A Multiplex TMA-CRISPR Kit for Respiratory Pathogen RNA and Its Application
By designing specific crRNA and combining it with the TMA-CRISPR-Cas12a2 enzyme system, we have achieved high sensitivity and high specificity multiplex detection of RNA from various respiratory pathogens, solving the problems of signal differentiation and insufficient RNA detection sensitivity, and making it suitable for rapid and accurate clinical diagnosis.
Patent Information
- Application Number
- CN202511403697.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-28
- Publication Date
- 2026-08-04
- Estimated Expiration
- 2045-09-28
AI Technical Summary
Existing CRISPR-Cas multiplex detection methods face challenges in signal differentiation and recognition, making it difficult to effectively distinguish multiple targets. Traditional signal readout techniques such as fluorescence and transverse flow banding are insufficient to meet the requirements of high throughput and scalability, and the sensitivity for RNA virus detection is inadequate.
Multiple crRNAs targeting different virus-specific sequences were designed and combined with a TMA reaction system and a CRISPR-Cas12a2 enzyme to achieve multiplex detection through TMA amplification and CRISPR detection reactions.
It can detect 10 copies/μL of RNA within 40 minutes, with high sensitivity and specificity. It can simultaneously detect multiple respiratory pathogens, adapting to the clinical scenario of rising mixed infection rates. It is fast, accurate, stable, and clinically applicable.
Smart Images

Figure CN121109659B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical detection technology, specifically to a multiplex TMA-CRISPR kit for respiratory pathogen RNA and its applications. Background Technology
[0002] Rapid and accurate detection of RNA pathogens is crucial for the effective prevention and control of respiratory infectious diseases such as influenza and human respiratory syncytial virus (RSV). The COVID-19 pandemic has further highlighted the urgent global need for diagnostic technologies that are not only rapid and sensitive but also capable of detecting low concentrations of viral RNA directly from clinical samples. Over the past decade, various RNA detection strategies have been developed, each optimized for different combinations of sensitivity, speed, cost, complexity, and field applicability. Given the increasing prevalence and co-infection rates of multiple respiratory diseases, there is an urgent need for multiplex assays capable of simultaneously identifying multiple pathogens.
[0003] With the rapid development of molecular biology techniques, nucleic acid-based diagnostic methods have been widely established and applied in laboratory testing for human diseases. Isothermal amplification technology operates at a constant temperature, achieving rapid nucleic acid amplification by adding enzymes with different activities and their corresponding specific primers. Commonly used isothermal amplification methods include loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), rolling circle amplification (RCA), nucleic acid sequence amplification (NASBA), and helicase-dependent amplification (HDA). These techniques all target DNA amplification, while respiratory viruses are mostly RNA viruses. Direct RNA amplification techniques have relatively weak sensitivity and other indicators in nucleic acid detection. However, the introduction of CRISPR-Cas detection systems allows for complementary advantages between the two. Cas enzyme-based detection systems are renowned for their high specificity in nucleic acid sequence recognition and signal reporting, and have become a promising research hotspot. However, using Cas enzyme systems alone lacks sufficient sensitivity; they must be combined with amplification reactions to effectively detect targets and improve the accuracy of diagnostic results. Multiplex detection capability is one of the core advantages of CRISPR diagnostic technology. By designing multiple crRNAs targeting different virus-specific sequences, multiple targets can be detected simultaneously in the same reaction system. However, current CRISPR-Cas multiplex detection methods still face challenges in distinguishing and recognizing detection signals. Traditional signal readout techniques, such as fluorescence and transverse flow banding, struggle to effectively differentiate multiple targets, thus limiting the scalability and high-throughput potential of these detections. Therefore, there is an urgent need for a novel detection kit targeting respiratory pathogens. Summary of the Invention
[0004] The purpose of this invention is to provide a multiplex TMA-CRISPR kit for respiratory pathogen RNA and its application. This kit can detect 10 copies / μL of RNA within 40 minutes and has high specificity.
[0005] The objective of this invention is achieved through the following technical solution:
[0006] This invention provides a specific nucleic acid sequence combination for detecting influenza A virus, including a crRNA sequence as shown in SEQ ID NO.1; a forward TMA primer as shown in SEQ ID NO.2; and a reverse TMA primer as shown in SEQ ID NO.3.
[0007] The present invention also provides a specific nucleic acid sequence combination for detecting influenza B virus, including a crRNA sequence as shown in SEQ.ID NO.4; a forward TMA primer as shown in SEQ.ID NO.5; and a reverse TMA primer as shown in SEQ.ID NO.6.
[0008] The present invention also provides a specific nucleic acid sequence combination for detecting respiratory syncytial virus type A, including a crRNA sequence as shown in SEQ.ID NO.7; a forward TMA primer as shown in SEQ.ID NO.8; and a reverse TMA primer as shown in SEQ ID NO.9.
[0009] The present invention also provides a specific nucleic acid sequence combination for detecting respiratory syncytial virus type B, including a crRNA sequence as shown in SEQ.ID NO.10; a forward TMA primer as shown in SEQ.ID NO.11; and a reverse TMA primer as shown in SEQ.ID NO.12.
[0010] This invention also provides a multiplex TMA-CRISPR kit for targeting respiratory pathogen RNA, comprising the following components:
[0011] The TMA reaction system includes (1) Buffer 1 and Buffer 2, wherein Buffer 1 contains 100 mM Tris-HCl, 40 mM MgCl2, 1.25 mM dNTPs, 7.5 mM NTPs and 20 mM spermidine; Buffer 2 contains 10×K buffer, 50 mM MTT and 0.2% BSA; (2) T7 RNA polymerase and M-MuLV reverse transcriptase; (3) Primer mixture containing the forward and reverse TMA primers as described in claims 1-4; (4) RNA to be tested;
[0012] The CRISPR reaction system includes Sucas12a2 enzyme, 10×HOLMES Buffer, RNase inhibitor, RNAreporter probe (5′- / 6-FAM-UUUUU-BHQ1 / 3′), CRISPR RNA (crRNA), 12.8 μL RNA-free water, and TMA template.
[0013] Furthermore, the TMA reaction system specifically comprises: 10 mM Tris-HCl, 4 mM MgCl2, 0.125 mM dNTPs, 0.75 mM NTPs, 2 mM spermidine, 1×K buffer, 5 mM DTT, and 0.02% BSA. The amount of T7 RNA polymerase used is 50 U, the amount of M-MuLV reverse transcriptase used is 100 U, and 1 μL of RNA is used as template.
[0014] Furthermore, the CRISPR reaction system specifically comprises: 2 μL 10×HOLMES Buffer, 1 μL 1 uM SuCas12a2, 1 μL RNase inhibitor, 1 μL 5 uM RNA reporter probe, 0.2 μL 20 uM crRNA, 12.8 μL RNA-free water, and 2 uL of TMA reaction product as template.
[0015] This invention also provides a method for simultaneously detecting RNA from multiple respiratory pathogens, comprising the following steps:
[0016] (1) Extract total RNA from the sample;
[0017] (2) Using the kit described above, perform multiplex TMA amplification and CRISPR-Cas12a2 detection reactions;
[0018] (3) Determine whether the sample contains influenza A virus, influenza B virus, respiratory syncytial virus type A and / or type B by detecting fluorescence signals.
[0019] Furthermore, the multiplex TMA amplification reaction conditions are 42℃ for 30 min. The CRISPR-Cas12a2 reaction conditions are: using 2 μL of TMA reaction product as a template for CRISPR detection and reacting at 37℃.
[0020] The present invention also provides the application of the specific nucleic acid sequence combination and the kit described herein in the preparation of reagents for diagnosing respiratory tract infections.
[0021] Beneficial effects:
[0022] High sensitivity: This invention can detect influenza A virus (IAV), influenza B virus (IBV), respiratory syncytial virus A (RSVA), and respiratory syncytial virus B (RSVB) RNA down to 10 copies / μL, close to the single copy level, solving the problem of weak sensitivity of traditional RNA amplification detection.
[0023] High specificity: This invention only generates effective amplification and fluorescence signals for the RNA of the target pathogen, and does not amplify non-target viruses (such as RHV, ADV), thus avoiding false positives and ensuring diagnostic accuracy;
[0024] Fast and efficient: The test can be completed within 40 minutes, some positive samples can be detected in clinical samples within 10 minutes, and all positive samples can be detected within 30 minutes, meeting the needs of rapid diagnosis of respiratory infectious diseases;
[0025] Multiple detection capability: The same reaction system can detect four pathogens simultaneously, adapting to clinical scenarios where the rate of mixed infection is rising, and overcoming the shortcomings of traditional CRISPR-Cas detection signals that are difficult to distinguish;
[0026] The system is stable and clinically applicable: After optimization of the buffer system, enzyme ratio (50U T7 RNA polymerase + 100U M-MuLv reverse transcriptase) and template concentration, the reaction system is stable; the clinical detection is highly consistent with qRT-PCR, and it can detect some positive samples that are negative for qRT-PCR, thus improving the clinical diagnostic coverage. Attached Figure Description
[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0028] Figure 1 This is a flowchart of the detection process in this invention;
[0029] Figure 2 This is a diagram showing the optimization results of the TMA reaction system in this invention, wherein... Figure 2 Figure A shows the amplification results of different reaction mixtures, verifying the effectiveness of the complete reaction system. Figure 2 Figure B shows the effect of different ratios of T7 RNA polymerase and M-MuLV reverse transcriptase on the fluorescence intensity of the reaction. Figure 2 C shows the fluorescence amplification curves when different TMA reaction product volumes are used as templates;
[0030] Figure 3The figure shows the results of the TMA-CRISPR reaction sensitivity and specificity evaluation in this invention, demonstrating the detection sensitivity of the method for four respiratory pathogen RNAs and the specificity detection results for non-target viruses.
[0031] Figure 4 This is a diagram showing the results of influenza clinical sample testing in this invention. Figure 4 Image A shows the fluorescence curve for detecting influenza A clinical samples. Figure 4 Figure B shows the fluorescence curve for detecting influenza B in clinical samples;
[0032] Figure 5 This is a diagram showing the clinical sample detection results of respiratory syncytial virus in this invention. Figure 5 Image A shows the detection results of respiratory syncytial virus type A in a clinical sample. Figure 5 Figure B shows the detection results of a clinical sample containing respiratory syncytial virus type B. Detailed Implementation
[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0038] Unless otherwise specified, all chemical reagents, biochemical reagents and materials used in this invention are commercially available.
[0039] The present invention will now be described in detail with reference to the accompanying drawings, so that the advantages and features of the invention can be more easily understood by those skilled in the art, thereby providing a clearer and more definite definition of the scope of protection of the present invention. However, this does not limit the present invention to the scope of the described embodiments. The reagents and raw materials used in the following embodiments are all commercially available, and the test methods without specific conditions are generally performed under conventional conditions or according to the conditions recommended by the respective manufacturers. Furthermore, unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.
[0040] Example 1: Screening of multiplex TMA-CRISPR primers and crRNA
[0041] This embodiment is used to screen for specific TMA primers and crRNA sequences against influenza A virus (IAV), influenza B virus (IBV), respiratory syncytial virus type A (RSV-A), and respiratory syncytial virus type B (RSV-B).
[0042] 1.1 Sample preparation and cDNA synthesis
[0043] Total RNA was extracted from LAV, IBV, RSV-A, and RSV-B standards and reverse transcribed into complementary DNA (cDNA) using the commercial reverse transcription kit Takara Cat#6110A according to the manufacturer's protocol.
[0044] 1.2 PCR amplification
[0045] The desired double-stranded DNA (dsDNA) fragment was amplified by polymerase chain reaction (PCR) in a 20 μL reaction volume. Each reaction mixture consisted of: 2 μL 10×Ex Taq buffer, 1.6 μL dNTP mixture (2.5 mM each), 2 μL 10 μM forward and reverse primers, 50 ng cDNA template, 0.1 μL Taq DNA polymerase (optionally a product of Nanjing Novizan Biotechnology Co., Ltd.), and the remaining volume was brought to 20 μL with nuclease-free water.
[0046] The thermal cycling conditions were as follows: initial denaturation at 94℃ for 3 min, followed by 30 cycles (94℃ for 15 s, 55℃ for 30 s, 72℃ for 30 s), and finally extended at 72℃ for 10 min.
[0047] 1.3 Reverse Cutting Experiment of SuCas12a2
[0048] After amplification of the target sequence, a SuCas12a2 trans-cutting experiment was performed, consisting of the following components: 2 μL 10×HOLMESBuffer, 1 μL 1 uM SuCas12a2, 1 μL RNase inhibitor, 1 μL 5 uM RNA reporter probe, 0.2 μL 20 uM crRNA, 1 uL T7 RNA polymerase, 0.8 uL NTPs, 12 μL RNA-free water, and 1 uL of the PCR product from step 1.2 as a template.
[0049] The reaction was carried out in an ABI 7500 Real-Time PCR system at 37°C for 30 min, with fluorescence intensity recorded every 30 s. The experimental results are as follows: Figure 1 As shown.
[0050] 1.4 Screening Results
[0051] The specific sequences obtained through the above experiments are as follows:
[0052] Influenza A crRNA sequence:
[0053]
[0054] Influenza A TMA primers (forward): TGAGTCTTCTAACCGAGGT (SEQ.ID NO.2)
[0055] Influenza A TMA primers (reverse): AATTTTAATACGACTCACTATAGGGAGATCTTGTCTTTAGCCATTCCA (SEQ.ID NO.3)
[0056] beta-reactive protein (CRRNA) sequence:
[0057]
[0058] Forward TMA primers for influenza B: GGGTCCGGGAGCAACCAATG (SEQ.ID NO.5)
[0059] Flow β TMA primers (reverse): GAAATTAATACGACTCACTATAGGGTAGTCTGTTTAGGCGGTCTT (SEQ.ID NO.6)
[0060] Respiratory syncytial virus (type A) crRNA sequence:
[0061]
[0062] Respiratory syncytial virus (type A) TMA primers (forward): TTACATTCCTGGTCAACTAT (SEQ.ID NO.8)
[0063] Respiratory syncytial virus (type A) TMA primers (reverse): GAAATTAATACGACTCACTATAGGGATTGAGATCATACTTGTATA (SEQ.ID NO.9)
[0064] Respiratory syncytial virus (type B) crRNA sequence:
[0065]
[0066] Respiratory syncytial virus (type B) TMA primers (forward): AGTAGGGAGTACCAAATA (SEQ.ID NO.11)
[0067] Respiratory syncytial virus (type B) TMA primers (reverse): GAAATTAATACGACTCACTATAGGGGGCTTAATGCCAATACATTC (SEQ.ID NO.12)
[0068] Example 2: Establishment and Optimization of Multiple TMA-CRISPR Methods
[0069] This embodiment is used to establish and optimize a multiplex TMA-CRISPR detection method to improve detection efficiency and accuracy.
[0070] 2.1 Optimization of TMA-CRISPR reaction buffer and enzyme system
[0071] To evaluate the feasibility of the TMA-CRISPR platform, five different reaction mixtures (A1-A5) were prepared, each containing a different combination of components. All reactions were carried out at 42°C for 30 minutes using RNA templates from four target respiratory viruses. Amplification products were detected by agarose gel electrophoresis.
[0072] Each experiment contained T7 RNA polymerase, M-MuLV reverse transcriptase, and a primer mixture. Buffer 1 contained 100 mM Tris-HCl (pH 8.0), 40 mM MgCl2, 1.25 mM dNTPs, 7.5 mM NTPs, and 20 mM spermidine. Buffer 2 contained 10×K buffer, 50 mM DTT, and 0.2% BSA. The five reaction systems were established as follows:
[0073] R1: Template-free negative control
[0074] R2: The reaction is missing buffer 1
[0075] R3: The reaction lacks buffer 2.
[0076] R4: RNase H-free
[0077] R5: Contains the target RNA and all complete reaction components.
[0078] Experimental results showed that a distinct amplification band was detected only in R5, while no amplifiable products were found in channels R1-R4. Real-time fluorescence monitoring was consistent with gel electrophoresis data; only R5 contained a detectable fluorescence signal from the intact reaction mixture. Figure 2 A).
[0079] The optimal ratio of T7 RNA polymerase to M-MuLV reverse transcriptase (MuLV) was then investigated. Four combinations of the reactants were studied: (1) T7: 50 U, MuLV: 100 U; (2) T7: 25 U, MuLV: 100 U; (3) T7: 25 U, MuLV: 50 U; (4) T7: 12.5 U, MuLV: 50 U. Real-time fluorescence curves showed that the reaction containing 50 U T7 polymerase and 100 U MuLV reverse transcriptase produced the highest fluorescence intensity. Figure 2 B).
[0080] 2.2 Optimization of TMA-CRISPR reaction template concentration and temperature
[0081] The volume of the TMA reaction product was systematically optimized as a template for CRISPR experiments, and four different template input volumes were tested: 8 μL, 4 μL, 2 μL, and 1 μL. Fluorescence amplification curves showed that 2 μL was the optimal template volume. Figure 2 C).
[0082] Example 3: Evaluation of TMA-CRISPR Response Sensitivity and Specificity
[0083] To evaluate the analytical sensitivity of the multiplex TMA-CRISPR-Cas12a2 assay, serial gradient dilutions of four different respiratory pathogen RNAs (IAV, IBV, RSV-A, and RSV-B) were performed, with a dilution range of 10-1. 7 ~10 1 Copy / μL. For example... Figure 3 As shown in the fluorescence amplification curve, the detection range of this system can reach 10 copies / μL, confirming the high sensitivity of the reaction.
[0084] To evaluate the specificity of this method, RNA was extracted from clinical specimens containing representative respiratory viruses such as IAV and IBV, RSV-A and RSV-B, RHV and ADV. Figure 3 As shown in the fluorescence amplification graph, the amplification curve only significantly increases in the presence of the corresponding target pathogen; no effective amplification is observed when detecting non-target viral RNA. No statistically significant amplification was observed in non-target samples, ruling out false positives. These results indicate that this method has high sensitivity and specificity, making it suitable for clinical diagnostic applications.
[0085] Example 4: Composition of the Multiplex TMA-CRISPR Kit
[0086] The multiplex TMA-CRISPR kit of the present invention includes TMA multiplex amplification and CRISPR detection as described in Example 2. The CRISPR detection comprises the following components: 2 μL 10×HOLMES Buffer, 1 μL 1 uM SuCas12a2, 1 μL RNase inhibitor, 1 μL 5 uM RNA reporter probe, 0.2 μL 20 uM crRNA, 12.8 μL RNA-free water, and 2 uL of TMA reaction product as template.
[0087] When used, the reaction conditions optimized in Example 2 are followed to achieve rapid, sensitive, and specific detection of four respiratory pathogens.
[0088] Example 5: Application of the Multiplex TMA-CRISPR Reagent Kit in Clinical Diagnosis
[0089] To determine the potential of the multiplex TMA-CRISPR kit prepared in this invention for clinical applications, patient samples diagnosed with influenza A (IAV), influenza B (IBV), and respiratory syncytial virus A and B (RSV-A, RSV-B) were analyzed.
[0090] First, 10 IAV-positive clinical samples were evaluated, and fluorescence curves were observed ( Figure 4A) indicates a positive result detected within 10 minutes, a result completely consistent with qRT-PCR. Similarly, analysis of 15 IBV-positive clinical specimens showed fluorescence curves ( Figure 4 B) indicates that approximately 80% of the samples are positive within 10 minutes, and all are positive after 30 minutes, a result consistent with qRT-PCR.
[0091] Fifteen clinical samples with RSV-A and another 15 clinical samples with RSV-B were tested. Eleven of these samples showed consistent RSV-A positivity in both TMA-CRISPR and qRT-PCR assays. Three samples yielded consistent RSV-A negative results in both methods. Results are as follows: Figure 5 As shown in Figure A. It is noteworthy that although qRT-PCR was negative, one sample tested positive for RSV-A via TMA. For RSV-B, 13 samples showed consistent positivity in both TMA and qRT-PCR. In contrast, two samples tested positive via TMA but negative via qRT-PCR, as shown in Figure A. Figure 5 As shown in B.
[0092] The above results indicate that the multiplex TMA-CRISPR detection method of the present invention has good clinical application prospects and can be used for rapid and accurate detection of respiratory pathogens.
[0093] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A multiplex TMA-CRISPR kit targeting respiratory pathogen RNA, characterized in that, Includes the following components: TMA reaction system: 10mM Tris-HCl, 4mM MgCl2, 0.125mM dNTPs, 0.75mM NTPs, 2mM spermidine, 1×K buffer, 5mM DTT and 0.02% BSA; 50U of T7 RNA polymerase, 100U of M-MuLV reverse transcriptase, and 1uL of RNA as template; CRISPR reaction system: 2 μL 10× HOLMES Buffer, 1 μL 1 uM SuCas12a2, 1 μL RNase inhibitor, 1 μL 5 uM RNA reporter probe, 0.2 μL 20 uM crRNA, 12.8 μL RNA-free water, and 2 uL of TMA reaction product as template; The primer mixture contains specific nucleic acid sequence combinations for detecting influenza A virus, including the crRNA sequence shown in SEQ.ID NO.1; the forward TMA primer shown in SEQ.ID NO.2; and the reverse TMA primer shown in SEQ.ID NO.
3. The primer mixture contains specific nucleic acid sequence combinations for detecting influenza B virus, including the crRNA sequence shown in SEQ.ID NO.4; the forward TMA primer shown in SEQ.ID NO.5; and the reverse TMA primer shown in SEQ.ID NO.
6. The primer mixture contains a specific combination of nucleic acid sequences for detecting respiratory syncytial virus type A, including the crRNA sequence shown in SEQ.ID NO.7; the forward TMA primer shown in SEQ.ID NO.8; and the reverse TMA primer shown in SEQ.ID NO.
9. The primer mixture contains a specific combination of nucleic acid sequences for detecting respiratory syncytial virus type B, including the crRNA sequence shown in SEQ.ID NO.10; the forward TMA primer shown in SEQ.ID NO.11; and the reverse TMA primer shown in SEQ.ID NO.
12.
2. A method for simultaneously detecting RNA from multiple respiratory pathogens for non-diagnostic and non-therapeutic purposes, characterized in that, Includes the following steps: (1) Extract total RNA from the sample; (2) Using the kit described in claim 1, perform multiplex TMA amplification and CRISPR-Cas12a2 detection reactions; (3) Determine whether the sample contains influenza A virus, influenza B virus, respiratory syncytial virus type A and / or type B by detecting fluorescence signals.
3. The method according to claim 2, characterized in that, The multiplex TMA amplification reaction conditions were 42℃ for 30 min, and the CRISPR-Cas12a2 reaction conditions were: using 2 μL of TMA reaction product as a template for CRISPR detection and reacting at 37℃.
4. The use of the kit as described in claim 1 in the preparation of reagents for diagnosing respiratory infections, characterized in that, The respiratory infection is caused by influenza A virus, influenza B virus, respiratory syncytial virus type A, or respiratory syncytial virus type B.