical solution or the probe described in the third technical solution.

[0034] The sixth technical solution provided by the present invention is a product for detecting microbial transglutaminase, wherein the product contains the aptamer described in the first technical solution or the probe described in the third technical solution.

[0035] In some embodiments, the product is a reagent or a kit.

[0036] The seventh technical solution provided by the present invention is a method for detecting microbial transglutaminase. The method includes labeling a reporter group on the aptamer described in the first technical solution, allowing the aptamer labeled with the reporter group to interact with the sample to be tested, and detecting microbial transglutaminase by detecting the signal of the reporter group.

[0037] The eighth technical solution provided by the present invention is the application of the aptamer described in the first technical solution, the probe described in the third technical solution, the cell described in the fourth technical solution, or the biosensor described in the fifth technical solution in the detection of microbial transglutaminase.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] This invention provides the first screening of high-affinity and high-specificity DNA aptamers targeting microbial transglutaminase (MTGase), filling a gap in aptamer recognition for this target. A reverse screening step was introduced during the screening process to effectively eliminate non-specific binding sequences to coexisting proteins, significantly improving aptamer selectivity. The binding ability and mechanism of the aptamers were systematically validated using multiple methods, including FP, ITC, CD, and molecular docking, ensuring the reliability and scientific validity of the screening results. The obtained aptamers exhibit excellent affinity for MTGase, with dissociation constants of 1.14±0.43 μM and 24.32±5.85 nM determined by ITC and FP methods, respectively. These dissociation constants are in the nanomolar range, providing a molecular basis for the subsequent development of related recognition and detection technologies. Attached Figure Description

[0040] Figure 1 This is a schematic diagram illustrating the screening principle of this method.

[0041] Figure 2 It is the secondary structure of the candidate aptamer.

[0042] Figure 3 This is the specificity analysis of S1 and S2 using the FP method.

[0043] Figure 4 These are the CD spectra of S1 before and after binding to the target.

[0044] Figure 5 This is the result of S1 docking with the target molecule. Detailed Implementation

[0045] refer to Figures 1-4 The preferred embodiments of the present invention will be described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0046] Raw materials used in the examples:

[0047] The reagents and raw materials used in this invention are as follows: microbial transglutaminase was purchased from Maclean's Ltd.; ready-to-use O'RangeRuler 10bp DNA molecular weight standard kit was purchased from Dynabeads. TMM-270 streptavidin magnetic beads were purchased from Thermo Fisher Scientific; acrylamide / bisacrylamide (30% solution), N,N,N',N'-tetramethylethylenediamine (TEMED) were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.; urea was purchased from Maclean's Biochemical Technology Co.; Lambda exonuclease (5000 U / mL) and 10× Lambda exonuclease reaction buffer were purchased from New England BioLabs; streptavidin, Taq Plus DNA polymerase, 2×TBE-urea sampling buffer, and dNTP mixture (25 mM solution) were purchased from Sangon Biotech (Shanghai) Co., Ltd. All DNA strands were synthesized and purified (HPLC) by Sangon Biotech Co.

[0048] Example 1: Screening of MTGase aptamers

[0049] 1. ssDNA library fixation

[0050] The randomized library (AATCAAACGCTAAGG-N10-GTGCACCCATTCTTG-N30-AAGCTTGGTACCCGTATCGT) and the biotin-modified capture probe (5′-biotin-CAAGAATGGGTGCAC-3′) were denatured in STE buffer at a final concentration of 1:1.5 for 5 minutes at 95°C and cooled to room temperature for 15 minutes. Subsequently, the library was incubated with pre-washed streptavidin-coated magnetic beads at 37°C and 200 rpm for 2 hours to immobilize the library on the magnetic bead surface.

[0051] 2. Target incubation and elution

[0052] The magnetic beads immobilized with the ssDNA library were incubated with binding buffer containing 50 μg / mL MTGase at 37°C and 200 rpm for 2 hours to allow the specific sequence to bind to the target. After magnetic separation, the supernatant was collected as a template for PCR amplification.

[0053] 3. PCR amplification and product purification

[0054] The eluted enriched sequences were amplified by PCR in 50 μL reaction buffer containing 2 μL ssDNA template, 0.5 μL Taq DNA polymerase (5 U / μL), 5 μL 10× polymerase buffer, 0.5 μL of each primer (FAM-labeled forward primer (5′-FAM-AATCAAACGCTAAGG-3′), reverse primer (5′-phosphate-ACGATACGGGTACCAAGCTT-3′), 10 μM), 1 μL dNTP mixture (5 mM), and 40.5 μL sterile water. Amplification conditions were: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 2 min, and storage at 4℃. The PCR products were purified to remove excess short-chain nucleic acids, dNTPs, ions, and salts from the amplification reaction system.

[0055] 4. Single-chain preparation

[0056] Lambda exonuclease and its buffer were added to the purified PCR product and mixed thoroughly. The mixture was incubated at 37°C until the exonuclease completely cleaved the phosphate-modified reversed nucleic acid strand. After complete digestion, the reaction was terminated at 75°C for 10 min. The digested product was identified using an 8% denaturing polyacrylamide gel electrophoresis. Finally, the ssDNA was purified by ethanol precipitation and collected as the next library.

[0057] 5. Enrichment rate monitoring and high-throughput sequencing

[0058] Enrichment efficiency was monitored using fluorescent labeling in each round of screening. Back-screening was performed in rounds 9 and 11 using soy protein isolate (SPI). Due to its high protein content (≥90%), good functionality, and cost advantages, soy protein isolate (SPI) is widely used in meat products, dairy substitutes, baked goods, snack foods, and nutritional supplements, primarily to increase protein content, improve texture, or replace animal protein. In ham sausages, sausages, fish balls, and vegetarian meat, SPI can improve the product's water-holding capacity, emulsification, and elasticity. In plant-based protein drinks, plant-based yogurt, and high-protein beverages, SPI can partially or completely replace milk protein, providing a rich protein source. In bread, cakes, and gluten products, SPI helps improve leavening and texture. Furthermore, SPI is widely used in protein bars, meal replacement powders, and nutritional foods for the elderly as an important plant protein supplement. Therefore, back-screening with soy protein isolate effectively removes interfering background from the food matrix and improves detection specificity.

[0059] The enrichment rate approached 70% in round 12, at which point screening was terminated. The enriched libraries from rounds 10 and 12 were subjected to high-throughput sequencing. Four candidate aptamers, S1 (SEQ ID NO.1), S2 (SEQ ID NO.2), S3 (SEQ ID NO.3), and S4 (SEQ ID NO.4), were selected based on secondary structure, free energy (ΔG), and sequence frequency for affinity and specificity experiments (Table 1). Figure 2 ).

[0060] Table 1. Basic Information on Candidate Aptamer Sequences

[0061]

[0062] Example 2: Affinity and Specificity Analysis of Candidate Aptamers

[0063] 1. Assess aptamer binding capacity by isothermal titration calorimetry (ITC).

[0064] MTGase and its aptamer were dissolved in 10 mM Tris-HCl buffer. 70 μL of 80 μM aptamer solution was loaded into a syringe, and 300 μL of 6 μM MTGase solution was added to the sample cell. The first injection was 0.4 μL, followed by 2 μL injections each time, for a total of 18 injections at 150 s intervals. The mixture was stirred at 750 rpm to ensure complete mixing after each injection. The corrected isothermal binding curves were fitted using the unit point binding model in the MicroCal PEAQ-ITC analysis software to obtain binding affinity and thermodynamic parameters.

[0065] 2. Verification of affinity and specificity using fluorescence polarization (FP) method.

[0066] A series of MTGase solutions (10–200 nM) were incubated with 5'-FAM-labeled candidate aptamers (5 nM) in BB buffer at 37°C in the dark for 2 hours. After incubation, fluorescence polarization was measured using a multi-functional plate reader. A blank control was performed under the same conditions using BB buffer instead of MTGase. The change in fluorescence polarization (ΔFP) was calculated as ΔFP = FP1 - FP0, where FP0 is the polarization of the control and FP1 is the polarization of the test group. The dissociation constant (Kd) was determined using GraphPad Prism 8.0 software via nonlinear fitting. To assess specificity, MTGase was replaced with structural analogs or potentially coexisting proteins, including β-conglycinin, glycinin, gliadin, casein, bovine serum albumin, and chicken ovalbumin, under the same conditions.

[0067] 3. Select candidate sequences with high affinity and good specificity as the best aptamers for the target.

[0068] The affinity results determined by the ITC and FP methods are consistent. As shown in Table 2, S1 has a lower dissociation constant and exhibits higher affinity for the target compared to other candidate aptamers. Specificity analysis results for S1 and S2 are as follows: Figure 3 As shown, both aptamers clearly distinguished between MTGase and non-target proteins, confirming their specificity. The relative binding rates of S1 to β-conglycinin, glycinin, gliadin, casein, bovine serum albumin, and chicken ovalbumin were all less than 25%. This indicates that aptamer S1 has low cross-reactivity with coexisting or structurally similar molecules. Therefore, S1, which specifically binds to MTGase and has high affinity, was selected for further investigation.

[0069] Table 2 Results of affinity determination for candidate aptamers

[0070] sequence ITC method for determining affinity (μM) FP method for determining affinity (nM) S1 1.14±0.43 24.32±5.85 S2 2.61±1.27 55.87±12.31 S3 2.80±1.96 72.0±17.39 S4 5.72±26.7 /

[0071] Example 3: Analysis of the optimal aptamer-target binding mechanism

[0072] 1. Circular dichroism (CD) spectroscopy analysis of conformational changes after aptamer binding

[0073] A mixture of 4 μM MTGase and 5 μM S1 aptamer was prepared in BB buffer and incubated at 37 °C and 200 rpm for 2 h. Baseline signals of the BB buffer and the 4 μM MTGase in the BB buffer were recorded and subtracted from the final spectrum. CD spectra were recorded in the 220–320 nm range at room temperature. Figure 4 As shown, after S1 binds to MTGase, the CD signal at 276 nm increases. This may be due to the enhanced base stacking within the hairpin structure caused by the aptamer-MTGase interaction, resulting in a more compact conformation.

[0074] 2. Analysis of aptamer-target binding sites based on molecular docking

[0075] The protein structure of MTGase was obtained from the RCSB PDB database (https: / / www.rcsb.org / , PDB ID: 1IU4), with a resolution of [resolution missing]. Water molecules were removed before docking. To construct the 3D structure of the aptamer, its secondary structure and Vienna format were first predicted using the Mfold online web server (http: / / unafold.rna.albany.edu / ?q=mfold), and then the 3D structure with the optimal predicted energy was generated using the RNAcomposer online tool. The final 3D conformation was obtained by mutagenizing a U base to a T base. Molecular docking experiments were performed using HDOCK Server, and the optimal docking model was selected by docking score selection. The docking results are shown below. Figure 5 As shown, there are 21 binding sites on S1 (C-18, A-19, T-20, C-21, C-22, G-23, G-24, T-60, T-61, G-62, A-63, G-64, G-65, T-66, G-67, T-68, A-69, G-70, A-71, A-72, A-73), which mainly bind to MTGase through non-covalent interactions such as hydrogen bonds and salt bridges.

[0076] Example 4: Application of aptamers

[0077] The aptamer S1 obtained in Example 2 was labeled with a marker to obtain a probe. The marker refers to any atom or molecule that can provide a detectable (preferably quantifiable) signal and can be linked to a nucleic acid aptamer. Markers include, but are not limited to, dyes; radioactive markers, such as... 32P; conjugated coupling groups, such as biotin; haptens, such as digoxigenin (DIG); chemiluminescent, phosphorescent, or fluorescent portions; fluorescent dyes alone or in combination with portions that can inhibit or shift the emission spectrum via fluorescence resonance energy transfer (FRET). Labels can provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric analysis, quantum dots, electrochemistry, X-ray diffraction or absorption, magnetism, enzyme-linked immunosorbent assays (ELISA), filter paper-based immunoassays, affinity precipitation, affinity chromatography, enzyme activity, projection microscopy or scanning imaging, super-resolution imaging, cell tracing, in vivo nanoparticle tracing imaging in animals or humans, nanoflow cytometry, tunable resistance pulse sensing, fluorescence-correlated spectroscopy, surface plasmon resonance, fluorescence polarization, surface-enhanced Raman spectroscopy, electrochemical sensing, microfluidics or microfluidics, microarray analysis, proteomics, genomics, metabolomics, microbiomics, RNA (mRNA, inRNA, snRNA, miRNA), etc. Labels can be charged portions (positive or negative) or selected as needed, and can be charge-neutral. The label may include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without a label (e.g., direct sequence reading). The label may also be used for targeted drug delivery. Specifically, the label is a fluorophore, colorimetric label, quantum dot, biotin, and other tag molecules that can be used for detection (e.g., alkyne groups for Raman scattering imaging, cycloalkenes for click chemistry, initiating groups for polymer labeling), or may be selected from peptide / protein molecules, LNA / PNA, non-natural amino acids and their analogs (e.g., peptides), non-natural nucleic acids and their analogs (nucleotides), and nanostructures (including inorganic nanoparticles, NV centers, aggregation / assembly-induced luminescent molecules, rare earth ion ligand molecules, polyoxometalates, etc.). The fluorophore may be selected from fluorescein dyes, rhodamine dyes, and other common dyes. Specifically, fluorescein dyes include standard fluorescein and its derivatives, such as FITC, FAM, TET, Cy5, Cy3, Quasar 670, and Alexa Fluor 488 / 647. Rhodamine dyes include R101, tetraethylrhodamine (RB200), or carboxytetramethylrhodamine (TAMRA). Fluorescein dyes are mainly selected from two categories: thiazole orange (TO), oxazole orange (YO) series and their dimer dyes, and polymethyl cyanine dyes. Fluorescein can also be selected from the following dyes: stilbene, naphthimide, coumarin, acridine, pyrene, etc. Fluorescein is usually labeled at the 5′ end of the probe sequence, but it can also be placed at the 3′ end by changing the modifying bond (e.g., -OH or -NH bond).

[0078] The aforementioned aptamers or probes can also be used to prepare products with the function of detecting MTGase, including cells, biosensors, reagents, or kits.

[0079] The method for detecting glutaminase in the above-mentioned products specifically involves labeling a reporter group onto an aptamer S1, allowing the aptamer labeled with the reporter group to interact with the sample to be tested, and detecting glutaminase by detecting the signal of the reporter group.

[0080] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A microbial transglutaminase aptamer, characterized in that, The aptamer contains a polynucleotide with a nucleotide sequence as described in SEQ ID NO.

1.

2. The aptamer according to claim 1, characterized in that, The aptamer may be connected to a functional group or molecule, which may be connected to the 5' end or the 3' end of the aptamer; the functional group or molecule may be an isotope, a fluorescent marker, a chemiluminescent marker, a bioluminescent marker, an enzyme marker, a magnetic substance, biotin, an affinity ligand and / or a thiol group.

3. A method for screening microbial transglutaminase-specific aptamers, characterized in that, Specifically, the following steps are included: (1) A random ssDNA library with a fixed region is ligated to streptavidin magnetic beads using a biotin-labeled capture sequence to obtain an immobilized ssDNA library, wherein the ssDNA library is: 5′-AATCAAACGCTAAGG-N10-GTGCACCCATTCTTG-N30-AAGCTTGGTACCCGTATC GT-3′, the biotin-tagged capture sequence is 5′-biotin-CAAGAATGGGTGCAC-3′; (2) Specifically, the MTGase solution is fully incubated with the immobilized ssDNA library for positive and negative screening, followed by elution, magnetic separation, and collection of the supernatant as a template for PCR amplification. (3) Perform PCR amplification on the elution supernatant from step (2), purify the PCR product, and prepare a single-stranded DNA library using Lambda exonuclease. (4) The single-stranded DNA library was screened in multiple rounds and enrichment rate was monitored and high-throughput sequencing was performed to obtain candidate sequences; (5) The affinity and specificity of candidate aptamers were analyzed based on isothermal titration calorimetry and fluorescence polarization method. The sequence with strong affinity and the best specificity was selected as the microbial transglutaminase specific aptamer.

4. The method according to claim 3, characterized in that, It also includes step (6), which specifically involves studying the conformational changes and binding regions of the aptamer binding to microbial transglutaminase using circular dichroism spectroscopy and molecular docking simulation.

5. A probe, characterized in that, The probe is a substance obtained by labeling the glutaminase aptamer as described in claim 1 or 2 with a labeling agent.

6. A cell, characterized in that, The cell contains the aptamer as described in claim 1 or 2 or the probe as described in claim 5.

7. A biosensor, characterized in that, It contains the aptamer as described in claim 1 or 2 or the probe as described in claim 5.

8. The use of the aptamer of claim 1 or 2, the probe of claim 5, the cell of claim 6, or the biosensor of claim 7 in the detection of glutaminase.

9. A product for detecting glutaminase, characterized in that, The product contains the aptamer as described in claim 1 or 2 or the probe as described in claim 5, and the product is a reagent or kit.

10. A method for detecting glutaminase, characterized in that, The method involves labeling a reporter group onto the aptamer as described in claim 1 or 2, allowing the aptamer labeled with the reporter group to interact with the sample to be tested, and detecting glutaminase by detecting the signal of the reporter group.

Images