Lipid nanoparticle drug conjugates

Abstract

The present disclosure provides conjugates comprising a targeting moiety, such as an antibody, Fab fragment or single chain variable fragment (ScFv), and a lipid nanoparticle (LNP) encapsulating a therapeutic agent (i.e., payload) wherein the targeting moiety, such as an antibody, Fab fragment or ScFv, is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises an enzyme recognition sequence and a click product formed by a click reaction between a first click handle on the targeting moiety such as an antibody, Fab fragment or ScFv and a second click handle on the LNP.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 423,271, filed November 7, 2022, and U.S. Provisional Patent Application No. 63 / 478,968, filed January 8, 2023, the disclosures of each of which are hereby incorporated by reference in their entirety for all purposes.

[0003] Reference to the electronic sequence list

[0004] The contents of the electronic sequence list (252052000440SEQLIST.xml; size: 123,591 bytes; creation date: November 6, 2023) are incorporated herein by reference in their entirety. Background Technology

[0005] The development of lipid nanoparticles (LNPs) has recently made significant progress in the intracellular delivery of payloads such as nucleic acids (e.g., mRNA or siRNA). LNPs typically consist of multiple components, including ionizable lipids, PEGylated lipids, accessory lipids, and cholesterol, all of which play important roles in the efficient delivery of payloads to diseased tissues. Nevertheless, serious safety concerns remain. For example, LNPs may accumulate and deliver payloads to cells outside their intended target, leading to potential toxicity. Therefore, an important objective is to develop LNPs that target diseased tissues and can be administered in non-toxic doses.

[0006] One approach to improving toxicological characteristics and enhancing the efficacy of LNPs is to modify the surface of the LNP with a targeting portion that targets specific cells, such as diseased cells. For example, the LNP can be coated with a targeting portion, such as an antibody or its antigen-binding portion, which can bind to specific cellular receptors on target cells, leading to the accumulation of the payload in the target tissue (relative to other tissues in the body). Different methods have been used to introduce the targeting portion onto the surface of the LNP. For example, one method relies on functionalizing a pre-formed LNP with the targeting portion. LNPs typically comprise lipids with polyethylene glycol (PEG) spacers that are functionalized with reactive portions such as thiols, amines, maleimides, or carboxylic acid groups. The functionalized lipids of the LNP react with complementary groups of the covalently bonded targeting portion to produce a conjugate of the LNP and the targeting portion.

[0007] More recent conjugation methods use milder reaction conditions and are based on biorthogonal chemical reactions, such as click chemistry. So-called click products are formed from a click handle on the LNP and a click handle bonded to the targeting moiety, linking the LNP to the targeting moiety. One biorthogonal method for producing LNP targeting moiety conjugates involves copper-catalyzed click reactions, such as the Huisgen 1,3-dipolar cycloaddition (CuAAC) between an azide and an alkyne. Other biorthogonal methods rely on copper-free click chemistry, for example, click products can be formed between an azide and a dibenzocyclooctyne (DBCO), using inverse electron demand Diels-alder (IEDDA) cycloaddition between a trans-cyclooctene (TCO) moiety and a tetrazine ring, or a Staudinger reaction between an azide and a phosphine.

[0008] In general, the above conjugation methods, including biorthogonal methods, when applied to antibodies or antigen binding fragments, result in LNP conjugated to the antibodies in a heterogeneous manner. Typically, when the antibodies or antigen binding fragments are functionalized with a reactive group or click handle, this functionalization occurs in a random manner, resulting in heterogeneity of the antibody population, exhibiting significant batch-to-batch variability. The randomly modified antibodies or antigen binding fragments result in LNP with a surface modified in a random manner. The reaction between the randomly modified antibodies or antigen binding fragments and the LNP can not occur with optimal efficiency. Furthermore, the LNP decorated in this manner can contain a proportion of antibodies or antigen binding fragments that are not effectively able to bind to the target receptor on the cell due to the inefficient orientation of the antibodies or antigen binding fragments on the surface of the LNP after conjugation. In addition, the antibodies conjugated to the antibodies or antigen binding fragments at specific amino acid residues can be conjugated in a non-optimized manner, which can impair the antibody binding ability, resulting in poor therapeutic efficacy.

[0009] Accordingly, there is a need to develop LNP with a surface modified with targeting moieties, such as antibodies or antigen binding fragments, where the antibodies or antigen binding fragments are attached to the LNP in a highly site-specific manner, resulting in a greater proportion of the targeting moieties effectively binding to their target receptors. SUMMARY

[0010] In one aspect, the present disclosure provides a conjugate comprising a lipid nanoparticle (LNP) encapsulating a therapeutic agent (i.e., a payload) and a targeting moiety, such as an antibody, a Fab fragment, or a single chain variable fragment (ScFv), wherein the targeting moiety (e.g., antibody, Fab fragment, or ScFv) is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises an enzyme recognition sequence and a click product formed from a click reaction between a first click handle on the targeting moiety (e.g., antibody, Fab fragment, or ScFv) and a second click handle on the LNP. In some embodiments, the enzyme recognition sequence is a sortase recognition motif or a LplA acceptor peptide. In certain embodiments, the payload can be a small molecule, a peptide or protein, an siRNA or miRNA, a nucleic acid (e.g., a DNA or RNA molecule, e.g., an mRNA molecule), a nucleic acid encoding a component of a system for altering or modifying a genome, or a combination thereof. In some embodiments, the payload is a DNA or RNA molecule (e.g., an mRNA) encoding or comprising a therapeutic agent. In some embodiments, the payload is a gene modification system, as described herein.

[0011] In one embodiment, the conjugate comprises a targeting moiety, such as an antibody, a Fab fragment, or a single chain variable fragment (ScFv) and a lipid nanoparticle (LNP), wherein the C-terminus of one or more of the heavy chains or light chains of the antibody, the C-terminus of the heavy chain or light chain of the Fab fragment, or the C-terminus of the ScFv is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises a sortase recognition motif and a click product formed from a click reaction between a first click handle on the antibody, Fab fragment, or ScFv and a second click handle on the LNP. In specific embodiments, the sortase recognition motif comprises an LPXT motif, where X is any amino acid residue. In some such embodiments, the sortase recognition motif comprises an LPET (SEQ ID NO: 8) motif. In some embodiments, the linker comprises 3 or more glycine residues between the sortase recognition motif and the click product. In some embodiments, the linker comprises between 3 and 10 glycine residues between the sortase recognition motif and the click product. In some such embodiments, the linker comprises 3, 4, 5, or 6 glycine residues between the sortase recognition motif and the click product. In some embodiments, the linker further comprises one or more additional amino acid residues between the targeting moiety, such as an antibody, a Fab fragment, or a ScFv, and the sortase recognition motif. In some such embodiments, the amino acid residues between the targeting moiety, such as an antibody, a Fab fragment, or a ScFv, and the sortase recognition motif are selected from the group consisting of (GGGGS) v (SEQ ID NO: 9), (G) v (SEQ ID NO: 10), (EAAAK) v(SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0012] In another embodiment, the conjugate comprises a targeting moiety, such as an antibody, a Fab fragment, or a single-chain variable fragment (ScFv), and a lipid nanoparticle (LNP), wherein the antibody, Fab fragment, or ScFv is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises a lipoic acid ligase (LplA) receptor peptide and a click product formed by a click reaction between a first click handle on the antibody, Fab fragment, or ScFv and a second click handle on the LNP. In some embodiments, the conjugate comprises an antibody, wherein the C-terminus of one or more of the heavy or light chains of the antibody is bonded to the linker. In some embodiments, the conjugate comprises a Fab fragment, wherein the C-terminus of the heavy or light chain of the Fab fragment is bonded to the linker. In some embodiments, the conjugate comprises an ScFv, wherein the C-terminus of the ScFv is bonded to the linker. In some embodiments, the LplA receptor peptide has the sequence GFEDKVWYDLDA (SEQ ID NO:15). In some embodiments, the linker further comprises one or more additional amino acid residues between the targeting moiety (such as an antibody, Fab fragment, or ScFv) and the LplA receptor peptide. In some such embodiments, the amino acid residues between the targeting moiety (such as an antibody, Fab fragment, or ScFv) and the LplA receptor peptide are selected from (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0013] In other embodiments, the enzyme recognition sequence is a transglutaminase recognition sequence (LLQG (SEQ ID NO:16)). In other embodiments, the enzyme recognition sequence is a sequence recognized by a formylglycine generating enzyme, specifically CXPXR, where each X is any amino acid.

[0014] In any of the above embodiments, the click product can be formed using a bisorthogonal chemistry approach. In one embodiment, a copper-catalyzed click reaction can be used to form the click product. One such copper-catalyzed click reaction is the Hughesgen 1,3-dipolar cycloaddition (CuAAC) between an azide and an alkyne. In another embodiment, copper-free click chemistry can be used to form the click product. For example, a click product can be formed between an azide and dibenzocyclooctene (DBCO). Alternatively, a Staudinger reaction between an azide and a phosphine can also be used to form the click product, thereby producing an aza-ylide.

[0015] In some embodiments, the click product can be formed by a reverse electron-demanding Diels-Alder reaction between a trans-cyclooctene (TCO) moiety on the first or second click handle and a tetrazine ring on the first or second click handle. In some embodiments, the first click handle comprises a tetrazine (Tz) ring, and the second click handle comprises a TCO moiety. In some embodiments, the tetrazine ring is unsubstituted. In some such embodiments, the tetrazine ring is a methyltetrazine. In some embodiments, the tetrazine ring is a 6-methyl-substituted tetrazine.

[0016] LNPs containing the disclosed conjugates typically comprise multiple (e.g., 3, 4, 5, or 6) lipid molecules. In specific embodiments, the click product is bonded to one or more lipids constituting the LNP. In such embodiments, the click product is formed by a reaction between a first click handle bonded to an antibody and a second click handle bonded to one or more lipids constituting the LNP.

[0017] In any of the above embodiments, the conjugate may comprise one or more polyethylene glycol-modified lipid molecules. In some embodiments, the second click handle is covalently bonded to at least one polyethylene glycol-modified lipid molecule, thereby generating a structural lipid-PEG. x- Click handles, where x is 5-120. In such embodiments, the click product is formed by a reaction between a first click handle bonded to an antibody and a second click handle bonded to one or more polyethylene glycol-modified lipids constituting the LNP. In some embodiments, the LNP comprises about 0.05 mol% to about 2 mol% of polyethylene glycol-modified lipids bonded to the second click handle. In some embodiments, the PEG spacer between the lipid and the second click handle comprises at least about 5, 10, 20, 30, 50, 50, 60, 70, 80, 90, 200, or 110 ethylene glycol units. In some embodiments, the PEG spacer comprises about 10-120 ethylene glycol units. In some embodiments, the polyethylene glycol-modified lipids bonded to the second click handle have a molecular weight of about 500 (i.e., PEG500) to about 5,000 (i.e., PEG5000). In some embodiments, the PEGylated lipid bonded to the second click handle has a molecular weight of about 1,000 (i.e., PEG1000) to about 3,000 (i.e., PEG5300). In some embodiments, the lipid component of the PEGylated lipid bonded to the second click handle is selected from DMG, DPG, DSG, DTA, DOPE, DPPE, DMPE, DSPE, sphingosine, sphingomyelin, and stearic acid.

[0018] In any of the above embodiments, the conjugate may comprise one or more cholesterol lipid molecules. In some embodiments, the second click handle is bonded to at least one cholesterol molecule constituting the LNP. In some such embodiments, the second click handle is bonded to β-sitosterol, hydroxycholesterol, or stigmasterol.

[0019] In any of the above embodiments, the conjugate may comprise one or more non-PEGylated phospholipids. In some embodiments, the second click handle is bonded to at least one non-PEGylated phospholipid. In some embodiments, the non-PEGylated phospholipid is selected from POPC, DOPC, DOPE, and DSPC. Such lipids are generally referred to as accessory lipids.

[0020] In any of the above embodiments, the conjugate may comprise one or more ionizable lipids. In some embodiments, the second click handle is bonded to at least one ionizable lipid. In some embodiments, the ionizable lipid is selected from V003, V004, V005, and V040.

[0021] In some implementations, the LNP component includes ionizable lipid V003, as shown below.

[0022]

[0023] In some embodiments, the LNP is a liposome. In some embodiments, the liposome comprises phospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and phosphatidylglycerol. In some embodiments, the liposome comprises a stabilizer, such as cholesterol.

[0024] Surprisingly, it was found that increasing the amount of non-PEGylated phospholipids (e.g., DSPC) in the conjugates disclosed herein improves the delivery of payloads (e.g., mRNA) to cells of interest (e.g., T cells or HSCs). In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 7:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 4:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 3:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 2.5:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 2:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is from about 1.5:1 to about 2.5:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is from about 2:1 to about 2.5:1.

[0025] Furthermore, an increased ratio of non-PEGylated phospholipids (e.g., DSPC) to cholesterol molecules in the conjugates disclosed herein can lead to increased delivery of payloads (e.g., mRNA) to cells of interest (e.g., T cells or HSCs). In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 6:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 3:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 2:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 1.5:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 0.5:1. In some implementations, the ratio between cholesterol molecules and non-polyethylene glycol-modified phospholipids (e.g., DSPC) is about 1:2 to about 0.8:1.

[0026] In any of the above embodiments, the conjugate may contain more than one targeting moiety per LNP, such as an antibody, Fab fragment, or ScFv. In some embodiments, the conjugate may contain more than 10 targeting moiety per LNP, such as an antibody, Fab fragment, or ScFv. In some embodiments, the conjugate may contain more than 20 targeting moiety per LNP, such as an antibody, Fab fragment, or ScFv. In some embodiments, the conjugate may contain more than 30 targeting moiety per LNP, such as an antibody, Fab fragment, or ScFv. In some embodiments, the conjugate may contain more than 50 targeting moiety per LNP, such as an antibody, Fab fragment, or ScFv. In some embodiments, the conjugate may contain about 50 to about 200 targeting moiety per LNP, such as an antibody, Fab fragment, or ScFv. In some embodiments, the conjugate may contain about 100 to about 200 targeting moiety per LNP, such as an antibody, Fab fragment, or ScFv.

[0027] In any of the above embodiments, the targeting portion (e.g., antibody, Fab fragment, or ScFv) of the conjugates disclosed herein can target cell surface receptors. In some embodiments, the targeting portion (e.g., antibody, Fab fragment, or ScFv) of the conjugates disclosed herein targets T cell receptors, including but not limited to CD2, CD3, CD4, CD5, CD6, CD7, or CD8. In other embodiments, the targeting portion (e.g., antibody, Fab fragment, or ScFv) of the conjugates disclosed herein targets hematopoietic stem cells (HSCs). In some embodiments, the targeting portion (e.g., antibody, Fab fragment, or ScFv) of the conjugates disclosed herein targets HSC receptors, including but not limited to CD90 or CD117. In any of the above embodiments, adding a targeting portion to the surface of an LNP produces a targeted LNP (tLNP), which can more effectively deliver the payload to target cells (i.e., cells containing cell surface receptors that bind to the targeting portion) compared to an LNP without a targeting portion. In some embodiments, conjugates containing a targeting moiety that binds to CD2, CD3, CD4, CD5, CD6, CD7, or CD8 comprise a targeting LNP capable of delivering a payload to T cells. In some embodiments, conjugates containing a targeting moiety that binds to CD90 or CD117 comprise a targeting LNP capable of delivering a payload to HSCs.

[0028] The conjugates disclosed herein can be used to deliver payloads to cells, particularly cells expressing cell surface receptors targeted by the targeting portion (e.g., antibody, Fab fragment, or ScFv) component of the conjugate. In some embodiments, the payload is one or more nucleic acid molecules, such as one or more DNA molecules, one or more RNA molecules (e.g., mRNA), or combinations thereof. In some embodiments, the payload is siRNA or microRNA. In other embodiments, the payload is an antisense oligonucleotide (ASO). In other embodiments, the payload is tRNA. In other embodiments, the payload is a DNA plasmid. In other embodiments, the payload is a small molecule. In other embodiments, the payload is one or more components of a CRISPR / Cas system, such as a CRISPR / Cas nuclease, or a nucleic acid encoding a CRISPR / Cas nuclease, and / or guide RNA. In some embodiments, the payload is one or more components of a CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b system. For example, the conjugates disclosed herein can be used to deliver CRISPR-Cas9 genome editing components. In some embodiments, the payload comprises a CRISPR / Cas nicking enzyme, or a nucleic acid encoding a CRISPR-Cas nicking enzyme, such as a CRISPR-Cas9 nicking enzyme. In some such embodiments, the conjugate may deliver mRNA encoding Cas9 and guide RNA. In some embodiments, the payload may be one or more components of a gene-modifying system, as described herein, comprising a gene-modifying polypeptide or a nucleic acid encoding a gene-modifying polypeptide. In some embodiments, the payload may be one or more components of a heterologous gene-modifying polypeptide. Other payloads may be selected from small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and their derivatives, peptide mimics, nucleic acids, nucleic acid analogs and their derivatives, extracts made from biological materials, or any combination thereof. In some embodiments, the payload may be an enzyme or a nucleic acid encoding an enzyme, for example, for enzyme replacement gene therapy.

[0029] In some embodiments, the conjugates of this disclosure can be used to deliver a system capable of inserting a heterologous target sequence into a cellular genome. In some embodiments, the system comprises: (A) a genetically modified polypeptide or a nucleic acid encoding the genetically modified polypeptide, wherein the genetically modified polypeptide comprises: (i) an endonuclease and / or DNA-binding domain; and (ii) a reverse transcriptase (RT) domain, wherein (i) and (ii) are both derived from a retrotransposon (e.g., from the same retrotransposon or different retrotransposons); and (B) a template RNA (or DNA encoding the template RNA) comprising (i) the sequence of the binding polypeptide and (ii) the heterologous target sequence. In some embodiments, the genetically modified polypeptide acts as a substantially autonomous protein machine capable of integrating the template nucleic acid sequence into a target DNA molecule (e.g., in mammalian host cells, such as genomic DNA molecules in host cells), substantially independent of the host machine. The heterologous target sequence may include, for example, a coding sequence, a regulatory sequence, or a gene expression unit. In some embodiments, the genetically modified polypeptide may be a retrotransposon, for example, selected from the retrotransposons in Table 7. In some embodiments, the gene-modifying polypeptide may be a retrotransposon selected from, but not limited to, the following retrotransposon classes: RTE (e.g., RTE-1_MD, RTE-3_BF and RTE-25_LMi), CR1 (e.g., CR1-1_PH), Crack (e.g., Crack-28_RF), L2 (e.g., L2-2_Dre and L2-5_GA) and Vingi (e.g., Vingi-1_Acar).

[0030] In another aspect, this disclosure provides a targeting motif, such as an antibody, Fab fragment, or ScFv, which is connected to a click handle via a sorting enzyme recognition motif through the C-terminus of one or more of the heavy or light chains of the antibody, the C-terminus of the heavy or light chain of the Fab fragment, or the C-terminus of the ScFv, wherein the click handle contains a tetrazine ring capable of reacting with the trans-cyclooctene (TCO) motif. In some embodiments, the tetrazine ring is substituted (e.g., methyltetrazine). In specific embodiments, the sorting enzyme recognition motif comprises an LPXT motif, where X is any amino acid residue. In some such embodiments, the sorting enzyme recognition motif comprises an LPET motif. In some embodiments, the linker comprises three or more glycine residues between the sorting enzyme recognition motif and the click handle. In some embodiments, the linker comprises between three and ten glycine residues. In some such embodiments, the linker comprises three, four, five, or six glycine residues. In some embodiments, the linker further comprises one or more additional amino acid residues between the targeting motif (such as an antibody, Fab fragment, or ScFv) and the sorting enzyme recognition motif. In some such implementations, the amino acid residues between the targeting motif (such as an antibody, Fab fragment, or ScFv) and the sorting enzyme recognition motif are selected from (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0031] In another aspect, this disclosure provides a targeting moiety, such as an antibody, Fab fragment, or ScFv, linked to a click handle via an LplA receptor peptide, wherein the click handle comprises a tetrazine ring capable of reacting with a trans-cyclooctene (TCO) moiety. In some embodiments, the LplA receptor peptide is linked to the click handle via the C-terminus of the targeting moiety (e.g., antibody, Fab fragment, or ScFv). In some such embodiments, the amino acid residues between the targeting moiety (e.g., antibody, Fab fragment, or ScFv) and the LplA receptor peptide are selected from (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v(SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ IDNO:14), where u is 1-10 and v is 1-10.

[0032] In another aspect, this disclosure provides a method for conjugating an LNP to a targeting motif (such as an antibody, a Fab fragment, or a single-chain variable fragment (ScFv)), wherein the antibody Fab fragment or ScFv is covalently linked to a first click handle via a linker comprising an enzyme recognition sequence, and the LNP is covalently linked to a second click handle. The method includes contacting the LNP with the antibody, Fab fragment, or ScFv such that the first click handle reacts with the second click handle to form a click reaction product conjugating the antibody, Fab fragment, or ScFv to the LNP. In some embodiments, the enzyme recognition sequence is a sorting enzyme recognition motif or an LplA receptor peptide. In some embodiments of LNP conjugation with an antibody, one or more C-termini of the heavy or light chain of the antibody are covalently bonded to an enzyme recognition sequence (e.g., a sorting enzyme recognition motif or an LplA receptor peptide). In some embodiments of LNP conjugation with a Fab fragment, the C-terminus of the heavy or light chain of the Fab fragment is covalently bonded to an enzyme recognition sequence (e.g., a sorting enzyme recognition motif or an LplA receptor peptide). In some embodiments where LNP is conjugated to ScFv, the C-terminus of the ScFv is covalently bonded to an enzyme recognition sequence (e.g., a sorting enzyme recognition motif or an LplA receptor peptide). In some of the above embodiments, the sorting enzyme recognition motif or LplA receptor peptide is attached to the click handle via the C-terminus of a targeting portion (e.g., an antibody, a Fab fragment, or ScFv).

[0033] In some of the above embodiments, before adding the enzyme recognition motif (e.g., a sorting enzyme recognition motif or an LplA receptor peptide), the C-terminus of the targeting motif (e.g., an antibody, Fab fragment, or ScFv) is first modified with one or more amino acid residues. Specific added amino acid residues that can be covalently attached to the C-terminus of the targeting motif (e.g., an antibody, Fab fragment, or ScFv) include, but are not limited to, (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) vA(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0034] In some of the above embodiments, the first click handle comprises a tetrazine ring or a TCO portion, and the second click handle comprises a tetrazine ring or a TCO portion. In some such embodiments, the first click handle comprises a tetrazine ring, and the second click handle comprises a TCO portion. In some embodiments, the tetrazine ring is methyltetrazine. In some embodiments, the conjugation efficiency achieved by the disclosed method is greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90%. In some embodiments, the conjugation efficiency achieved by the disclosed method is from about 60% to about 95%. In some embodiments, the conjugation efficiency achieved by the disclosed method is from about 70% to about 85%.

[0035] In another aspect, this disclosure provides a method for manufacturing lipid nanoparticles (LNPs) conjugated in a site-specific manner to a targeting moiety (such as an antibody, Fab fragment, or ScFv), the method comprising...

[0036] (i) Covalently attaching a peptide having a sorting enzyme recognition site to one or more C-termini of a target moiety (e.g., an antibody or a Fab fragment), or covalently attaching it to the C-terminus of a ScFv;

[0037] (ii) In the presence of a sorting enzyme, and under conditions suitable for the sorting enzyme to link the target moiety (e.g., antibody, Fab fragment, or ScFv) to a first click handle, the product of step (i) is contacted with a first click handle covalently bound to three or more glycine residues (e.g., between 3 and 10 glycine residues); and

[0038] (iii) Contact the product of step (ii) with the LNP, wherein one or more lipids constituting the LNP contain a second click handle capable of reacting with the first click handle, thereby generating a click product.

[0039] In some embodiments, step (i) involves covalently attaching a peptide having a sorting enzyme recognition site to a linker covalently attached to one or more C-termini of a targeting moiety (e.g., an antibody or a Fab fragment) or to the C-terminus of an ScFv. In some embodiments, the linker comprises one or more amino acid residues. Specific added amino acid residues that can be covalently attached to the C-terminus of a targeting moiety (e.g., an antibody, a Fab fragment, or an ScFv) include, but are not limited to, (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v(SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0040] In some embodiments, step (ii) (i.e., the transpeptidation reaction catalyzed by the sorting enzyme) is carried out in the presence of sorting enzyme A5. In other embodiments, step (ii) is carried out in the presence of the sorting enzyme Streptococcus pyogenes sorting enzyme A (SpSrtA WT).

[0041] In another aspect, this disclosure provides a method for manufacturing LNPs conjugated in a site-specific manner to a target moiety (e.g., an antibody, a Fab fragment, or a ScFv), the method comprising...

[0042] (i) Covalently bind the LplA receptor peptide to the target moiety, such as an antibody, Fab fragment, or ScFv;

[0043] (ii) Under conditions suitable for lipoic acid ligase to link the target moiety (e.g., antibody, Fab fragment, or ScFv) to the first click handle, the product of step (i) is contacted with a carboxylic acid compound containing the first click handle; and

[0044] (iii) Contact the product of step (ii) with the LNP, wherein one or more lipids constituting the LNP contain a second click handle capable of reacting with the first click handle, thereby generating a click product.

[0045] In some embodiments, the carboxylic acid group (COOH) of the carboxylic acid compound in step (ii) is bonded to the first click handle via a linker. In specific embodiments, the linker may be an aliphatic group. In some embodiments, the linker may be a saturated hydrocarbon containing between 2 and 30 carbon atoms. For example, in some embodiments, the carboxylic acid in step (ii) has the formula COOH-R-click handle, where R is a saturated C 2- C 30 Group. In other embodiments, the carboxylic acid in step (ii) has the formula COOH-R-click handle, wherein R is a C group containing at least one unsaturated carbon atom. 2- C 30 Group. In other embodiments, the carboxylic acid in step (ii) has the formula COOH-R-click handle, wherein R comprises two lipid chains. In some such embodiments, the carboxylic acid is as follows, where n = 1–120.

[0046] In some embodiments of step (i), the Lp1A receptor peptide is covalently bonded to one or more C-termini of a targeting moiety (e.g., an antibody or a Fab fragment). In other embodiments of step (i), the Lp1A receptor peptide is covalently bonded to the C-terminus of ScFv.

[0047] In some embodiments, step (i) involves covalently attaching a peptide having the LplA receptor peptide to a linker covalently attached to one or more C-termini of a targeting moiety (e.g., an antibody or Fab fragment) or to the C-terminus of an ScFv. In some embodiments, the linker binding to the C-terminus of the targeting moiety (e.g., an antibody, Fab fragment, or ScFv) comprises one or more amino acid residues. Specific added amino acid residues that may be covalently attached to the C-terminus of the targeting moiety (e.g., an antibody, Fab fragment, or ScFv) include, but are not limited to, (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ IDNO:14), where u is 1-10 and v is 1-10.

[0048] In another aspect, a modified targeting moiety (e.g., antibody, Fab fragment, or ScFv) containing a first click handle, generated by the methods disclosed herein, reacts with a lipid containing a second click handle to form a click product, thereby producing a lipid modified on its surface with the targeting moiety (e.g., antibody, Fab fragment, or ScFv). Subsequently, the modified lipid is inserted into a precursor LNP, thereby forming an LNP modified on its surface with the targeting moiety (e.g., antibody, Fab fragment, or ScFv). In some embodiments, the lipid containing the second click handle is a polyethylene glycol-modified lipid. Attached Figure Description

[0049] Figure 1 This demonstrates the formation of an LNP conjugated to the C-terminus of a Fab fragment via sorting enzyme-mediated ligation and subsequent click reaction.

[0050] Figure 2 This illustrates the formation of an LNP conjugated to the C-terminus of a Fab fragment via lipoic acid ligase-mediated ligation and subsequent click reaction.

[0051] Figure 3An example of a polyethylene glycol-modified lipid bonded to a second click handle (TCO) is shown.

[0052] Figure 4 An example of a non-PEGylated lipid bonded to a second click handle (TCO) is shown.

[0053] Figure 5 An example of an ionizable lipid bonded to a second click handle (TCO) is shown.

[0054] Figure 6 Examples of sterols bonded to a second click handle (TCO) are shown.

[0055] Figure 7 A schematic diagram is shown of the transpeptide reaction catalyzed by sorting enzyme A5 conjugating the click handle with the Fab fragment.

[0056] Figure 8 The deconvolution MS spectrum of the reaction between the Fab fragment catalyzed by sorting enzyme A5 and the click handle bond at the triglycine residue is shown.

[0057] Figure 9 shows the results of transfection experiments in T cells using LNPs conjugated to the anti-CD5 Fab fragment via sorting enzyme-mediated linking. The transfection results are compared with unmodified (control) LNPs and LNPs modified with anti-CD5 antibody using a random modification method. Figure 9A and 9C The method demonstrates the quantification of mRNA transfection by flow cytometry using green fluorescent protein (%GFP+) per cell. Figure 9B and 9D Transfection is indicated by median fluorescence intensity (MFI).

[0058] Figure 10 shows the results of transfection experiments in human CD34+ cells using LNPs conjugated to the anti-CD117 Fab fragment via sorting enzyme-mediated linking. The transfection results are compared with unmodified (control) LNPs and LNPs modified with anti-CD117 antibody using a random modification method. Figure 10A The method demonstrates the quantification of mRNA transfection by flow cytometry using green fluorescent protein (%GFP+) per cell. Figure 10B Transfection is indicated by median fluorescence intensity (MFI).

[0059] Figure 11A A schematic diagram is shown illustrating the generation of site-specific conjugates via the reaction of anti-CD117 Fab with a site-specific sorting enzyme that recognizes motifs and LNPs. In the schematic diagram, the wavy line represents PEG lipidally bonded to the LNP. Figure 11BA schematic diagram is shown of the generation of conjugates by reacting Fab fragments modified using a random method (NHS modification) with LNP.

[0060] Figure 12 shows the results of transfecting Kasumi-1 cells (CD117+ cell line) with LNPs conjugated to anti-CD117Fab fragments generated either by site specificity (sorting enzyme mediated) or by random modification. Figure 12A The method demonstrates the quantification of mRNA transfection by flow cytometry using green fluorescent protein (%GFP+) per cell. Figure 12B Transfection is indicated by median fluorescence intensity (MFI).

[0061] Figure 13 shows the results of an in vivo experiment evaluating transduction in HSCs and early progenitor cells (HSC+ early progenitor cells) (also known as HSPCs) conjugated to one of three tested CD117-specific Fab fragments (Fab 1, Fab 5, or Fab 6) compared to transduction using a basal LNP lacking conjugation to an anti-CD117 Fab fragment. Figure 13A Up to 58% of HSC+ early progenitor cells received LNPs with Fab fragments modified with sorting enzymes. Figure 13B Up to 62% of long-term (LT)-HSCs received LNPs with a sorting enzyme-modified Fab fragment. Compared to LNPs without the anti-CD117 Fab fragment, LNPs with the sorting enzyme-modified Fab fragment exhibited significantly higher in vivo transfection levels in both HSC+ early progenitor cells and LT-HSCs. Furthermore, as... Figure 13C As shown, there is a good correlation between in vitro transduction of primary HSCs and in vivo targeting of HSCs. On the other hand, as... Figure 13C As shown, there is separation between nonspecific IgG and site-specific conjugated (sorting enzyme method) FabLNP.

[0062] Figure 14 The effects of increasing the mol% of helper lipids in the targeted LNP that conjugate to the CD117-specific Fab fragment on the transduction and expression of GFP-encoding mRNA in HSCs and early progenitor cells (HSC+ early progenitor cells) (also known as HSPCs) are shown. Specifically, Figure 14 The results of in vivo experiments are shown, comparing the transduction of LNPs targeting LNPs with two different amounts of helper lipids (LNP A and LNP B). LNP A and LNP B contain 8% and 22% helper lipids, respectively. More than 80% of HSC+ early progenitor cells were transduced with LNP B.

[0063] Figure 15The results of FACS-based sorting after administration of the conjugate of this disclosure to 3- to 5-year-old cynomolgus monkeys are shown to identify the percentage of HSPCs that are positive for GFP protein expression.

[0064] Figure 16 The data demonstrates that LNP A (with anti-CD3 Fab) and LNP B (with anti-CD5 Fab) delivered GFP mRNA to huCD45+ T cells in the spleen of 78% and 84% of humanized NSG mice, respectively. This data suggests that the exemplary LNPs deliver RNA to human lymphocytes located within secondary lymphoid tissue.

[0065] Figure 17 This demonstrates that the exemplary conjugates of this disclosure, when administered to cynomolgus monkeys, deliver GFP mRNA to approximately 10% and 37% of CD3+ T cells in lymph nodes and peripheral blood, respectively.

[0066] Figure 18 This demonstrates that the exemplary conjugates of this disclosure deliver GFP mRNA to CD4+ T cells and CD8+ T cells in peripheral blood after administration to cynomolgus monkeys.

[0067] Figure 19A The LNP conjugation to a site-specific modified antibody via a reaction between a first click handle on the antibody and a second click handle on the LNP is shown. Figure 19B Several different complementary click handles for synthesizing the conjugates disclosed herein are shown.

[0068] Figure 20 The conjugation efficiency of an exemplary reaction between an antibody with site-specific modifications generated using a sorting enzyme ligation and an LNP using an antibody and different complementary click handles on the LNP is shown.

[0069] Figure 21 The study shows the composition of the LNP and different ratios of PEGylated lipids in the LNP in an evaluation of the effect of PEGylated lipid concentration on conjugation efficiency.

[0070] Figure 22 A general method for preparing and purifying the conjugates disclosed herein is shown.

[0071] Figure 23 The effect of PEGylated lipid concentration on conjugation efficiency is shown.

[0072] Figure 24 An example of an alpha-lipoic acid ligase-catalyzed reaction between the Fab fragment covalently bonded to the Lp1A receptor peptide and the carboxylic acid is shown.

[0073] Figure 25AAn exemplary gene-modification system is shown that can be used to introduce chimeric antigen receptor (CAR) molecules into the genome of primary human T cells. Figure 25B BMCACAR expression after being delivered to T cells via electroporation or LNP delivery systems is shown. Figure 25C This demonstrates the efficacy of CAR T cells against BCMA-positive tumor cells. Detailed Implementation

[0074] I. Definition

[0075] Antigen-binding domain: As used herein, the term "antigen-binding domain" refers to the portion of a targeting portion (e.g., an antibody or chimeric antigen receptor) that binds to an antigen. In some embodiments, the antigen-binding domain binds to cell surface antigens of cells. In some embodiments, the antigen-binding domain binds to antigens characteristic of cancer, such as tumor-associated antigens in tumor cells. In some embodiments, the antigen-binding domain binds to antigens characteristic of infectious diseases, such as virus-associated antigens in virus-infected cells. In some embodiments, the antigen-binding domain binds to characteristic antigens of cells targeted by the subject's immune system in autoimmune diseases, such as autoantigens. In some embodiments, the antigen-binding domain is or comprises an antibody or its antigen-binding portion. In some embodiments, the antigen-binding domain is or comprises ScFv or Fab.

[0076] Domain: As used herein, the term "domain" refers to the structure of a biomolecule that contributes to a specific function of the biomolecule. A domain can include a continuous region (e.g., a continuous sequence) or distinct, non-continuous regions (e.g., non-continuous sequences) of a biomolecule. Examples of protein domains include, but are not limited to, endonuclease domains, DNA-binding domains, and reverse transcriptase domains; examples of nucleic acid domains are regulatory domains, such as transcription factor-binding domains.

[0077] Exogenous: As used herein, the term “exogenous” when referring to a biomolecule (such as a nucleic acid sequence or polypeptide) means that the biomolecule has been artificially introduced into a host genome, cell, or organism. For example, nucleic acids added to an existing genome, cell, tissue, or subject using recombinant DNA technology or other methods are exogenous to the existing nucleic acid sequence, cell, tissue, or subject.

[0078] Expression cassette: As used herein, the term "expression cassette" refers to a nucleic acid construct containing nucleic acid elements sufficient to express the nucleic acid molecules of the present invention.

[0079] gRNA spacer: As used in this article, "gRNA spacer" refers to a portion of nucleic acid that is complementary to the target nucleic acid and can work with the gRNA scaffold to target the Cas protein to the target nucleic acid.

[0080] gRNA scaffold: As used herein, "gRNA scaffold" refers to a scaffold that can bind to the nucleic acid portion of the Cas protein and, together with a gRNA spacer, can target the Cas protein to the target nucleic acid. In some implementations, the gRNA scaffold includes a crRNA sequence, a tetracyclic, and a tracrRNA sequence.

[0081] Genetically modified polypeptides: As used interchangeably herein, “genetically modified polypeptide” and “reverse transposon gene-modified polypeptide” refer to a polypeptide comprising a reverse transcriptase reverse transcriptase domain and a reverse transcriptase endonuclease domain, or a polypeptide comprising an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity with said domains, capable of integrating a nucleic acid sequence (e.g., a sequence provided on a template nucleic acid) into a target DNA molecule (e.g., in mammalian host cells, such as genomic DNA molecules in host cells). In some embodiments, the endonuclease domain is a catalytically inactive endonuclease domain. In some embodiments, the reverse transcriptase reverse transcriptase domain and the reverse transcriptase endonuclease domain are derived from the same reverse transposon. In some embodiments, the gene-modified polypeptide is capable of integrating the sequence substantially independently of host mechanisms. In some embodiments, the gene-modified polypeptide integrates the sequence into a random location in the genome, and in some embodiments, the gene-modified polypeptide integrates the sequence into a specific target site. In some embodiments, the genetically modified polypeptide includes one or more domains that collectively facilitate 1) binding to a template nucleic acid, 2) binding to a target DNA molecule, and 3) facilitating the integration of at least a portion of the template nucleic acid into the target DNA. The genetically modified polypeptide includes naturally occurring polypeptides and engineered variants of the aforementioned polypeptides, for example, having one or more amino acid substitutions on a naturally occurring sequence. The genetically modified polypeptide also includes heterologous constructs, for example, wherein the one or more of the aforementioned domains are heterologous to each other, either through a heterologous fusion (or other conjugate) of the originally wild-type domain, or through a fusion of modified domains, for example, by replacing or fusing a heterologous subdomain or other substituted domain. Exemplary genetically modified polypeptides that can be used in the methods provided herein and systems comprising them, as well as methods of using them, are described, for example, in WO / 2021 / 178717, which is incorporated herein by reference, including Tables 10, 11, X, 3A, 3B, and Z1 therein. In some embodiments, the genetically modified polypeptide integrates a sequence into a gene. In some embodiments, the genetically modified polypeptide integrates a sequence into a sequence outside a gene. As used in this article, "gene modification system" refers to a system that includes gene-modified polypeptides and template nucleic acids.

[0082] Gene modification system: As used herein, “gene modification system” refers to a system that contains a gene-modifying polypeptide or a nucleic acid (e.g., mRNA) encoding a gene-modifying polypeptide and a template nucleic acid.

[0083] Heterogeneous: The term "heterogeneous" when used to describe a first element relative to a second element means that the first and second elements do not exist in nature in the manner described. For example, a heterologous polypeptide, nucleic acid molecule, construct, or sequence is (a) a polypeptide, nucleic acid molecule, or part of a polypeptide or nucleic acid molecule sequence that is not native to the cell expressing it, (b) a polypeptide or nucleic acid molecule, or part of a polypeptide or nucleic acid molecule, that has been altered or mutated relative to its native state, or (c) a polypeptide or nucleic acid molecule that has altered expression compared to its native expression level under similar conditions. For example, heterologous regulatory sequences (e.g., promoters, enhancers) can be used to regulate the expression of genes or nucleic acid molecules in a manner different from how genes or nucleic acid molecules are normally expressed in nature. In another instance, a heterologous domain of a polypeptide or a nucleic acid sequence (e.g., a DNA-binding domain of a polypeptide or a nucleic acid encoding the DNA-binding domain of a polypeptide) may be arranged relative to other domains, or may be a different sequence or from a different source relative to other domains or portions of the polypeptide or its encoding nucleic acid. In some embodiments, the heterologous nucleic acid molecule may be present in the natural host cell genome but may have altered expression levels or a different sequence, or both. In other embodiments, the heterologous nucleic acid molecule may not be endogenous to the host cell or host genome, but may be introduced into the host cell through transformation (e.g., transfection, electroporation), wherein the added molecule may integrate into the host genome, or may exist temporarily (e.g., mRNA) or semi-stable for more than one generation as extrachromosomal genetic material (e.g., augmented viral vectors, plasmids, or other self-replicating vectors). In some embodiments, a domain is heterologous relative to another domain if the first domain is not naturally contained in the same polypeptide as the other domain (e.g., a fusion between two domains of different proteins from the same organism).

[0084] Heterogeneous genetically modified peptide: As used herein, the term "heterogeneous genetically modified peptide" refers to a peptide comprising a retroviral reverse transcriptase, or a peptide comprising an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity with a retroviral reverse transcriptase, capable of integrating a nucleic acid sequence (e.g., a sequence provided on a template nucleic acid) into a target DNA molecule (e.g., in mammalian host cells, such as genomic DNA molecules in host cells). In some embodiments, the heterogeneous genetically modified peptide is capable of integrating the sequence substantially independently of host mechanisms. In some embodiments, the heterogeneous genetically modified peptide integrates the sequence into a random location in the genome, and in some embodiments, the heterogeneous genetically modified peptide integrates the sequence into a specific target site. In some embodiments, the integrated sequence comprises a deletion, substitution, or insertion relative to the target DNA molecule. In some embodiments, the heterogeneous genetically modified peptide includes one or more domains that collectively promote 1) binding to a template nucleic acid, 2) binding to a target DNA molecule, and 3) promoting the integration of at least a portion of the template nucleic acid into the target DNA. Heterogeneous genetic modification peptides include naturally occurring peptides and engineered variants of the aforementioned peptides, for example, having one or more amino acid substitutions in a naturally occurring sequence. Heterogeneous genetic modification peptides also include heterologous constructs, for example, wherein one or more of the aforementioned domains are heterologous to each other, either through heterologous fusions (or other conjugates) of the original wild-type domains, or fusions of modified domains, for example, by replacing or fusing heterologous subdomains or other substituted domains. Exemplary heterogeneous genetic modification peptides that can be used in the methods provided herein, and systems comprising them, and methods of using them, are described, for example, in PCT / US2021 / 020948, which relates to heterogeneous genetic modification peptides comprising retroviral reverse transcriptase domains and is incorporated herein by reference. In some embodiments, the heterogeneous genetic modification peptide integrates a sequence into a gene. In some embodiments, the heterogeneous genetic modification peptide integrates a sequence into a sequence outside a gene. As used herein, a “heterogeneous genetic modification system” refers to a system comprising a heterogeneous genetic modification peptide and a template nucleic acid.

[0085] Mutated or mutated: When applied to a nucleic acid sequence, the term "mutated" means that nucleotides in the nucleic acid sequence may be inserted, deleted, or altered compared to a reference (e.g., native) nucleic acid sequence. A single change (point mutation) can be made at a locus, or multiple nucleotides may be inserted, deleted, or altered at a single locus. Furthermore, one or more changes can be made at any number of loci within the nucleic acid sequence. Nucleic acid sequences can be mutated by any method known in the art. In some embodiments, the mutation occurs naturally. In some embodiments, the desired mutation can be generated using the system described herein.

[0086] Nucleic acid molecules: “Nucleic acid molecules” means RNA and DNA molecules, including but not limited to complementary DNA (“cDNA”), genomic DNA (“gDNA”), and messenger RNA (“mRNA”), and also includes synthetic nucleic acid molecules, such as those produced by chemical synthesis or recombination, such as RNA templates, as described herein. Nucleic acid molecules can be double-stranded or single-stranded, circular or linear. If single-stranded, a nucleic acid molecule can be a sense strand or an antisense strand. Unless otherwise stated, as examples of all sequences described herein, the general format “SEQ ID NO:” or “nucleic acid containing SEQ ID NO:1” refers to a nucleic acid having at least a portion of the sequence of (i) SEQ ID NO:1, or (ii) a sequence complementary to SEQ ID NO:1. The choice between the two depends on the context of use of SEQ ID NO:1. For example, if a nucleic acid is used as a probe, the choice between the two depends on whether the probe needs to be complementary to the desired target. The nucleic acid sequences of this disclosure may be modified chemically or biochemically, or may contain non-natural or derived nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications such as non-electrolyte linkages (e.g., methylphosphonates, triphosphates, aminophosphates, carbamates, etc.), charged linkages (e.g., thiophosphates, dithiophosphates, etc.), side chain moieties (e.g., polypeptides), intercalating agents (e.g., acridine, psoralen, etc.), chelating agents, alkylating agents, and modified linkages (e.g., α-anomeric nucleic acids, etc.). Also included are chemically modified bases, backbones, and modified caps. Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a specified sequence via hydrogen bonds and other chemical interactions. Such molecules are known in the art and include, for example, molecules in which peptide linkages replace phosphate ester linkages in the molecular backbone, such as peptide nucleic acids (PNAs). Other modifications may include, for example, ribose rings containing bridging moieties or other analogs, such as those found in "locked" nucleic acids (LNAs). In various implementations, nucleic acids are operatively associated with additional genetic elements, such as tissue-specific expression control sequences (e.g., tissue-specific promoters and tissue-specific microRNA recognition sequences), and additional elements such as inverted repeats (e.g., inverted terminal repeats, such as elements derived from or originating from viruses, such as AAV ITRs) and tandem repeats, inverted / direct repeats, homologous regions (segments with different degrees of homology to the target DNA), untranslated regions (UTRs) (5', 3', or both 5' and 3' UTRs), and various combinations thereof.The nucleic acid elements of the system provided by this invention can be provided in a variety of topologies, including single-stranded, double-stranded, circular, linear, linear with open ends, linear with closed ends, and specific forms of these, such as dog bone DNA (dbDNA) and closed-end DNA (ceDNA).

[0087] Primer binding sequence: As used herein, the term "primer binding site sequence" or "PBS sequence" refers to a portion of the template RNA that is capable of binding to a region contained in the target nucleic acid sequence. In some cases, the PBS sequence is a nucleic acid sequence containing at least 3, 4, 5, 6, 7, or 8 bases that is 100% identical to a region contained in the target nucleic acid sequence. In some embodiments, the primer region contains at least 5, 6, 7, or 8 bases that is 100% identical to a region contained in the target nucleic acid sequence. Not bound by theory, in some embodiments, when the template RNA contains both a PBS sequence and a heterologous target sequence, the PBS sequence binds to a region contained in the target nucleic acid sequence, thereby allowing the reverse transcriptase domain to use said region as a primer for reverse transcription and the heterologous target sequence as a template for reverse transcription.

[0088] It should be understood that the aspects and implementation schemes described herein as “comprising” include implementation schemes that are “composed of” and “substantially composed of”.

[0089] II. Conjugates

[0090] In one aspect, as described in this section, this disclosure provides conjugates of lipid nanoparticles (LNPs) comprising a targeting moiety and an encapsulated therapeutic agent (i.e., a payload), wherein the targeting moiety is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises an enzyme recognition sequence and a click product formed by a click reaction between a first click handle on the targeting moiety and a second click handle on the LNP. Specific embodiments of methods using the conjugates of this disclosure are described in Section 3. Section 4 describes specific embodiments of payloads delivered by the conjugates of this disclosure. Further details regarding the LNP portion of the conjugates of this disclosure are described in Section 5.

[0091] In some embodiments, the targeting moiety is an antibody or its antigen-binding fragment. In some cases, the targeting moiety is an antibody, Fab fragment, ScFv, DARPIN, VHH domain antibody, FN3 domain antibody, nanobody, single-domain antibody, or Centyrin. In other embodiments, the targeting moiety is a folic acid moiety, antibiotic mimicry, polynucleotide (such as DNA or RNA aptamers), carbohydrate, vitamin, or N-acetylgalactosamine (GalNac). Conjugating the targeting moiety to an LNP produces a targeted LNP (tLNP). In some embodiments, the targeting moiety is a ligand that binds to a receptor on the cell surface. In some embodiments, the ligand may be a natural ligand of the receptor. In some embodiments, the ligand may be a synthetic ligand of the receptor. In some embodiments, the targeting moiety is a small molecule, such as a small molecule ligand of a receptor on the cell surface. In some embodiments, the targeting moiety is a peptide or polypeptide, such as a peptide or polypeptide ligand of a receptor on the cell surface. In some embodiments, the peptide or polypeptide is linear. In other embodiments, the peptide or polypeptide is cyclic. In some implementations, the targeting moiety is a cytokine, for example, such that the cytokine targeting moiety binds to a cytokine receptor on the cell surface. Conjugating the targeting moiety to an LNP produces a targeted LNP (tLNP).

[0092] In another aspect, this disclosure provides a method for conjugating an LNP to a target portion modified with an enzyme recognition sequence, wherein the conjugation is performed via a click reaction. For example, this disclosure provides a method for conjugating an LNP to an antibody, a Fab fragment, or a single-chain variable fragment (ScFv), wherein the antibody Fab fragment or ScFv is covalently linked to a first click handle via a linker containing an enzyme recognition sequence, and the LNP is covalently linked to a second click handle. The method includes contacting the LNP with the antibody, Fab fragment, or ScFv such that the first click handle reacts with the second click handle to form a click reaction product conjugating the antibody, Fab fragment, or ScFv to the LNP. In some embodiments, the antibody Fab fragment or ScFv is directly bonded to the enzyme recognition sequence. In some embodiments, the antibody Fab fragment or ScFv is bonded to the enzyme recognition sequence via one or more amino acid residues. Specific added amino acid residues that can be covalently attached to the C-terminus of the antibody, Fab fragment, or ScFv include, but are not limited to, (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) uALEA(EAAAK) v A(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0093] In some embodiments, the enzyme recognition sequence is a sorting enzyme recognition motif or an LplA receptor peptide. In some embodiments of LNP conjugation with an antibody, one or more C-termini of the heavy or light chain of the antibody are covalently bonded directly or via a linker containing one or more amino acid residues to the enzyme recognition sequence (e.g., a sorting enzyme recognition motif or an LplA receptor peptide), as described herein. In some embodiments of LNP conjugation with a Fab fragment, the C-terminus of the heavy or light chain of the Fab fragment is covalently bonded to the enzyme recognition sequence (e.g., a sorting enzyme recognition motif or an LplA receptor peptide). In some embodiments of LNP conjugation with a ScFv, the C-terminus of the ScFv is covalently bonded to the enzyme recognition sequence (e.g., a sorting enzyme recognition motif or an LplA receptor peptide). In some of the above embodiments, the first click handle comprises a tetrazine ring or a TCO motif, and the second click handle comprises a tetrazine ring or a TCO motif. In some such embodiments, the first click handle comprises a tetrazine ring, and the second click handle comprises a TCO motif. In some embodiments, the tetrazine ring is methyltetrazine. In some embodiments, the join efficiency achieved by the disclosed method is greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90%. In some embodiments, the join efficiency achieved by the disclosed method is from about 60% to about 95%. In some embodiments, the join efficiency achieved by the disclosed method is from about 70% to about 85%.

[0094] In one embodiment, this disclosure provides a method for manufacturing lipid nanoparticles conjugated in a site-specific manner to a targeting moiety (e.g., an antibody, a Fab fragment, or a ScFv), the method comprising...

[0095] (i) Covalently attaching a peptide having a sorting enzyme recognition site to one or more C-termini of a target moiety (e.g., an antibody or a Fab fragment), or covalently attaching it to the C-terminus of a ScFv;

[0096] (ii) In the presence of a sorting enzyme, and under conditions suitable for the sorting enzyme to link the target moiety (e.g., antibody, Fab fragment, or ScFv) to the first click handle, the product of step (i) is contacted with the first click handle covalently bound to three or more glycine residues.

[0097] (iii) Contact the product of step (ii) with lipid nanoparticles (LNP), wherein one or more lipids constituting the LNP contain a second click handle capable of reacting with a first click handle, thereby generating a click product.

[0098] In some embodiments, step (i) involves covalently attaching a peptide having a sorting enzyme recognition site to a linker covalently attached to one or more C-termini of a targeting moiety (e.g., an antibody or a Fab fragment) or to the C-terminus of an ScFv. In some embodiments, the linker comprises one or more amino acid residues. Specific added amino acid residues that can be covalently attached to the C-terminus of a targeting moiety (e.g., an antibody, a Fab fragment, or an ScFv) include, but are not limited to, (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0099] In some embodiments, the sorting enzyme recognition motif, which is bonded to the C-terminus of the targeting motif (e.g., antibody, Fab fragment, or ScFv), is bonded to one or more amino acid residues. For example, in some embodiments, the glycine (G) of the LPXTG (SEQ ID NO:17) motif may be bonded to one or more (e.g., between 1 and 10) histidine (H) residues (see [link to 1]). Figure 1 Glycine and histidine residues are removed during the transpeptide reaction.

[0100] In some embodiments, step (ii) (i.e., the sorting enzyme-catalyzed reaction) is carried out in the presence of sorting enzyme A5. Sorting enzyme A5 is an engineered five-mutant variant of the wild-type sorting enzyme from Staphylococcus aureus, exhibiting significantly higher activity than the wild-type sorting enzyme. See U.S. Patent No. 9,267,227. In such embodiments, the sorting enzyme recognition site in step (i) that binds to the target motif (e.g., antibody, Fab fragment, or ScFv) has the sequence LPXTG (SEQ ID NO: 17), where X is any amino acid residue. In step (ii), sorting enzyme A catalyzes a transpeptidation reaction between the LXTG recognition motif and a glycine residue bound to a first click handle by cleaving the sorting enzyme recognition site between threonine and glycine residues.

[0101] In other embodiments, step (ii) is performed in the presence of the sorting enzyme Streptococcus pyogenes sorting enzyme A (SpSrtA WT). In such embodiments, the sorting enzyme recognition site that binds to the target motif (e.g., antibody, Fab fragment, or ScFv) in step (i) has the sequence LPXTA (SEQ ID NO:18), where X is any amino acid residue. In step (ii), SpSrtA catalyzes a transpeptidation reaction between the LPXTA (SEQ ID NO:18) recognition motif and a glycine residue bound to the first click handle by cleaving the sorting enzyme recognition site between threonine and alanine residues.

[0102] Figure 1 This diagram illustrates the formation of an LNP conjugated to the C-terminus of a Fab fragment via sorting enzyme-mediated ligation and a subsequent click reaction. In the schematic, the C-terminus of the Fab fragment is first covalently modified with a sorting enzyme recognition motif covalently bonded to six histidine (H) residues. The sorting enzyme-modified Fab fragment then reacts with a first click handle (click handle 1) covalently bonded to a glycine (G) residue. The resulting Fab fragment modified with the first click handle then reacts with an LNP containing at least one lipid covalently bonded to a second click handle (click handle 2), thereby providing an LNP specifically conjugated to the Fab fragment site.

[0103] In another embodiment, this disclosure provides a method for manufacturing lipid nanoparticles conjugated in a site-specific manner to a targeting moiety (e.g., an antibody, a Fab fragment, or a ScFv), the method comprising:

[0104] (i) Covalently bind the LplA receptor peptide site to the target region, such as an antibody, Fab fragment, or ScFv;

[0105] (ii) Under conditions suitable for lipoic acid ligase to link the target moiety (e.g., antibody, Fab fragment, or ScFv) to the first click handle, the product of step (i) is contacted with a carboxylic acid compound containing the first click handle; and

[0106] (iii) Contact the product of step (ii) with lipid nanoparticles (LNP), wherein one or more lipids constituting the LNP contain a second click handle capable of reacting with a first click handle, thereby generating a click product.

[0107] In some embodiments of step (i), the Lp1A receptor peptide is covalently bonded to one or more C-termini of an antibody or Fab fragment. In other embodiments of step (i), the Lp1A receptor peptide is covalently bonded to the C-terminus of an ScFv.

[0108] In some embodiments, step (i) involves covalently attaching a peptide having the Lp1A receptor peptide to a linker covalently attached to one or more C-termini of a targeting moiety (e.g., an antibody or Fab fragment) or to the C-terminus of an ScFv. In some embodiments, the linker comprises one or more amino acid residues. Specific added amino acid residues that may be covalently attached to the C-terminus of a targeting moiety (e.g., an antibody, Fab fragment, or ScFv) include, but are not limited to, (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) v A(SEQ ID NO:14), where u is 1-10 and v is 1-10.

[0109] In some embodiments, step (ii) (i.e., the reaction catalyzed by the lipoic acid ligase) is carried out in the presence of a mutant lipoic acid ligase, wherein the tryptophan residue at the (W) position of the lipoic acid ligase is mutated. Specific W37 mutants are described in Cohen et al., 2012, ChemBioChem, 13, 888-894. In some embodiments, the mutant lipoic acid ligase is selected from W37V, W37I, W37T, W37L, W37C, W37A, and W37G.

[0110] In some embodiments, the carboxylic acid in step (ii) (i.e., the reaction catalyzed by lipoic acid ligase) is C3-C. 20 Carboxylic acid. In some embodiments, the carboxylic acid in step (ii) is a fatty acid, such as C7-C... 19 Fatty acid. In some such embodiments, the fatty acid is selected from decanoic acid, palmitic acid, lauric acid, or octanoic acid. In some embodiments, the first click handle covalently bonded to the carboxylic acid (e.g., fatty acid) comprises a tetrazine ring. In some embodiments, the tetrazine ring is a methyltetrazine ring. In other embodiments, the first click handle covalently bonded to the carboxylic acid comprises a TCO moiety. In other embodiments, the first click handle covalently bonded to the carboxylic acid (e.g., fatty acid) comprises an azide group.

[0111] In other embodiments, the carboxylic acid in step (ii) has the formula COOH-R-click handle, wherein R comprises two lipid chains. In some such embodiments, the carboxylic acid is as follows, where n = 1–120.

[0112]

[0113]

[0114]

[0115] Figure 2 The diagram illustrates the formation of an LNP conjugated to the C-terminus of a Fab fragment via LplA linkage and a subsequent click reaction. In the schematic, the C-terminus of the Fab fragment is first covalently modified with an LplA receptor peptide. Specifically, a first click handle (click handle 1) is first introduced by chemically reacting a carboxylic acid with a lysine residue of the LplA receptor peptide. The resulting Fab fragment modified with the first click handle then reacts with an LNP containing at least one lipid covalently bonded to a second click handle (click handle 2), thereby providing an LNP specifically conjugated to the Fab fragment site.

[0116] Conjugates prepared using the site-specific methods disclosed herein have a high density of targeting agents on the surface of LNPs. For example, the conjugate may contain more than one targeting moiety (e.g., antibody, Fab fragment, or ScFv) per LNP. In some embodiments, the conjugate may contain more than 10 targeting moieties (e.g., antibody, Fab fragment, or ScFv) per LNP. In some embodiments, the conjugate may contain more than 20 targeting moieties (e.g., antibody, Fab fragment, or ScFv) per LNP. In some embodiments, the conjugate may contain more than 30 targeting moieties (e.g., antibody, Fab fragment, or ScFv) per LNP. In some embodiments, the conjugate may contain more than 50 targeting moieties (e.g., antibody, Fab fragment, or ScFv) per LNP. In some embodiments, the conjugate may contain more than 75 targeting moieties (e.g., antibody, Fab fragment, or ScFv) per LNP. In some embodiments, the conjugate may contain more than 100 targeting moieties (e.g., antibody, Fab fragment, or ScFv). In some embodiments, the conjugate may contain about 50 to about 200 targeting moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP. In some embodiments, the conjugate may contain about 100 to about 200 targeting moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP. In some embodiments, the conjugate may contain about 10 to about 150 targeting moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP. In some embodiments, the conjugate may contain about 10 to about 30 targeting moieties (e.g., antibodies, Fab fragments, or ScFv) per LNP.

[0117] The enzyme recognition site binds to a specific site on the target region. For example, the enzyme recognition sequence can bind to the C-terminus, N-terminus, or frame region of one of the aforementioned formats. The target region binds to the enzyme recognition sequence in a site-specific manner. Therefore, the LNP formed after the click reaction undergoes site-selective modification on its surface, which has significant advantages, as disclosed herein.

[0118] In some embodiments, the C-terminus of the targeting moiety (e.g., antibody, Fab fragment, scFv, DARPIN, VHH domain antibody, FN3 domain or nanobody, single-domain antibody, or Centyrin) is bonded to an enzyme recognition sequence. In embodiments where the targeting moiety has more than one C-terminus (e.g., antibody or Fab fragment), the enzyme recognition sequence may be bonded to one or more C-termini of the targeting moiety. For example, the enzyme recognition sequence may be bonded to the C-terminus of one or two heavy chains and / or one or two light chains. In some embodiments, the enzyme recognition sequence is bonded to the C-terminus of the heavy chain of an antibody or Fab fragment.

[0119] In one embodiment, the conjugate comprises a protein-targeting motif (e.g., an antibody, Fab fragment, or ScFv) as described above and a lipid nanoparticle (LNP), wherein the C-terminus of the targeting motif is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises a sorting enzyme recognition motif and a click product formed by a click reaction between a first click handle on the targeting motif and a second click handle on the LNP. In some embodiments, the C-terminus of one or more of the heavy or light chains of the antibody, the C-terminus of the heavy or light chain of the Fab fragment, or the C-terminus of the ScFv is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises a sorting enzyme recognition motif and a click product formed by a click reaction between a first click handle on the antibody, Fab fragment, or ScFv and a second click handle on the LNP. In a specific embodiment, the sorting enzyme recognition motif comprises an LPXT motif, where X is any amino acid residue. In some such embodiments, the sorting enzyme recognition motif comprises an LPET motif. In some embodiments, the linker comprises three or more glycine residues between the sorting enzyme recognition motif and the click product. In some embodiments, the linker comprises between 3 and 50 glycine residues. In some embodiments, the linker contains between 3 and 10 glycine residues. In some such embodiments, the linker contains 3, 4, 5, or 6 glycine residues.

[0120] In some implementations, the conjugate has a structural targeting moiety -LPXT(G). n (SEQ ID NO:19) - Click product - LNP, for example, antibody - LPXT(G) n(SEQ ID NO:19) - Click product - LNP, Fab fragment - LPXT(G) n (SEQ ID NO:19) - Click product - LNP, or ScFv-LPXT(G) n (SEQ ID NO:19) - Click Product - LNP, wherein X is any amino acid residue and n is between 1 and 20 (e.g., between 3 and 10 or between 3 and 6). In these embodiments, the leucine (L) residue of the sorting enzyme recognition motif is bonded to at least one C-terminus of the antibody or Fab fragment or the C-terminus of the ScFv. In some such embodiments, X is E. In some embodiments, the linker between the antibody (or Fab fragment or ScFv) and the click comprises the following amino acid residues: LPETGGG (SEQ ID NO:20), LPETGGGG (SEQ ID NO:21), LPETGGGGG (SEQ ID NO:22), LPETAGGG (SEQ ID NO:23), or LPETGGGGGG (SEQ ID NO:24).

[0121] In some embodiments, the linker further comprises additional amino acid residues between the targeting moiety (e.g., antibody, Fab fragment, or ScFv) and the sorting enzyme recognition motif. In such embodiments, the C-terminus of the targeting moiety (e.g., antibody, Fab fragment, or ScFv) may be covalently modified with one or more amino acid residues before covalently linking to the sorting enzyme recognition motif. For example, in a specific embodiment, the conjugate has a structural targeting moiety -Z-LPXT(G). n (SEQ ID NO:19) - Click product - LNP, for example, antibody - Z-LPXT(G) n (SEQ ID NO:19) - Click product - LNP, Fab fragment - Z-LPXT(G) n (SEQ ID NO:19) - Click product - LNP, or ScFv-Z-LPXT(G) n (SEQ ID NO:19) - Click Product - LNP, wherein Z is a linker between the antibody (or Fab fragment or ScFv) and a leucine residue of the sorting enzyme recognition motif. In some embodiments, Z comprises one or more amino acid residues. In some embodiments, Z is (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v(SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) vA (SEQ ID NO:14), where u is 1-10 and v is 1-10. In some embodiments, Z is GG, GGG, GGGG (SEQ ID NO:25), GGGGG (SEQ ID NO:26), GGGGGG (SEQ ID NO:27), and GGGGGGG (SEQ ID NO:28) or GGGGGS (SEQ ID NO:29).

[0122] In some implementations, the conjugate has a structural targeting moiety -LPXT(G). n (SEQ ID NO:19)-Dihydropyridazine-LNP, for example, antibody-LPXT(G) n (SEQ ID NO:19)-Dihydropyridazine-LNP,Fab fragment-LPXT(G) n (SEQ ID NO:19)-Dihydropyridazine-LNP or ScFv-LPXT(G) n (SEQ ID NO:19)-Dihydropyridazine-LNP, Antibody-Z-LPXT(G) n (SEQ ID NO:19)-Dihydropyridazine-LNP,Fab fragment-Z-LPXT(G) n (SEQ ID NO:19)-Dihydropyridazine-LNP or ScFv-Z-LPXT(G) n (SEQ ID NO:19)-Dihydropyridazine-LNP, where variables n and Z are defined as above. In a specific embodiment, the dihydropyridazine portion is 1,4-dihydropyridazine.

[0123] In another embodiment, the conjugate comprises a protein-targeting moiety (e.g., antibody, Fab fragment, or ScFv) as described above, which is conjugated to a lipid nanoparticle via a linker, wherein the linker comprises a lipoic acid ligase (LplA) receptor peptide and a click product formed by a click reaction between a first click handle on the targeting moiety and a second click handle on the LNP. In some embodiments, the linker further comprises one or more additional amino acid residues between the protein-targeting moiety (e.g., antibody, Fab fragment, or ScFv) and the LplA receptor peptide. In some embodiments, the LplA receptor peptide has the sequence GFEDKVWYDLDA (SEQ ID NO: 15). In some embodiments, the conjugate comprises an antibody, wherein the C-terminus of one or more of the heavy or light chains of the antibody is bonded to the linker. In some embodiments, the conjugate comprises a Fab fragment, wherein the C-terminus of the heavy or light chain of the Fab fragment is bonded to the linker. In some embodiments, the conjugate comprises an ScFv, wherein the C-terminus of the ScFv is bonded to the linker.

[0124] In some embodiments, the linker comprises additional amino acid residues between the targeting moieties. For example, an antibody, a Fab fragment, or a ScFv and an LplA receptor peptide. In such embodiments, the C-terminus of the targeting moieties (e.g., an antibody, a Fab fragment, or a ScFv) may be covalently modified with one or more amino acid residues before covalently linking the LplA receptor peptide. For example, in a specific embodiment, the conjugate has a structural targeting moieties -Z-LplA receptor peptide-click product-LNP, such as antibody-Z-LplA receptor peptide-click product-LNP, Fab fragment-Z-LplA receptor peptide-click product-LNP, or ScFv-Z-LplA receptor peptide-click product-LNP, where Z is a linker between the antibody (or Fab fragment or ScFv) and a glycine residue of the LplA receptor peptide. In some embodiments, Z comprises one or more amino acid residues. In some embodiments, Z is (GGGGS). v (SEQ ID NO:9), (G) v (SEQ ID NO:10), (EAAAK) v (SEQ ID NO:11), (PAPAP) v (SEQ ID NO:12), (AP) v (SEQ ID NO:13) and A(EAAAK) u ALEA(EAAAK) vA(SEQ ID NO:14), where u is 1-10 and v is 1-10. In some embodiments, Z is GG, GGG, GGGG (SEQ ID NO:25), GGGGG (SEQ ID NO:26), GGGGGG (SEQ ID NO:27), and GGGGGGG (SEQ ID NO:28) or GGGGGS (SEQ ID NO:29).

[0125] It should be understood that in the above embodiments, the lysine (K) residue of the LplA receptor peptide is covalently linked to the click product, which in turn is covalently linked to the LNP. Specifically, to generate the conjugate, the side-chain lysine acyl group reacts with a carboxylic acid compound containing a first click handle. The resulting modified targeting moiety (e.g., antibody, Fab fragment, or ScFv) reacts with the LNP modified with a second click handle, as disclosed herein, to generate the click product. The following shows the surface of an LNP modified with a Fab fragment, where R is a lipid group (e.g., C...). 2- C 30 alkyl groups).

[0126]

[0127] In other embodiments, the enzyme recognition sequence is a transglutaminase recognition sequence (LLQG (SEQ ID NO:16)). The transglutaminase recognition sequence (LLQG (SEQ ID NO:16)) is also known as a Q-tag. The Q-tag may be present at one or more sites on the target moiety (e.g., antibody, Fab fragment, or ScFv), such as at the C-terminus, or may be inserted therein. Transglutaminase catalyzes a reaction between the side-chain amide group on the Q-tag and an alkyl primary amine on the LNP component (e.g., lipid), thereby linking the antibody to the LNP via an amide bond.

[0128] In other embodiments, the enzyme recognition sequence is a sequence recognized by a formylglycine synthase, specifically CXPXR, where each X is any amino acid. In such embodiments, the CXPXR sequence can be inserted at one or more sites on the targeting moiety (e.g., an antibody, a Fab fragment, or a ScFv), such as at the C-terminus. The formylglycine synthase converts the cysteine ​​thiol of CXPXR into an aldehyde group, which can react with an aminooxy or hydrazine group of the component bonded to the LNP.

[0129] The click products used to form conjugates can be formed using bisorthogonal chemistry methods.

[0130] In one embodiment, a copper-catalyzed click reaction can be used to form the click product. One such copper-catalyzed click reaction is the Hughesgen 1,3-dipolar cycloaddition (CuAAC) between an azide and an alkyne. In some embodiments, the first or second click handle comprises a cyclic derivative of an alkynyl group. In some embodiments, the cyclic derivative of the alkynyl group is selected from dibenzocyclooctyne, cyclooctyne, and difluorinated cyclooctyne. In some embodiments, the click chemistry involves strain-promoted cycloaddition of an azide. In some embodiments, the click chemistry is based on the reaction of a strained olefin.

[0131] In another embodiment, copper-free click chemistry can be used to form the click product. For example, a click product can be formed between an azide and dibenzocyclooctene (DBCO). Alternatively, a Staudinger reaction between an azide and a phosphine can be used to form the click product, thereby producing an azaylide.

[0132] In some embodiments, the click product can be formed by a reverse electron-demanding Diels-Alder reaction between a trans-cyclooctene (TCO) moiety on the first or second click handle and a tetrazine ring on the first or second click handle. In some embodiments, the first click handle comprises a tetrazine (Tz) ring, and the second click handle comprises a TCO moiety. In some embodiments, the tetrazine ring is unsubstituted. In some such embodiments, the tetrazine ring is a methyltetrazine. In some embodiments, the tetrazine ring is a 6-methyl-substituted tetrazine.

[0133] In some implementations, the first or second click handle is a tetrazine derivative having one of the following structures:

[0134]

[0135] in This represents the attachment point of the compound joint or LNP.

[0136] In some embodiments, when the linker of the conjugate contains a sorting enzyme recognition motif covalently bound to three or more glycine residues, the attachment site of the tetrazine derivative is at a glycine residue of the linker. For example, in embodiments where the linker contains a sorting enzyme recognition motif bonded to three glycine residues, the tetrazine residue may be covalently bonded to a third (N-terminal) glycine residue. In some embodiments, when the linker of the conjugate contains an LplA receptor peptide, the attachment site of the tetrazine derivative is at a lysine (K) residue of the LplA receptor peptide.

[0137] In some implementations, the first or second click handle is a TCO derivative having one of the following structures:

[0138]

[0139] III. Instructions for Use

[0140] In any of the above embodiments, the targeting portion component of the conjugates disclosed herein may target cell surface antigens or receptors. In some embodiments, the targeting portion component of the conjugate enhances the delivery of the payload (e.g., therapeutic payload) formulated in the LNP component of the conjugate by targeting cell surface antigens or receptors on cells. In some embodiments, the conjugates described herein deliver the payload to more target cells and / or deliver a greater quantity of payload to target cells compared to conjugates lacking a targeting portion or having a smaller targeting portion per LNP. Enhancing the delivery of therapeutic payloads to target cells (e.g., immune cells or diseased or dysfunctional cells) using targeting conjugates (LNPs) as described herein can improve the treatment of a patient's (e.g., human) disease or ailment.

[0141] In some embodiments, the targeting fraction of the conjugates disclosed herein targets T-cell receptors, including but not limited to CD2, CD3, CD4, CD5, CD6, CD7, or CD8. In other embodiments, the targeting fraction of the conjugates disclosed herein targets hematopoietic stem cells (HSCs). In some embodiments, the targeting fraction of the conjugates disclosed herein targets HSC receptors, including but not limited to CD90 or CD117. In other embodiments, the targeting fraction of the conjugates binds to CD8, TCRα, TCRβ, CD10, CD33, CD34, CD68, CD19, CD62L, CD25, CXCR3, CCR2, CCR3, CCR4, CCR5, CCR6, or CCR7, or combinations thereof.

[0142] In some embodiments, the targeting portion binds to CD4+ or CD8+ T cells. In other embodiments, the targeting portion binds to natural killer (NK) cells. In other embodiments, the targeting portion binds to hematopoietic stem cells. In other embodiments, the targeting portion binds to lymphoid progenitor cells. In other embodiments, the targeting portion binds to myeloid cells. In other embodiments, the targeting portion binds to macrophages.

[0143] The conjugates disclosed herein can be used to deliver specific payloads to cells, particularly cells expressing cell surface receptors targeted by the targeting portion (e.g., antibody, Fab fragment, or ScFv) component of the conjugate. In some embodiments, the payload is RNA. In some embodiments, the payload is mRNA. In other embodiments, the payload is siRNA or microRNA (miRNA). In other embodiments, the payload is an antisense oligonucleotide (ASO). In other embodiments, the payload is tRNA. In other embodiments, the payload is a DNA vector, such as a DNA plasmid, closed-terminal DNA (ceDNA), or small circular DNA (e.g., nanoparticles). In other embodiments, the payload is a small molecule. In other embodiments, the payload is guide RNA. In some embodiments, the payload is a peptide or protein. In some embodiments, the conjugates disclosed herein may comprise two or more payloads of the same or different payload categories, for example, selected from any two or more mRNAs, guide RNAs, siRNAs, miRNAs, ASOs, DNA vectors, small molecules, peptides, and proteins.

[0144] The conjugates disclosed herein can be used to deliver therapeutic agents of interest to cells. For example, in some embodiments, the conjugates disclosed herein can be used to deliver nucleic acids (e.g., mRNA) encoding vaccines. In other embodiments, the conjugates disclosed herein can be used to deliver nucleic acids (e.g., mRNA) encoding enzymes. In other embodiments, the conjugates disclosed herein can be used to deliver nucleic acids (e.g., DNA or RNA molecules) encoding chimeric antigen receptors (CARs) to T cells.

[0145] The conjugates described herein can be used to target and modify immune cells. In some embodiments, the conjugates can be used to modify T cells. In some embodiments, T cells can include any T cell subset, such as CD4+, CD8+, γ-δ, naive T cells, stem cell memory T cells, central memory T cells, or mixtures of various subsets. In some embodiments, the conjugates can be used to deliver or modify T cell receptors (TCRs) on T cells. In some embodiments, the conjugates can be used to deliver at least one chimeric antigen receptor (CAR) to T cells. For example, in a specific embodiment, the conjugates can be used to deliver a CAR or a nucleic acid encoding a CAR (e.g., DNA or RNA, such as mRNA) to T cells. In some embodiments, the conjugates can be used to deliver at least one CAR, i.e., a nucleic acid encoding a CAR (e.g., DNA or RNA, such as mRNA), to natural killer (NK) cells. In some embodiments, the conjugates can be used to deliver a CAR or a nucleic acid encoding a CAR (e.g., DNA or RNA, such as mRNA) to natural killer T (NKT) cells. In some embodiments, the conjugate can be used to deliver at least one CAR or a nucleic acid encoding a CAR (e.g., DNA or RNA, such as mRNA) to progenitor cells, such as T, NK, or NKT cells. In some embodiments, cells modified with at least one CAR (e.g., CAR-T cells, CAR-NK cells, CAR-NKT cells) or combinations of cells modified with at least one CAR (e.g., a mixture of CAR-NK / T cells) are used to treat diseases identified in the targetable landscape of CAR therapies, such as in MacKay et al., Nat Biotechnol 38, 233-244 (2020).In some embodiments, the immune cells comprise CARs specific to tumor or pathogen antigens, said CARs being selected from AChR (fetal acetylcholine receptor), ADGRE2, AFP (alpha-fetoprotein), BAFF-R, BCMA, CAIX (carbonic anhydrase IX), CCR1, CCR4, CEA (carcinoembryonic antigen), CD3, CD5, CD8, CD7, CD10, CD13, CD14, CD15, CD19, CD20, CD22, CD30, CD33, CL11, CD34, CD38, CD41, CD44, CD49f, CD56, CD61, CD64, CD68, CD70, CD74, CD99, CD117, CD123, CD133, CD138, CD44v6, CD267, CD26 ...139, CD1 S, CLEC12A, CS1, EGP-2 (epithelial glycoprotein-2), EGP-40 (epithelial glycoprotein-40), EGFR (HER1), EGFR-VIII, EpCAM (epithelial cell adhesion molecule), EphA2, ERBB2 (HER2, human epidermal growth factor receptor 2), ERBB3, ERBB4, FBP (folate-binding protein), Flt3 receptor, folate receptor-a, GD2 (ganglioside G2), GD3 (ganglioside G3), GPC3 (phosphatidylinositol polysaccharide-3), GPI00, hTERT (human telomerase reverse transcriptase), ICAM-1, integrin B7, interleukin-6 receptor, IL13Ra2 (interleukin-13 receptor 30 subunit α-2), κ light chain, KDR (kinase insertion domain receptor), LeY (Lewis Y), L1CAM (L1 cell adhesion molecule), LILRB2 (leukocyte immunoglobulin-like receptor B2), MARTI, MAGE-A1 (melanoma-associated antigen A1), MAGE-A3, MSLN (mesothelin), MUC16 (mucin 16), MUCI (mucin I), KG2D ligand, NY-ESO-1 (cancer testis antigen), PRI (proteinase 3), TRBCI, TRBC2, TFM-3, TACI, tyrosinase, survivin, hTERT, carcinoembryonic antigen (h5T4), p53, PSCA (prostate stem cell antigen), PSMA (prostate-specific membrane antigen), hROR1, TAG-72 (tumor-associated glycoprotein 72), VEGF-R2 (vascular endothelial growth factor R2), WT-1 (Wilms tumor protein), and HIV (human immunodeficiency virus), hepatitis B, hepatitis C, CMV (cytomegalovirus), EBV (Epstein-Barr virus). Antigens of HPV (human papillomavirus).

[0146] In some embodiments, the conjugate as described herein is applied in vitro or ex vivo to immune cells (e.g., T cells, NK cells, NKT cells, or progenitor cells) to deliver a therapeutic payload (e.g., a gene-modified system), and then the cells are delivered to a patient. In some embodiments, immune cells (e.g., T cells, NK cells, NKT cells, or progenitor cells) are modified in vitro or ex vivo and then delivered to a patient. In some embodiments, nucleic acids (e.g., DNA or RNA, such as mRNA) are delivered using one of the methods mentioned herein, and immune cells, such as T cells, NK cells, NKT cells, or progenitor cells, are modified in the patient. In some embodiments, the patient is a human patient, such as a human patient requiring this treatment.

[0147] In some implementations, the targeting portion is a T-cell targeting portion, such as an antibody, Fab fragment, or ScFv, which binds to T-cell antigens selected from the group consisting of: CD2, CD3, CD4, CD5, CD7, CD8, CD28, CD137, CD45, T-cell receptor (TCR)β, TCR-α, TCR-α / β, TCR-γ / δ, PD1, CTLA4, TIM3, LAG3, CD18, IL-2 receptor, CD11a, TLR2, TLR4, TLR5, IL-7 receptor, or IL-15 receptor.

[0148] In some embodiments, conjugates as described herein are applied in vitro or ex vivo to HSCs (e.g., LT-HSCs) or HSC progenitor cells to deliver a therapeutic payload (e.g., a gene-modified system), and then the cells are delivered to a patient. In some embodiments, conjugates as described herein are applied in vivo to HSCs (e.g., LT-HSCs) or HSC progenitor cells to deliver a therapeutic payload (e.g., a gene-modified system). In some embodiments, HSCs (e.g., LT-HSCs) or HSC progenitor cells are modified in vitro or ex vivo and then delivered to a patient. In some embodiments, HSCs (e.g., LT-HSCs) or HSC progenitor cells are modified in vivo in a patient. In some embodiments, the patient is a human patient, such as a person requiring this treatment.

[0149] In some implementations, the targeting portion is an HSC targeting portion, such as an antibody, Fab fragment, or ScFv, which binds to an HSC antigen selected from CD90 and CD117.

[0150] The conjugates disclosed herein can be introduced into cells, tissues, and multicellular organisms. In some embodiments, the system or components of the system are delivered to cells via mechanical or physical means. In some embodiments, the cells are human cells.

[0151] In some embodiments, the conjugates described herein are delivered to the brain, cerebellum, adrenal glands, ovaries, pancreas, parathyroid glands, pituitary gland, testes, thyroid gland, breast, spleen, tonsils, thymus, lymph nodes, bone marrow, lungs, myocardium, esophagus, stomach, small intestine, colon, liver, salivary glands, kidneys, prostate, blood, or other cell or tissue types or tissues located therein. In some embodiments, the conjugates described herein are used to treat diseases such as cancer, inflammatory diseases, infectious diseases, genetic defects, or other diseases. Cancer can be a cancer of the brain, cerebellum, adrenal glands, ovaries, pancreas, parathyroid glands, pituitary gland, testes, thyroid gland, breast, spleen, tonsils, thymus, lymph nodes, bone marrow, lungs, myocardium, esophagus, stomach, small intestine, colon, liver, salivary glands, kidneys, prostate, blood, or other cell or tissue types, and can include a variety of cancers.

[0152] In some embodiments, the conjugates described herein are administered via enteral administration (e.g., oral, rectal, gastrointestinal, sublingual, sublipal, or buccal administration). In some embodiments, the conjugate system described herein is administered via parenteral administration (e.g., intravenous, intramuscular, subcutaneous, intradermal, epidural, intracerebral, intraventricular, epidermal, nasal, intraarticular, intra-articular, intracavernous, intraocular, intraosseous, intraperitoneal, intrathecal, intrauterine, intravaginal, intravesical, perivascular, or transmucosal administration). In some embodiments, the conjugates described herein are administered via topical administration (e.g., transdermal administration).

[0153] In some embodiments, the conjugates described herein are used to treat diseases, conditions, or disorders. In some embodiments, the conjugates described herein, or components or portions thereof, are used to treat any of the diseases, conditions, or disorders listed in Tables 1-6. In some such embodiments, the conjugates described herein, or components or portions thereof, are used to treat a disease, condition, or disorder in a human patient. In some embodiments, the conjugates described herein are used to treat hematopoietic stem cell (HSC) diseases, conditions, or disorders, for example, as listed in Table 1. In some embodiments, the conjugates described herein are used to treat kidney diseases, conditions, or disorders, for example, as listed in Table 2. In some embodiments, the conjugates described herein are used to treat liver diseases, conditions, or disorders, for example, as listed in Table 3. In some embodiments, the conjugates described herein are used to treat lung diseases, conditions, or disorders, for example, as listed in Table 4. In some embodiments, the conjugates described herein are used to treat skeletal muscle diseases, conditions, or disorders, for example, as listed in Table 5. In some embodiments, the conjugates described herein are used to treat skin diseases, conditions, or disorders, for example, as listed in Table 6.

[0154] Table 1-6: Specific Indications

[0155] Table 1: HSC

[0156]

[0157]

[0158] Table 2: Kidneys

[0159] Disease Affected gene Congenital nephrotic syndrome NPHS2 Cystinosis CTNS

[0160] Table 3: Liver

[0161]

[0162]

[0163] Table 4: Lungs

[0164]

[0165] Table 5: Skeletal Muscle

[0166]

[0167] Table 6: Skin

[0168]

[0169]

[0170] IV. Treatment Effective Payload

[0171] The conjugates (targeted LNPs) described herein can be used to deliver payloads (e.g., containing therapeutic agents) to cells such as, but not limited to, immune cells (e.g., T cells) or HSCs (e.g., LT-HSCs) or HSC progenitor cells.

[0172] In some embodiments, the payload is one or more nucleic acids. In some embodiments, the payload is one or more RNA molecules. In some embodiments, the payload is mRNA (e.g., mRNA encoding an enzyme). In some embodiments, the RNA molecule is non-coding RNA (ncRNA). In some embodiments, the payload is an RNA template (e.g., an RNA template for reverse transcription, such as targeted priming reverse transcription (TPRT)). In other embodiments, the payload is siRNA or microRNA (miRNA). In other embodiments, the payload contains guide RNA for the CRISPR-Cas system. In other embodiments, the payload is tRNA. In other embodiments, the payload is an antisense oligonucleotide (ASO). In other embodiments, the payload is a DNA molecule, such as a DNA plasmid, closed-terminal DNA (ceDNA), or small circular DNA (e.g., microcircles or nanoparticles). Nucleic acid payloads can be linear, circular, covalently blocked, single-stranded, double-stranded, or hybrid RNA / DNA molecules. In other embodiments, the payload is a small molecule. In some embodiments, the payload is a peptide or protein. In some embodiments, the conjugates disclosed herein may include two or more payloads, such as those selected from RNA (e.g., mRNA, ncRNA, guide RNA, siRNA, miRNA), ASO, DNA vectors, small molecules, peptides, and proteins.

[0173] The conjugates (targeted LNPs) described herein can be used to deliver therapeutic agents of interest to cells, such as, but not limited to, immune cells (e.g., T cells), HSCs, or HSC progenitor cells. In some embodiments, the conjugates (targeted LNPs) contain a payload as a therapeutic agent. In some embodiments, the therapeutic agent may be a therapeutic peptide or protein, a nucleic acid containing a therapeutic agent, or a nucleic acid encoding a therapeutic agent. In some embodiments, the therapeutic agent may be a gene therapy drug (e.g., for gene therapy or gene editing), wherein the therapeutic agent is capable of modifying, altering, or influencing changes in the cellular genomic DNA, such as, but not limited to, immune cells, such as T cells, HSCs (e.g., LT-HSCs), or HSC progenitor cells in a subject. In some embodiments, the therapeutic agent is a gene therapy agent or a gene editing agent. In some embodiments, the therapeutic agent is a gene-modifying peptide, as described herein. In some embodiments, the therapeutic agent is a gene-modifying system, as described herein.

[0174] In some embodiments, the therapeutic agent may be a peptide or protein, such as an enzyme, or a nucleic acid (e.g., mRNA or DNA) encoding a peptide or protein (e.g., an enzyme). In some embodiments, the enzyme may be or include nucleases, recombinases, integrases, transposases, reverse transcriptases, helicases, transcriptases, polymerases, reverse transcriptases, deaminases, methyltransferases, demethylases, or ligases, or may be a combination having their enzymatic activities. In some embodiments, the therapeutic agent may be a peptide or protein, or a nucleic acid encoding a peptide or protein, for use as an alternative gene therapy. In some embodiments, the therapeutic agent may be a peptide or protein, or a nucleic acid encoding a peptide or protein, for modifying or altering the genome or epigenome of a cell, such as, but not limited to, immune cells, such as a subject's T cells, HSCs, or HSC progenitor cells. In some embodiments, the therapeutic agent may comprise one or more components of a system for modifying or altering the genome or epigenome of a cell, such as, but not limited to, immune cells, such as a subject's T cells, HSCs, or HSC progenitor cells. In some embodiments, the system for modifying or altering the genome or epigenome of a subject's cells comprises one or more proteins, one or more nucleic acids (e.g., RNA and / or DNA), or combinations thereof. In some embodiments, the therapeutic agent may be a fusion protein, such as a fusion protein comprising a nuclease (e.g., an endonuclease such as Cas9 or a functional portion thereof) and a protein domain comprising recombinase, integrase, transposase, reverse transcriptase, helicase, transcriptase, polymerase, reverse transcriptase, deaminase, methyltransferase, demethylase, or ligase activity.

[0175] In some embodiments, the therapeutic agent may be one or more components of a ribonucleoprotein (RNP) for modifying or altering the cellular genome or epigenome (RNP), such as, but not limited to, immune cells, such as T cells, HSCs, or HSC progenitor cells. For example, in some cases, the therapeutic agent may be a protein, or a nucleic acid (e.g., mRNA) encoding the protein, and / or an RNA molecule (e.g., gRNA or RNA containing gRNA) for guiding the protein to a specific location in the genome or epigenome, wherein the protein is capable of modifying or altering the genome or epigenome as a nuclease, recombinase, integrase, transposase, helicase, transcriptase, polymerase, reverse transcriptase, deaminase, methyltransferase, demethylase, or ligase, or a combination thereof.

[0176] In some embodiments, the therapeutic agent comprises a nuclease (e.g., an endonuclease) or a nucleic acid encoding a nuclease (e.g., an endonuclease). In some embodiments, the nuclease cleaves DNA to produce double-strand breaks, resulting in the introduction of insertion and / or deletion (insertion-deletion) mutations in the DNA (e.g., genomic DNA). In some embodiments, the nuclease is a nicking enzyme (i.e., it cleaves single strands of DNA). In some embodiments, the nuclease is mutated, causing it to become inactive or containing reduced nuclease activity. In some embodiments, the nuclease is a CRISPR-Cas protein. In some embodiments, the nuclease is a recombinant nuclease. In some embodiments, the nuclease is a restriction endonuclease, a broad-spectrum nuclease, a homing endonuclease, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN).

[0177] In some embodiments, the conjugates (targeting LNPs) disclosed herein can be used to deliver gene-editing components into cells. In some embodiments, the conjugates described herein can be used to deliver therapeutic agents comprising a CRISPR-Cas system or a component thereof into cells. In some embodiments, the therapeutic agent comprises a class I (type I, III, or IV) CRISPR-Cas protein or nucleic acid encoding a CRISPR-Cas protein. In some embodiments, the therapeutic agent comprises a class II (type II, V, or VI) CRISPR-Cas protein or nucleic acid encoding a CRISPR-Cas protein. In some embodiments, the therapeutic agent comprises a CRISPR-Cas9 system or nucleic acid encoding one or more components of the CRISPR-Cas9 system. In some embodiments, the therapeutic agent comprises a CRISPR-Cas12 system (e.g., the Cas12a system) or nucleic acid encoding one or more components of the CRISPR-Cas12 system. In some such embodiments, the conjugates described herein may comprise two RNA molecules, such as RNA comprising guide RNA (gRNA) and mRNA encoding a CRISPR-Cas protein. In some embodiments, Cas is Cas9 or Cas12a. In some embodiments, Cas is Cas9. In some embodiments, Cas is Cas12a. In some embodiments, the gRNA is a single guide RNA (sgRNA). In some embodiments, the LNP (e.g., a targeting LNP) comprises or contains a payload consisting of Cas9 or an mRNA encoding Cas9.

[0178] In some embodiments, the therapeutic agent comprises one of the following CRISPR-Cas proteins or a nucleic acid (e.g., mRNA) encoding one of the following CRISPR-Cas proteins: Cas9 (e.g., dCas9 and nCas9), Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, or Cas12i. In some embodiments, the therapeutic agent comprises *Streptococcus pyogenes* or *Streptococcus thermophilus* Cas9, or a functional fragment thereof, or a nucleic acid encoding Cas9 or a functional fragment thereof. In some embodiments, the therapeutic agent comprises a Cas9 sequence, for example, as described in Chylinski, Rhun, and Charpentier (2013) RNA Biology 10:5, 726-737; which is incorporated herein by reference.In the implementation scheme, the therapeutic agent comprises one of the following CRISPR-Cas proteins or a nucleic acid (e.g., mRNA) encoding one of the following CRISPR-Cas proteins: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas8a, Cas8b, Cas8c, Cas9 (e.g., Csn1 or Csx12), Cas10, Cas1 0d, Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, Cas12i, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm 5. Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx 1S, Csx11, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csa1, Csa2, Csa3, Csa4, Csa5, type II Cas Effector proteins, type V Cas effector proteins, type VI Cas effector proteins, CARF, DinG, Cpf1, Cas12b / C2c1, Cas12c / C2c3, Cas12b / C2c1, Cas12c / C2c3, SpCas9 (K855A), eSpCas9 (1.1), SpCas9-HF1, the hyperprecise Cas9 variant (HypaCas9), SpRYCas9, their homologs, their modified or engineered forms, and / or their functional fragments. In embodiments, Cas9 comprises one or more substitutions, for example selected from H840A, D10A, P475A, W476A, N477A, ​​D1125A, W1126A, and D1127A. In the implementation, Cas9 includes one or more mutations selected from the following positions: D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986 and / or A987, for example, one or more substitutions selected from D10A, G12A, G17A, E762A, H840A, N854A, N863A, H982A, H983A, A984A and / or D986A.In some implementations, the therapeutic agent comprises a Cas (e.g., Cas9) or a fragment or variant thereof encoding a Cas derived from Corynebacterium ulcerans, Corynebacterium diphtheria, Spiroplasma syrphidicola, Prevotella intermedia, Spiroplasma taiwanense, Streptococcus iniae, Belliella baltica, Psychroflexus torquis, Streptococcus thermophilus, Listeria innocua, Campylobacter jejuni, Neisseria meningitidis, Streptococcus pyogenes, or Staphylococcus aureus.

[0179] In some embodiments, the therapeutic agent comprises a Cpf1 domain, for example, comprising one or more substitutions, such as at positions D917, E1006A, D1255, or any combination thereof, selected from D917A, E1006A, D1255A, D917A / E1006A, D917A / D1255A, E1006A / D1255A, and D917A / E1006A / D1255A, or a nucleic acid encoding thereus.

[0180] In some implementations, the therapeutic agent comprises spCas9, spCas9-VRQR, spCas9-VRER, xCas9, saCas9, saCas9-KKH, spCas9-MQKSER, spCas9-LRKIQK, or spCas9-LRVSQL, or a nucleic acid encoding therethe.

[0181] In some embodiments, the therapeutic agent comprises a Cas9 nicking enzyme (nCas9), such as Streptococcus pyogenes nCas9, for example, wherein the Cas9 contains an amino acid substitution at position D10 or H840, such as D10A or H840A, or a nucleic acid (e.g., mRNA) encoding the Cas9 nicking enzyme (nCas9). In some embodiments, the therapeutic agent comprises catalytically inactive or “dead” Cas9 (dCas9), such as Streptococcus pyogenes Cas9, for example, wherein the Cas9 contains an amino acid substitution at positions D10 and H840, such as D10A and H840A, or a nucleic acid (e.g., mRNA) encoding catalytically inactive Cas9 (dCas9).

[0182] In some embodiments, the therapeutic agent comprises a deaminase, such as cytidine deaminase or adenine deaminase, or a nucleic acid (e.g., mRNA) encoding the deaminase. In some embodiments, the conjugates described herein (targeting LNPs) deliver the deaminase to target cells to generate substitution mutations in the cell's DNA (e.g., genomic DNA). In some embodiments, the therapeutic agent is a base editor, as described in the art, such as a cytidine base editor (CBE) or an adenine nucleobase editor (ABE). Examples of therapeutic agents comprising a deaminase or a nucleic acid encoding a deaminase can be found in PCT applications PCT / US2014 / 038359, PCT / US2017 / 045381, PCT / US2018 / 024208, PCT / US2018 / 056146, and PCT / US2019 / 050112, which are incorporated herein by reference in their entirety, including the sequence listing and sequences therein.

[0183] In some embodiments, the therapeutic agent can be used for epigenome editing. In some embodiments, the therapeutic agent comprises a methyltransferase and / or a demethylase, or one or more nucleic acids (e.g., one or more mRNAs) encoding a demethylase and / or a methyltransferase. In some embodiments, the therapeutic agent demethylates DNA (e.g., genomic DNA) and / or histones. In some embodiments, the therapeutic agent methylates DNA (e.g., genomic DNA) and / or histones. In some embodiments, the therapeutic agent can be used to alter gene transcription (e.g., via gene silencing or gene activation using CRISPRoff and / or CRISPRon). In some embodiments, the therapeutic agent may comprise a DNA methyltransferase domain or a nucleic acid encoding a DNA methyltransferase domain. In some embodiments, the therapeutic agent may comprise a KRAB domain, a DNMT3A domain, a DNMT3B domain, a DNMT1 domain, a DNMT3L domain, or a SETDB1 domain, or may comprise a nucleic acid encoding a KRAB domain, a DNMT3A domain, a DNMT3B domain, a DNMT1 domain, a DNMT3L domain, a SETDB1 domain, a VP64 domain, a p65 domain, a TET1 domain, a TET2 domain, or a TET3 domain. Examples of therapeutic agents comprising methyltransferases and / or demethylases or nucleic acids encoding methyltransferases and / or demethylases can be found in PCT applications PCT / IB2015 / 058202, PCT / US2021 / 035244, and PCT / US2021 / 035937, which are incorporated herein by reference in their entirety, including the sequence listing and sequences therein.

[0184] In some embodiments, the therapeutic agent can be used to alter or modify nucleic acid sequences, for example, by inserting a heterologous sequence into DNA via targeted priming reverse transcription (TPRT), thereby introducing insertions, deletions, or substitutions into DNA (e.g., genomic DNA). In some embodiments, the therapeutic agent (i.e., the payload) can be a genetically modified protein, a nucleic acid encoding a genetically modified protein, or a gene-modifying system, as described herein. In some embodiments, the therapeutic agent can be a genetically modified peptide or a nucleic acid encoding a genetically modified peptide. In some embodiments, the therapeutic agent can be a template RNA used in conjunction with a genetically modified peptide. In some embodiments, the therapeutic agent delivered by the conjugate (targeted LNP) described herein is one or more components of a gene-modifying system, such as a genetically modified peptide (or a nucleic acid encoding a genetically modified peptide) and / or a template RNA used in conjunction with a genetically modified peptide. In some embodiments, the therapeutic agent comprises or is derived from a retrotransposon or a mobile genetic element (MGE). In some embodiments, the therapeutic agent can be a heterologous genetically modified peptide or a nucleic acid encoding a heterologous genetically modified peptide, as described herein. In some embodiments, the therapeutic agent can be RNA used in conjunction with a heterologous genetically modified peptide. In some embodiments, the therapeutic agent delivered by the conjugate (targeting LNP) described herein is one or more components of a heterologous genetic modification system, such as a heterologous genetic modification peptide (or a nucleic acid encoding a heterologous genetic modification peptide) and / or RNA used in conjunction with the heterologous genetic modification peptide. In some embodiments, the therapeutic agent is a fusion protein, such as an endonuclease protein fused to a reverse transcriptase, or an endonuclease nicking enzyme fused to a reverse transcriptase. In some embodiments, the therapeutic agent is a fusion protein, such as an endonuclease protein fused to a polymerase, or an endonuclease nicking enzyme fused to a polymerase.

[0185] Other examples of therapeutic agents can be found in PCT applications PCT / US2020 / 023730, PCT / US2021 / 031439, PCT / US2020 / 055156, PCT / US2021 / 052097, PCT / US2022 / 012054, PCT / US2022 / 023175, PCT / US2022 / 074628, and PCT / US2023 / 065947, which are incorporated herein by reference in their entirety, including the sequence listings and sequences therein.

[0186] In some implementations, the mRNA component of the gene modification system contains a recombinant nuclease or a nucleic acid encoding a nuclease, such as a CRISPR-Cas nuclease (e.g., a nickase), a restriction endonuclease, a broad range of nucleases, a homing endonuclease, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN).

[0187] In some embodiments, the therapeutic agent may be a small molecule. In some embodiments, the therapeutic agent may be siRNA or miRNA.

[0188] Gene modification system

[0189] The conjugates (targeted LNPs) described herein can be formulated to include one or more components of a gene-modifying system or one or more nucleic acids encoding said components. Thus, in some embodiments, the payload includes a gene-modifying system, or one or more nucleic acids encoding components of a gene-modifying system. For example, in some embodiments, the payload includes template RNA and mRNA encoding a gene-modifying polypeptide. In some embodiments, the conjugates prepared according to this disclosure are used to deliver a system capable of inserting a heterologous target sequence (e.g., a sequence encoding a CAR) into the genome of a cell (e.g., an immune cell, such as a T cell) to a target cell. In some embodiments, the system includes: (A) a gene-modifying polypeptide or a nucleic acid encoding a gene-modifying polypeptide, wherein the gene-modifying polypeptide includes: (i) an endonuclease and / or DNA-binding domain; and (ii) a reverse transcriptase (RT) domain, wherein (i) and (ii) are both derived from a retrotransposon (e.g., from the same retrotransposon or different retrotransposons); and (B) template RNA (or DNA encoding template RNA) comprising (i) the sequence of the binding polypeptide and (ii) the heterologous target sequence. In some implementations, the genetically modified polypeptide acts as a largely autonomous protein machine capable of integrating a template nucleic acid sequence into a target DNA molecule (e.g., in mammalian host cells, such as genomic DNA molecules within the host cell), largely independent of the host machine. The heterologous target sequence may include, for example, coding sequences, regulatory sequences, or gene expression units.

[0190] In some implementations, the systems described herein may offer numerous advantages over various earlier systems. For example, this disclosure describes a reverse transcriptase transposase capable of inserting long heterologous nucleic acids into the genome. Furthermore, the reverse transcriptase transposases described herein can insert heterologous nucleic acids into endogenous sites in the genome, such as rDNA loci. This contrasts with the Cre / loxP system, which requires a first step of inserting a foreign loxP site followed by a second step of inserting the sequence of interest into the loxP site.

[0191] Gene-modified peptides

[0192] Non-long terminal repeat (LTR) retrotransposons are a class of mobile genetic elements widely distributed in eukaryotic genomes. Examples include apurinol / pyrimidine-free endonuclease (APE) types, restriction enzyme-like endonuclease (RLE) types, and Penelope-like element (PLE) types.

[0193] APE-type retrotransposons consist of two functional domains: an endonuclease / DNA-binding domain and a reverse transcriptase domain. Examples of APE-type retrotransposons can be found in Table 1 of, for example, PCT applications PCT / US2019 / 048607, US2023 / 0235358, US2023 / 0242899, and US2020 / 0109398, the disclosures of which are incorporated herein by reference in their entirety, including the sequence listings in PCT / US2019 / 048607 and US2020 / 0109398 and the sequences mentioned in Table 1.

[0194] RLEs consist of three functional domains: a DNA-binding domain, a retrotranscription domain, and a nuclease domain. Examples of RLE retrotransposons can be found in Table 2 of, for example, PCT applications PCT / US2019 / 048607, US2023 / 0235358, US2023 / 0242899, and US2020 / 0109398, the disclosures of which are incorporated herein by reference in their entirety, including the sequence listings in PCT / US2019 / 048607 and US2020 / 0109398 and the sequences mentioned in Table 2.

[0195] The reverse transcriptase domain of non-LTR retrotransposons functions by binding an RNA sequence template and reverse transcribing it into target DNA in the host genome. The RNA sequence template has a 3' untranslated region that specifically binds to the retrotransposase, and a variable 5' region that typically contains an open reading frame (“ORF”) encoding the retrotransposase protein. The RNA sequence template may also contain a 5' untranslated region that specifically binds to the retrotransposase.

[0196] Penelope-like elements (PLEs) differ from both LTR and non-LTR retrotransposons. PLEs typically contain a reverse transcriptase domain that is different from APE and RLE elements but resembles that of telomerase and group II introns, as well as an optional GIY-YIG endonuclease domain.

[0197] Other exemplary classes of retrotransposons include, but are not limited to, RTE (e.g., RTE-1_MD, RTE-3_BF, and RTE-25_LMi), CR1 (e.g., CR1-1_PH), Crack (e.g., Crack-28_RF), L2 (e.g., L2-2_Dre and L2-5_GA), and Vingi (e.g., Vingi-1_Acar) retrotransposons.

[0198] As described herein, the elements of such retrotransposons can be functionally modularized and / or modified to target, edit, modify, or manipulate target DNA sequences, for example, by inserting a target (e.g., heterologous) nucleic acid sequence into a target genome (e.g., a mammalian genome) via reverse transcription. In some embodiments, the gene modification system comprises: (A) a polypeptide or nucleic acid encoding a polypeptide, wherein the polypeptide comprises (i) a reverse transcriptase domain of a reverse transposase, and (ii) a reverse transposase endonuclease domain containing DNA-binding functionality; and (B) a template RNA (or DNA encoding the template RNA) comprising (i) a sequence that binds the polypeptide and (ii) a heterologous target sequence. The RNA template element of the gene modification system is typically heterologous to the polypeptide element and provides the target sequence to be inserted (reverse transcribed) into the host genome.

[0199] In some embodiments, the gene modification system comprises a retrotransposase sequence of any of the elements listed in Tables 10, 11, X, Z1, 3A, or 3B of PCT Publications WO / 2021 / 178717, US2023 / 0235358, and US2023 / 0242899, which are incorporated herein by reference because they involve domains derived from retrotransposons.

[0200] In some embodiments, the amino acid sequences encoded by the elements in Table 7 are the amino acid sequences encoded by the full-length sequences of the elements listed in Table 7, or sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with them. In some embodiments, the full-length sequences of the elements listed in Table 7 may comprise one or more (e.g., all) of the 5' UTR, polypeptide-coding sequence, or 3' UTR of a retrotransposon as described herein. In some embodiments, the amino acid sequences in Table 7 are the amino acid sequences encoded by the full-length sequences of the elements listed in Table 7, or sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with them. In some embodiments, the 5' UTR of the elements in Table 7 includes the 5' UTR of the full-length sequence of the elements listed in Table 7, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it. In some embodiments, the 3' UTR of the elements in Table 7 includes the 3' UTR of the full-length sequence of the elements listed in Table 7, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.

[0201] Table 7 also indicates the host organism from which the nucleic acid sequence was obtained and a list of domains present in the polypeptide encoded by the open reading frame of the nucleic acid sequence.

[0202] In some implementations, the genetically modified polypeptide further includes a heterologous protein domain.

[0203] Table 7 provides gene-modified peptides containing retrotransposon elements, which were altered to improve integration efficiency into the human genome. The retrotransposase peptides were improved through homologous mapping to re-obtain optimal amino acid sequences. Template molecules used with homologous retrotransposases were mapped back to their host genome and flanking genomic DNA to elucidate target site motifs. When detectable, conserved sequence motifs from flanking genomic DNA arising endogenously from the element align with the human genome, and new sequences are derived from the human genome as 5' or 3' "human homologous arms". In some embodiments, the template RNA described herein comprises one or both of a first homologous domain and a second homologous domain, wherein the first homologous domain comprises a sequence of the 5' human homologous arm of Table 7 (or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with it), and the second homologous domain comprises a sequence of the 3' human homologous arm of Table 7 (or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with it).

[0204] Table 7: Retrotransposase systems with enhanced integration activity

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226] Retrotransposon discovery tools

[0227] Due to repeated mobilization over time, transposable elements in genomic DNA often exist in the form of tandem or scattered repeats (Jurka et al., Opin Struct Biol 8, 333-337 (1998)). Tools capable of identifying such repeats can be used to identify novel elements in genomic DNA and to populate databases, such as Repbase (Jurka et al., Cytogenet Genome Res 110, 462-467 (2005)). One tool for identifying repetitive sequences that may contain transposable elements is RepeatFinder (Volfovsky et al., Genome Biol 2 (2001)), which analyzes the repetitive structure of genomic sequences. Other tools (e.g., Censor (Kohany et al., BMC Bioinformatics 7, 474 (2006))) can be used to further collect and analyze repetitive sequences. The Censor package takes genomic repeats and annotates them against known transposable elements using various BLAST methods. Full-frame translation can be used to generate ORFs for comparison.

[0228] Other exemplary methods for identifying transposable elements include RepeatModeler2, which can automatically discover and annotate transposable elements in genomic sequences (Flynn et al. bioRxiv (2019)). In addition to this via available packages such as Censor, a given genome or sequence can be fully translated and annotated using protein domain tools such as InterProScan, which uses the InterPro database (Mitchell et al. Nucleic Acids Res 47, D351-360 (2019)) to label domains of a given amino acid sequence, thereby identifying potential proteins containing domains associated with known transposable elements.

[0229] Retrotransposons can be further classified based on their reverse transcriptase domains using tools such as RTclass1 (Kapitonov et al. Gene 448, 207-213 (2009)).

[0230] polypeptide components of gene modification systems

[0231] RT domain

[0232] In some aspects, the reverse transcriptase domain of the gene modification system is based on the reverse transcriptase domain of APE or RLE type non-LTR retrotransposons, or on the reverse transcriptase domain of PLE type retrotransposons. The wild-type reverse transcriptase domains of APE, RLE, or PLE type retrotransposons can be used in the gene modification system, or can be modified (e.g., by inserting, deleting, or substituting one or more residues) to alter the reverse transcriptase activity against the target DNA sequence. In some embodiments, the reverse transcriptase has altered codon usage from its native sequence, for example, for modification targeting human cells. In some embodiments, the reverse transcriptase domain is a heterologous reverse transcriptase derived from different LTR retrotransposons, non-LTR retrotransposons, or other sources. In some embodiments, the gene modification system comprises a polypeptide containing the reverse transcriptase domains of RTE (e.g., RTE-1_MD, RTE-3_BF, and RTE-25_LMi), CR1 (e.g., CR1-1_PH), Crack (e.g., Crack-28_RF), L2 (e.g., L2-2_Dre and L2-5_GA), and Vingi (e.g., Vingi-1_Acar) retrotransposons.

[0233] In some embodiments, the gene modification system comprises a polypeptide containing the reverse transcriptase domain of a retrotransposon listed in Tables 10, 11, X, Z1, Z2, or 3A or 3B of PCT Publication No. WO / 2021 / 178717.

[0234] In some embodiments, the gene-modifying system comprises a polypeptide containing the reverse transcriptase domain of the retrotransposons listed in Table 7. In some embodiments, the amino acid sequence of the reverse transcriptase domain of the gene-modifying system is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the amino acid sequence of the reverse transcriptase domain of the retrotransposons referenced in Table 7. For example, the reverse transcriptase domain can be identified using conventional tools such as the Basic Local Alignment Search (BLAST) tool based on homology with other known reverse transcriptase domains. In some embodiments, the reverse transcriptase domain is modified, for example, through site-specific mutations. In some embodiments, the reverse transcriptase domain is engineered to bind heterologous template RNA.

[0235] In some embodiments, the polypeptide (e.g., an RT domain) includes an RNA-binding domain, for example, a domain that specifically binds to an RNA sequence. In some embodiments, the template RNA includes an RNA sequence that is specifically bound by the RNA-binding domain.

[0236] In some embodiments, the RT domain forms a dimer (e.g., a heterodimer or homodimer). In some embodiments, the RT domain is monomeric. In some embodiments, the RT domain naturally functions as a monomer or dimer (e.g., a heterodimer or homodimer). In some embodiments, the RT domain naturally functions as a monomer. In some embodiments, the naturally occurring heterodimeric RT domain may also function as a homodimer. In some embodiments, the dimer RT domain is expressed as a fusion protein, such as a homodimeric fusion protein or a heterodimeric fusion protein. In some embodiments, the RT function of the system is achieved by multiple RT domains (e.g., as described herein). In further embodiments, the multiple RT domains are fused or separate, for example, they may be on the same polypeptide or on different polypeptides.

[0237] In some embodiments, the genetically modified polypeptide described herein comprises an RNase H domain, for example, wherein the RNase H domain may be part of an RT domain. In some embodiments, the RT domain (e.g., as described herein) comprises an RNase H domain, such as an endogenous RNase H domain or a heterologous RNase H domain. In some embodiments, the RT domain (e.g., as described herein) lacks an RNase H domain. In some embodiments, the RT domain (e.g., as described herein) comprises an RNase H domain that has been added, deleted, mutated, or exchanged for a heterologous RNase H domain. In some embodiments, mutations in the RNase H domain produce polypeptides exhibiting lower RNase activity, for example, as determined by the method described in Kotewicz et al. Nucleic Acids Res 16(1):265-277 (1988), for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% lower than other similar domains without mutations. In some implementations, RNase H activity is eliminated.

[0238] In some embodiments, the RT domain is mutated, thereby increasing fidelity compared to other similar domains without the mutation. For example, in some embodiments, the YADD (SEQ ID NO: 69) or YMDD (SEQ ID NO: 70) motif in the RT domain (e.g., in reverse transcriptase) is replaced by YVDD. In embodiments, the replacement of YADD (SEQ ID NO: 69), YMDD (SEQ ID NO: 70), or YVDD (SEQ ID NO: 71) results in higher fidelity of retroviral reverse transcriptase activity (e.g., as described in Jamburuthugoda and Eickbush J Mol Biol 2011).

[0239] Nucleotide endonuclease domain:

[0240] In some embodiments, the polypeptide comprises a restriction endonuclease domain (e.g., a heterologous restriction endonuclease domain). In some embodiments, the restriction endonuclease / DNA binding domain of an APE-type retrotransposon, the restriction endonuclease domain of an RLE-type retrotransposon, or the restriction endonuclease domain of a PLE-type retrotransposon may be used or modified (e.g., by insertion, deletion, or substitution of one or more residues) in the gene modification system described herein. In some embodiments, the restriction endonuclease domain or the restriction endonuclease / DNA binding domain is altered from its native sequence to have altered codons, for example, for modification targeting human cells. In some embodiments, the restriction endonuclease element is a heterologous restriction endonuclease element. The amino acid sequence of the endonuclease domain of the gene modification system described herein may be at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the amino acid sequence of the endonuclease domain of the retrotransposon cited in Tables X, Z1, Z2, 3A, or 3B of PCT Publication No.: WO / 2021 / 178717.

[0241] In some embodiments, the gene-modifying system comprises a polypeptide containing the endonuclease domains of the retrotransposons listed in Table 7. In some embodiments, the amino acid sequence of the endonuclease domain of the gene-modifying system is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identical to the amino acid sequence of the endonuclease domain of the retrotransposons referenced in Table 7. For example, tools such as the Basic Local Alignment Search (BLAST) tool can be used to identify the endonuclease domain based on homology with other known endonuclease domains.

[0242] In some embodiments, the gene-modified polypeptide has the function of cleaving a DNA target site via a nuclease domain. In some embodiments, the nuclease domain is also a DNA-binding domain. In some embodiments, the nuclease domain is also a template nucleic acid (e.g., template RNA)-binding domain. In some embodiments, the nuclease / DNA-binding domain of an APE-type retrotransposon or the nuclease domain of an RLE-type retrotransposon can be used or modified (e.g., by insertion, deletion, or substitution of one or more residues) in the gene modification system described herein.

[0243] Template nucleic acid binding domain:

[0244] Genetically modified peptides typically contain a region capable of associating with a template nucleic acid (e.g., template RNA). In some embodiments, the template nucleic acid binding domain is an RNA-binding domain. In some embodiments, the RNA-binding domain is a modular domain that can associate with RNA molecules containing specific features, such as structural motifs, or secondary structures present in the 3'UTR of non-LTR retrotransposons. In other embodiments, the template nucleic acid binding domain (e.g., the RNA-binding domain) is contained within a retrotranscriptional domain, for example, the reverse transcriptase-derived component having known RNA-preferred features, such as secondary structures present in the 3'UTR of non-LTR retrotransposons.

[0245] DNA-binding domain:

[0246] In some embodiments, the DNA-binding domains of the genetically modified peptides described herein are selected, designed, or constructed for binding to desired host DNA target sequences. In some embodiments, the DNA-binding domain of the engineered retrotransposon is a heterologous DNA-binding protein or domain relative to the natural retrotransposon sequence. In some embodiments, the heterologous DNA-binding domain is the DNA-binding domain of the retrotransposon described in Table 7 herein or in Tables X, Z1, Z2, or 3A or 3B of PCT Publication No. WO / 2021 / 178717. In some embodiments, tools such as the Basic Local Alignment Search (BLAST) tool can be used to identify the DNA-binding domain based on homology with other known DNA-binding domains. In other embodiments, the DNA-binding domain is modified, for example, through site-specific mutations. In some embodiments, the DNA-binding domain has altered codon usage from its natural sequence, for example, modified for human cells.

[0247] In the implementation, the DNA-binding domain includes one or more modifications relative to the wild-type DNA-binding domain, such as modifications via directed evolution (e.g., phage-assisted continuous evolution (PACE)).

[0248] In some aspects of the invention, the host DNA binding site integrated into the gene modification system may be located within a gene, an intron, an exon, an ORF, outside the coding region of any gene, within the regulatory region of a gene, or outside the regulatory region of a gene. In other aspects, the engineered retrotransposon may bind to one or more host DNA sequences. In still other aspects, the engineered retrotransposon may have low sequence specificity, such as binding to multiple sequences or lacking sequence preference.

[0249] In some embodiments, the gene-modifying system is used to edit target loci in multiple alleles. In some embodiments, the gene-modifying system is designed to edit specific alleles. For example, the gene-modifying peptide may target a specific sequence present only in one allele, such as template RNA containing a template RNA (e.g., an annealing domain) that is homologous to the target allele, but not to a second homologous allele. In some embodiments, the gene-modifying system may alter haplotype-specific alleles. In some embodiments, the gene-modifying system targeting a specific allele preferentially targets that allele, for example, showing a preference of at least 2, 4, 6, 8, or 10-fold for the target allele.

[0250] Location sequences of gene modification systems

[0251] In some implementations, the gene-modified system RNA further includes intracellular localization sequences, such as nuclear localization sequences.

[0252] The nuclear localization sequence can be an RNA sequence that facilitates RNA entry into the cell nucleus. In some embodiments, the nuclear localization signal is located on the template RNA. In some embodiments, a reverse transposase polypeptide is encoded on a first RNA, and the template RNA is a second separate RNA, and the nuclear localization signal is located on the template RNA rather than on the RNA encoding the reverse transposase polypeptide. While not wishing to be bound by theory, in some embodiments, the RNA encoding the reverse transposase primarily targets the cytoplasm to facilitate its translation, while the template RNA primarily targets the cell nucleus to facilitate its reverse transposition into the genome. In some embodiments, the nuclear localization signal is located at the 3' end, 5' end, or an internal region of the template RNA. In some embodiments, the nuclear localization signal is located at the 3' end of a heterologous sequence (e.g., directly at the 3' end of the heterologous sequence) or at the 5' end of a heterologous sequence (e.g., directly at the 5' end of the heterologous sequence). In some embodiments, the nuclear localization signal is located outside the 5' UTR or outside the 3' UTR of the template RNA. In some embodiments, the nuclear localization signal is located between the 5' UTR and the 3' UTR, wherein optionally the nuclear localization signal is not transcribed with the transgene (e.g., the nuclear localization signal is in the antisense direction or is located downstream of a transcription termination signal or a polyadenylation signal). In some embodiments, the nuclear localization sequence is located inside an intron. In some embodiments, multiple identical or different nuclear localization signals are located in the RNA, for example, in the template RNA. In some embodiments, the length of the nuclear localization signal is less than 5, 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 bp. Various RNA nuclear localization sequences can be used. For example, Lubelsky and Ulitsky, Nature 555 (107-111), 2018, describe RNA sequences that drive RNA localization to the cell nucleus. In some embodiments, the nuclear localization signal is a SINE-derived nuclear RNA localization (SIRLOIN) signal. In some embodiments, the nuclear localization signal binds to nuclear-enriched proteins. In some embodiments, the nuclear localization signal binds to HNRNPK proteins. In some embodiments, the nuclear localization signal is pyrimidine-rich, such as a C / T-rich, C / U-rich, C-rich, T-rich, or U-rich region. In some embodiments, the nuclear localization signal originates from long non-coding RNA. In some embodiments, the nuclear localization signal originates from MALAT1 long non-coding RNA or the 600-nucleotide M region of MALAT1 (described in Miyagaawa et al., RNA 18, (738-751), 2012).In some embodiments, the nuclear localization signal is derived from BORG long non-coding RNA or the AGCCC motif (described in Zhang et al., Molecular and Cellular Biology 34, 2318-2329 (2014)). In some embodiments, the nuclear localization sequence is described in Shukla et al., The EMBO Journal e98452 (2018). In some embodiments, the nuclear localization signal is derived from a non-LTR retrotransposon, an LTR retrotransposon, a retrovirus, or an endogenous retrovirus.

[0253] In some embodiments, the polypeptide described herein comprises one or more (e.g., 2, 3, 4, 5) nuclear targeting sequences, such as nuclear localization sequences (NLS), as described herein. In some embodiments, the NLS is a bipartite NLS. In some embodiments, the NLS facilitates the entry of the protein containing the NLS into the cell nucleus. In some embodiments, the NLS is fused to the N-terminus of the genetically modified polypeptide described herein. In some embodiments, the NLS is fused to the C-terminus of the genetically modified polypeptide. In some embodiments, a linker sequence is disposed between the NLS and a neighboring domain of the genetically modified polypeptide. In some embodiments, the NLS comprises the amino acid sequence of the NLS described herein.

[0254] In some embodiments, the nucleic acid described herein (e.g., RNA encoding a gene-modifying polypeptide or DNA encoding RNA) contains a microRNA binding site. In some embodiments, the microRNA binding site is used to increase the target cell specificity of the gene-modifying system. For example, the microRNA binding site can be selected based on the following: the site is recognized by miRNAs present in non-target cell types but absent in target cell types (or present at a lower level relative to non-target cells). Therefore, when RNA encoding a gene-modifying polypeptide is present in non-target cells, it will be bound by the miRNA, and when RNA encoding a gene-modifying polypeptide is present in target cells, it will not be bound by the miRNA (or will be bound but at a lower level relative to non-target cells). While not wishing to be bound by theory, the binding of miRNA to RNA encoding a gene-modifying polypeptide may reduce the production of the gene-modifying polypeptide, for example, by degrading the mRNA encoding the polypeptide or by interfering with translation. Therefore, the efficiency of inserting a heterologous target sequence into the genome of a target cell is higher than that into the genome of a non-target cell. Systems with microRNA binding sites in RNA encoding gene-modifying polypeptides (or in DNA encoding RNA) can also be used in combination with template RNA regulated by a second microRNA binding site.

[0255] In some embodiments, the peptide used in any of the systems described herein can be a molecular reconstruction or ancestral reconstruction based on aligned peptide sequences of multiple retrotransposons. In some embodiments, the 5' or 3' untranslated region used in any of the systems described herein can be a molecular reconstruction of the 5' or 3' untranslated region based on aligned 5' or 3' untranslated regions of multiple retrotransposons. Based on accession numbers, peptide or nucleic acid sequences can be aligned, for example, using conventional sequence analysis tools such as the Basic Local Alignment Search (BLAST) tool or CD-Search for conserved domain analysis. Molecular reconstructions can be created based on sequence consensus, for example using the methods described in Ivics et al., Cell 1997, 501–510; Wagstaff et al., Molecular Biology and Evolution 2013, 88–99. In some embodiments, the 5' or 3' untranslated region or the retrotransposon derived from the peptide is a young or recently active mobile element, as assessed via phylogenetic methods, such as those described in Boissinot et al., Molecular Biology and Evolution 2000, 915–928.

[0256] Intended peptides

[0257] In some embodiments, the gene modification system includes an integrin. Typically, an integrin comprises a polypeptide capable of joining two polypeptides or polypeptide fragments via peptide bonds. In some embodiments, the integrin is a trans-splicing integrin capable of joining two polypeptide fragments, for example, to form a polypeptide component of a system as described herein. Promoter

[0258] In some embodiments, one or more promoter or enhancer elements are operatively linked to a nucleic acid or template nucleic acid encoding a gene-modified protein, for example, controlling the expression of a heterologous target sequence. In some embodiments, one or more promoter or enhancer elements include cell type or tissue-specific elements. In some embodiments, the promoter or enhancer is identical to or derived from a naturally occurring promoter or enhancer that controls the expression of a heterologous target sequence.

[0259] In some embodiments, the gene modification system is capable of producing substitutions of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more nucleotides at the target site. In some embodiments, the substitution is a transition mutation. In some embodiments, the substitution converts adenine to thymine, adenine to guanine, adenine to cytosine, guanine to thymine, guanine to cytosine, guanine to adenine, thymine to cytosine, thymine to adenine, thymine to guanine, cytosine to adenine, cytosine to guanine, or cytosine to thymine.

[0260] In some embodiments, the gene-modifying system is capable of inserting at least 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides (and optionally not exceeding 500, 400, 300, 200, or 100 nucleotides) at the target site. In some embodiments, the gene-modifying system is capable of inserting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides (and optionally not exceeding 500, 400, 300, 200, or 100 nucleotides) at the target site. In some embodiments, the gene-modifying system is capable of inserting at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases (and optionally not exceeding 1, 5, 10, or 20 kilobases) at the target site. In some embodiments, the gene-modifying system is capable of producing deletions of at least 81, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally not exceeding 500, 400, 300, or 200 nucleotides). In some embodiments, the gene-editing system is capable of producing deletions of at least 81, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally not exceeding 500, 400, 300, or 200 nucleotides). In some embodiments, the gene-editing system is capable of producing deletions of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally not exceeding 500, 400, 300, or 200 nucleotides). In some implementations, the gene-modification system is capable of producing deletions of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases (and optionally not exceeding 1, 5, 10, or 20 kilobases).

[0261] In some embodiments, insertions, deletions, substitutions, or combinations thereof increase or decrease gene expression (e.g., transcription or translation). In some embodiments, insertions, deletions, substitutions, or combinations thereof increase or decrease gene expression (e.g., transcription or translation) by altering, adding, or deleting sequences in promoters or enhancers (e.g., sequences that bind transcription factors). In some embodiments, insertions, deletions, substitutions, or combinations thereof alter gene translation (e.g., altering amino acid sequences), inserting or deleting start or stop codons, altering or fixing the translational framework of a gene. In some embodiments, insertions, deletions, substitutions, or combinations thereof alter gene splicing, for example by inserting, deleting, or altering splice acceptor or donor sites. In some embodiments, insertions, deletions, substitutions, or combinations thereof alter the half-life of transcripts or proteins. In some embodiments, insertions, deletions, substitutions, or combinations thereof alter protein localization in the cell (e.g., from the cytoplasm to the mitochondria, from the cytoplasm to the extracellular space (e.g., adding secretion tags)). In some embodiments, insertions, deletions, substitutions, or combinations thereof alter (e.g., improve) protein folding (e.g., prevent the accumulation of misfolded proteins). In some implementations, insertion, deletion, substitution, or a combination thereof alters, increases, or decreases the activity of a gene (e.g., the protein encoded by that gene).

[0262] In some embodiments, the system or method described herein results in a “scarless” insertion of a heterologous target sequence, while in other embodiments, the target site may exhibit deletions or duplications of endogenous DNA due to the insertion of the heterologous sequence. The mechanisms of different retrotransposons may result in different patterns of duplication or deletion in the host genome during retrotransposition at the target site. In some embodiments, the system results in a scarless insertion, and there are no duplications or deletions in the surrounding genomic DNA. In some embodiments, the system results in a deletion of less than 1, 2, 3, 4, 5, 10, 50, or 100 bp of genomic DNA upstream of the insertion. In some embodiments, the system results in a deletion of less than 1, 2, 3, 4, 5, 10, 50, or 100 bp of genomic DNA downstream of the insertion. In some embodiments, the system results in a duplication of less than 1, 2, 3, 4, 5, 10, 50, or 100 bp of genomic DNA upstream of the insertion. In some embodiments, the system results in a duplication of less than 1, 2, 3, 4, 5, 10, 50, or 100 bp of genomic DNA downstream of the insertion.

[0263] In some embodiments, the gene-modifying system described herein, or its DNA-binding domain, specifically binds to its target site, for example, as measured using the assay of Example 21 of PCT application number PCT / US2019 / 048607. In some embodiments, the binding of the gene-modifying peptide or its DNA-binding domain to its target site is stronger than its binding to any other binding site in the human genome. For example, in some embodiments, in the assay of Example 21 of PCT application number PCT / US2019 / 048607, the target site represents more than 50%, 60%, 70%, 80%, 90%, or 95% of the binding events of the gene-modifying peptide or its DNA-binding domain to human genomic DNA. In some embodiments, the DNA-binding domain of the gene-modifying peptide is heterologous to the rest of the gene-modifying peptide, for example, such that the gene-modifying peptide targets a target site different from the endogenous DNA-binding domain associated with the rest of the gene-modifying peptide.

[0264] Genetic engineering, such as dimerized gene-modified peptides

[0265] Some non-LTR retrotransposons utilize two subunits to complete retrotransposition (Christensen et al., PNAS 2006). In some embodiments, the retrotransposases described herein comprise two linked subunits as a single polypeptide. For example, two wild-type retrotransposases can form a covalently “dimeric” protein by linker coupling. In some embodiments, the nucleic acid encoding the retrotransposase encodes two retrotransposase subunits to be expressed as a single polypeptide. In some embodiments, the subunits are linked by a peptide linker. Depending on the mechanism, not all functions require two retrotransposase subunits. In some embodiments, the fusion protein may consist of a fully functional subunit and a second subunit lacking one or more functional domains. In some embodiments, one subunit may lack retrotranscriptase function. In some embodiments, one subunit may lack a retrotranscriptase domain. In some embodiments, one subunit may only have endonuclease activity. In some embodiments, one subunit may only have an endonuclease domain. In some embodiments, the two subunits constituting a single polypeptide can provide complementary functions.

[0266] In some embodiments, a subunit may lack endonuclease function. In some embodiments, a subunit may lack an endonuclease domain. In some embodiments, a subunit may possess only reverse transcriptase activity. In some embodiments, a subunit may possess only a reverse transcriptase domain. In some embodiments, a subunit may possess only DNA-dependent DNA synthesis function.

[0267] Evolved variants of gene modification polypeptides

[0268] In some embodiments, the present invention provides evolutionary variants of genetically modified polypeptides. Evolutionary variants are described, for example, on pages 1179-1182 of PCT application WO / 2021 / 178720.

[0269] Template RNA components of gene modification systems

[0270] The gene modification system described herein can transcribe an RNA sequence template into a host target DNA site via targeted reverse transcription. By directly writing the DNA sequence into the host genome through reverse transcription of the RNA sequence template, the gene modification system can insert the target sequence into the target genome without introducing the foreign DNA sequence into the host cell (unlike systems such as CRISPR), and can also eliminate the foreign DNA insertion step. Therefore, this gene modification system provides a platform for using custom RNA sequence templates containing the target sequence (e.g., sequences containing foreign gene coding and / or functional information).

[0271] In some embodiments, the template RNA cis-encodes a genetically modified protein with the heterologous target sequence. Various cis-constructs are described, for example, in Kuroki-Kami et al. (2019) Mobile DNA 10:23 (incorporated herein by reference in its entirety) and can be used in combination with any of the embodiments described herein. For example, in some embodiments, the template RNA comprises a heterologous target sequence, a sequence encoding a genetically modified protein (e.g., a protein comprising (i) a reverse transcriptase domain and (ii) a nuclease domain, e.g., as described herein), a 5' untranslated region, and a 3' untranslated region. These components may be included in various orders. In some embodiments, the genetically modified protein and the heterologous target sequence are encoded in different orientations (sense and antisense), e.g., using Kuroki-Kami et al., Id. Figure 3 The arrangement shown in A. In some embodiments, the genetically modified protein and the heterologous target sequence encode in the same orientation. In some embodiments, the nucleic acid encoding the polypeptide and the template RNA, or the nucleic acid encoding the template RNA, are covalently linked, for example, as part of a fusion nucleic acid, and / or as part of the same transcript. In some embodiments, the fusion nucleic acid comprises RNA or DNA.

[0272] In some cases, the nucleic acid encoding the gene-modifying polypeptide can be the 5' of a heterologous target sequence. For example, in some embodiments, the template RNA from 5' to 3' comprises a 5' untranslated region, a sense-coded gene-modifying polypeptide, a sense-coded heterologous target sequence, and a 3' untranslated region. In some embodiments, the template RNA from 5' to 3' comprises a 5' untranslated region, a sense-coded gene-modifying polypeptide, an antisense-coded heterologous target sequence, and a 3' untranslated region.

[0273] It should be understood that when the template RNA is described as containing an open reading frame or its reverse complementary sequence, in some implementations, the template RNA must first be converted into double-stranded DNA (e.g., by reverse transcription) before the open reading frame can be transcribed and translated.

[0274] In some implementations, custom RNA sequence templates can be identified, designed, engineered, and constructed to contain sequences that alter or specify the function of the host genome, such as by introducing heterologous coding regions into the genome; affecting or inducing exon structure / alternative splicing; inducing disruption of endogenous genes; inducing transcriptional activation of endogenous genes; inducing epigenetic regulation of endogenous DNA; or inducing upregulation or downregulation of operablely similar genes. In some implementations, custom RNA sequence templates can be engineered to contain sequences encoding exons and / or transgenes, providing binding sites for transcription factor activators, repressors, enhancers, and combinations thereof. In other implementations, the coding sequence can be further customized using splice acceptor sites, poly-A tails, etc. In some implementations, the RNA sequence may contain a sequence encoding an RNA sequence template homologous to a reverse transcription transposase, be engineered to contain a heterologous coding sequence, or a combination thereof.

[0275] The template RNA may share some homology with the target DNA. In some embodiments, the template RNA and the target DNA at the 3' end of the RNA have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175, 200 or more precisely homologous bases. In some embodiments, the template RNA has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 175, 180, or 200 or more bases homologous to the target DNA (e.g., at the 5' end of the template RNA). In some embodiments, the template RNA has a 3' untranslated region derived from a retrotransposon (e.g., the retrotransposon described herein). In some embodiments, the template RNA has a 3' region of at least 10, 15, 20, 25, 30, 40, 50, 60, 80, 100, 120, 140, 160, 180, 200 or more bases, which has at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to the 3' sequence of a retrotransposon (e.g., the retrotransposon described herein, such as the retrotransposons in Table 7). In some embodiments, the template RNA has a 5' untranslated region derived from a retrotransposon (e.g., the retrotransposon described herein). In some embodiments, the template RNA has a 5' region of at least 10, 15, 20, 25, 30, 40, 50, 60, 80, 100, 120, 140, 160, 180, or 200 or more bases that has at least 40%, 50%, 60%, 70%, 80%, 90%, 95% or higher homology to the 5' sequence of a retrotransposon (e.g., the retrotransposon described herein, such as the retrotransposon described in Table 7).

[0276] The template RNA component of the gene modification system described herein is typically capable of binding the gene-modifying protein of the system. In some embodiments, the template RNA has a 3' region capable of binding the gene-modifying genome editing protein. The binding region (e.g., the 3' region) can be a structured RNA region, such as having at least one, two, or three hairpin loops, capable of binding the gene-modifying protein of the system.

[0277] The template RNA component of the gene-modification system described herein is typically capable of binding the gene-modification protein of the system. In some embodiments, the template RNA has a 5' region capable of binding the gene-modification protein. The binding region (e.g., the 5' region) can be a structured RNA region, such as having at least one, two, or three hairpin loops capable of binding the gene-modification protein of the system. In some embodiments, the 5' untranslated region contains a pseudoknot, such as a pseudoknot capable of binding the gene-modification protein.

[0278] In some embodiments, the template RNA (e.g., the untranslated region of hairpin RNA, e.g., the 5' untranslated region) contains a stem-loop sequence. In some embodiments, the template RNA (e.g., the untranslated region of hairpin RNA, e.g., the 5' untranslated region) contains a hairpin. In some embodiments, the template RNA (e.g., the untranslated region of hairpin RNA, e.g., the 5' untranslated region) contains a helix. In some embodiments, the template RNA (e.g., the untranslated region of hairpin RNA, e.g., the 5' untranslated region) contains a pseudoknot. In some embodiments, the template RNA contains a ribozyme. In some embodiments, the ribozyme is similar to a hepatitis D virus (HDV) ribozyme, for example, having a secondary structure similar to that of an HDV ribozyme and / or having one or more activities of an HDV ribozyme, such as self-cleavage activity. See, for example, Eickbush et al., Molecular and Cellular Biology, 2010, 3142-3150.

[0279] In some implementations, the template RNA (e.g., the untranslated region of a hairpin RNA, such as the 3' untranslated region) contains one or more stem loops or helices. Exemplary structures of the R2 3'UTR are found, for example, in Ruschak et al., “Secondary structure models of the 3' untranslated regions of diverse R2 RNAs”, RNA. 2004, Jun; 10(6):978–987. Figure 3 In, and in Eikbush and Eikbush, “R2 and R2 / R1 hybrid non-autonomous retrotransposons derived by internal deletions of full-length elements” Mobile DNA (2012) 3:10; for example, in which Figure 3 As shown in the document, these articles are hereby included in their entirety by way of citation.

[0280] In some embodiments, the template RNA described herein comprises a sequence capable of binding to the genetically modified protein described herein. For example, in some embodiments, the template RNA comprises an MS2 RNA sequence capable of binding to the MS2 coat protein sequence in the genetically modified protein. In some embodiments, the template RNA comprises an RNA sequence capable of binding to a B-box sequence. In some embodiments, in addition to or instead of the UTR, the template RNA is also ligated (e.g., covalently) to a non-RNA UTR, such as a protein or small molecule.

[0281] In some embodiments, the template RNA has a poly-A tail at the 3' end. In some embodiments, the template RNA does not have a poly-A tail at the 3' end.

[0282] In some embodiments, the template RNA has a 5' region of at least 10, 15, 20, 25, 30, 40, 50, 60, 80, 100, 120, 140, 160, 180, 200 or more bases, which has at least 40%, 50%, 60%, 70%, 80%, 90%, 95% or higher homology to the 5' sequence of a retrotransposon (such as the retrotransposon described herein).

[0283] The system's template RNA typically contains a target sequence for insertion into the target DNA. The target sequence can be coding or non-coding.

[0284] In some embodiments, the system or method described herein includes a single template RNA. In some embodiments, the system or method described herein includes multiple template RNAs.

[0285] In some embodiments, the target sequence may contain an open reading frame. In some embodiments, the template RNA has a Kozak sequence. In some embodiments, the template RNA has an internal ribosome entry site. In some embodiments, the template RNA has a self-cleaving peptide, such as a T2A or P2A site. In some embodiments, the template RNA has a start codon. In some embodiments, the template RNA has a splice acceptor site. In some embodiments, the template RNA has a splice donor site. Exemplary splice acceptors and splice donor sites are described in US10435677, which is incorporated herein by reference in its entirety. Exemplary splice acceptor site sequences are known to those skilled in the art and include, by way of example only, CTGACCCTTCTCTCTCTCCCCCAGAG (SEQ ID NO:72) (from the human HBB gene) and TTTCTCTCCCACAAG (SEQ ID NO:73) (from the human immunoglobulin-γ gene). In some embodiments, the template RNA has a microRNA binding site located downstream of a stop codon. In some embodiments, the template RNA has a polyA tail downstream of a stop codon in the open reading frame. In some embodiments, the template RNA contains one or more exons. In some embodiments, the template RNA contains one or more introns. In some embodiments, the template RNA contains a eukaryotic transcription terminator. In some embodiments, the template RNA contains an enhancing translation element or a translation-enhancing element. In some embodiments, the RNA contains the human T-cell leukemia virus (HTLV-1) R region. In some embodiments, the RNA contains a post-transcriptional regulatory element that enhances nuclear export, such as a post-transcriptional regulatory element of hepatitis B virus (HPRE) or marmot hepatitis virus (WPRE). In some embodiments, in the template RNA, the heterologous target sequence encodes a polypeptide and encodes it in an antisense orientation relative to the 5' and 3' UTRs. In some embodiments, in the template RNA, the heterologous target sequence encodes a polypeptide and encodes it in a sense orientation relative to the 5' and 3' UTRs.

[0286] In some embodiments, the nucleic acid described herein (e.g., template RNA or DNA encoding the template RNA) contains a microRNA binding site. In some embodiments, the microRNA binding site is used to increase the target cell specificity of the gene modification system. For example, the microRNA binding site can be selected based on the following: the site is recognized by miRNAs present in non-target cell types but not in target cell types (or its presence is at a low level relative to non-target cells). Therefore, when the template RNA is present in non-target cells, it is bound by the miRNA, and when the template RNA is present in target cells, it is not bound by the miRNA (or it is bound but at a reduced level relative to non-target cells). While not wishing to be bound by theory, the binding of miRNA to the template RNA may interfere with the insertion of heterologous target sequences into the genome. Therefore, the insertion of heterologous target sequences into the genome of target cells is more efficient than into the genome of non-target cells. Systems with microRNA binding sites in the template RNA (or the DNA encoding it) can also be used in combination with nucleic acids encoding gene-modifying polypeptides, wherein the expression of the gene-modifying polypeptide is regulated by a second microRNA binding site, such as as described herein, for example in the section entitled “Polypeptide Components of Gene Modification Systems”.

[0287] In some embodiments, the target sequence may contain non-coding sequences. For example, the template RNA may contain promoter or enhancer sequences. In some embodiments, the template RNA contains tissue-specific promoters or enhancers, each promoter being unidirectional or bidirectional. In some embodiments, the promoter is an RNA polymerase I promoter, an RNA polymerase II promoter, or an RNA polymerase III promoter. In some embodiments, the promoter contains a TATA element. In some embodiments, the promoter contains a B recognition element. In some embodiments, the promoter has one or more transcription factor binding sites. In some embodiments, the non-coding sequence is transcribed in the antisense direction relative to the 5' and 3' UTRs. In some embodiments, the non-coding sequence is transcribed in the sense direction relative to the 5' and 3' UTRs.

[0288] In some embodiments, the nucleic acid described herein (e.g., template RNA or DNA encoding template RNA) contains a promoter sequence, such as a tissue-specific promoter sequence. In some embodiments, the tissue-specific promoter is used to increase the target cell specificity of the gene-modifying system. For example, the promoter can be selected based on whether it is active in target cell types but inactive (or has a low level of activity) in non-target cell types. Thus, even if the promoter integrates into the genome of a non-target cell, it will not drive the expression of the integrated gene (or will only drive low-level expression). Systems with tissue-specific promoter sequences in template RNA can also be used in combination with microRNA binding sites, such as in the template RNA or nucleic acid encoding a gene-modifying protein, as described herein. Systems with tissue-specific promoter sequences in template RNA can also be used in combination with DNA encoding a gene-modifying polypeptide, driven by a tissue-specific promoter, for example, to achieve higher levels of the gene-modifying protein in target cells than in non-target cells.

[0289] In some embodiments, the heterologous target sequence contained in the template RNA (or DNA encoding the template RNA) is operatively linked to at least one regulatory sequence. In some embodiments, the heterologous target sequence is operatively linked to a tissue-specific promoter such that the expression of the heterologous target sequence (e.g., a therapeutic protein) is upregulated in target cells, as described above. In some embodiments, the heterologous target sequence is operatively linked to a miRNA binding site such that the expression of the heterologous target sequence (e.g., a therapeutic protein) is downregulated in cells (e.g., non-target cells) with higher levels of the corresponding miRNA, as described above.

[0290] In some implementations, the template RNA includes microRNA sequences, siRNA sequences, guide RNA sequences, and piwiRNA sequences.

[0291] In some embodiments, the template RNA contains a non-coding heterologous target sequence, such as a regulatory sequence. In some embodiments, the integration of the heterologous target sequence thus alters the expression of the endogenous gene. In some embodiments, the integration of the heterologous target sequence upregulates the expression of the endogenous gene. In some embodiments, the integration of the heterologous target sequence downregulates the expression of the endogenous gene.

[0292] In some embodiments, the template RNA contains sites that coordinate epigenetic modifications. In some embodiments, the template RNA contains elements that repress (e.g., prevent) epigenetic silencing. In some embodiments, the template RNA contains chromatin insulators. For example, the template RNA contains CTCF sites or sites targeting DNA methylation.

[0293] To promote higher or more stable gene expression, the template RNA may contain features that prevent or inhibit gene silencing. In some embodiments, these features prevent or inhibit DNA methylation. In some embodiments, these features promote DNA demethylation. In some embodiments, these features prevent or inhibit histone deacetylation. In some embodiments, these features prevent or inhibit histone methylation. In some embodiments, these features promote histone acetylation. In some embodiments, these features promote histone demethylation. In some embodiments, multiple features may be incorporated into the template RNA to promote one or more of these modifications. CpG dinucleotides are readily methylated by host methyltransferases. In some embodiments, the template RNA is depleted of CpG dinucleotides, for example, it does not contain CpG dinucleotides or contains a reduced number of CpG dinucleotides compared to the corresponding unaltered sequence. In some embodiments, the promoter driving the expression of the integrated DNA transgene is lacking in CpG dinucleotides.

[0294] In some implementations, the template RNA comprises a gene expression unit consisting of at least one regulatory region operatively linked to an effector sequence. The effector sequence may be a sequence transcribed into RNA (e.g., a coding sequence or a non-coding sequence, such as a sequence encoding microRNA).

[0295] In some embodiments, the target sequence of the template RNA is inserted into the target genome within an endogenous intron. In some embodiments, the target sequence of the template RNA is inserted into the target genome and thus serves as a novel exon. In some embodiments, inserting the target sequence into the target genome results in the substitution of a natural exon or the skipping of a natural exon.

[0296] In some embodiments, the target sequence of the template RNA is inserted into a genomic safe harbor site of the target genome, such as AAVS1, CCR5, or ROSA26. In some embodiments, the target sequence of the template RNA is inserted into an albumin locus. In some embodiments, the target sequence of the template RNA is inserted into a TRAC locus. In some embodiments, the target sequence of the template RNA is added to an intergenic or intragenic region of the genome. In some embodiments, the target sequence of the template RNA is added to the 5' or 3' region of the genome, within 0.1 kb, 0.25 kb, 0.5 kb, 0.75 kb, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 7.5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 50, 75 kb, or 100 kb of the endogenous active gene. In some embodiments, the target sequence of the template RNA is added to the 5' or 3' end of the genome, within 0.1 kb, 0.25 kb, 0.5 kb, 0.75 kb, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 7.5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 50, 75 kb, or 100 kb of the endogenous promoter or enhancer. In some embodiments, the target sequence of the template RNA can be, for example, 50-50,000 base pairs (e.g., between 50-40,000 bp, 500-30,000 bp, 500-20,000 bp, 100-15,000 bp, 500-10,000 bp, 50-5,000 bp). In some implementations, the length of the heterologous target sequence is less than 1,000, 1,300, 1,500, 2,000, 3,000, 4,000, 5,000, or 7,500 nucleotides.

[0297] The template nucleic acid (e.g., template RNA) component of the gene-modification system described herein is typically capable of binding the gene-modification protein of the system. In some embodiments, the template nucleic acid (e.g., template RNA) has a 3' region capable of binding the gene-modification protein. The binding region (e.g., the 3' region) can be a structured RNA region, such as having at least one, two, or three hairpin loops, capable of binding the gene-modification protein of the system. The binding region can associate the template nucleic acid (e.g., template RNA) with any polypeptide module. In some embodiments, the binding region of the template nucleic acid (e.g., template RNA) can associate with an RNA-binding domain in the polypeptide. In some embodiments, the binding region of the template nucleic acid (e.g., template RNA) can associate with a retrotranscriptional domain of the polypeptide (e.g., specifically binding an RT domain). For example, when the retrotranscriptional domain is derived from a non-LTR retrotransposon, the template nucleic acid (e.g., template RNA) may contain a binding region derived from a non-LTR retrotransposon, such as a 3'UTR from a non-LTR retrotransposon. In some embodiments, the system or method described herein comprises a single template nucleic acid (e.g., template RNA). In some embodiments, the systems or methods described herein include multiple template nucleic acids (e.g., template RNA). In some embodiments, when the system contains multiple nucleic acids, each nucleic acid contains a conjugation domain. In some embodiments, the conjugation domain enables nucleic acid molecules to associate, for example, through hybridization of complementary sequences.

[0298] In some embodiments, the template nucleic acid may contain one or more UTRs (e.g., a 5' UTR or a 3' UTR, such as those from an R2 type retrotransposon). In some embodiments, the UTR facilitates the interaction between the template and the reverse transcriptase domain of the polypeptide. In some embodiments, the template has one or more sequences that facilitate association between the template and the genetically modified polypeptide. In some embodiments, these sequences may be derived from a retrotransposon UTR. In some embodiments, the UTR may be located flanking the desired insert sequence. In some embodiments, a sequence with target site homology may be located outside one or both UTRs. In some embodiments, a sequence with target site homology may anneal to the target sequence to initiate reverse transcription. In some embodiments, the 5' and / or 3' UTR may be located at the end of the target site homologous sequence. In some embodiments, the genetic modification system may result in the insertion of the desired payload without any additional sequences (e.g., a gene expression unit without a UTR for binding the genetically modified protein).

[0299] A template nucleic acid (e.g., template RNA) can be programmed to cause insertion, mutation, or deletion at a target DNA locus. In some embodiments, the template nucleic acid (e.g., template RNA) can be programmed to cause insertion into the target DNA. For example, the template nucleic acid (e.g., template RNA) may contain a heterologous sequence, wherein reverse transcription will cause the heterologous sequence to be inserted into the target DNA. In other embodiments, the RNA template can be programmed to write deletions into the target DNA. For example, the template nucleic acid (e.g., template RNA) may be matched to upstream and downstream target DNA of the desired deletion, wherein reverse transcription will cause the upstream and downstream sequences to be copied from the template nucleic acid (e.g., template RNA) without intercalation sequences, such as causing deletion of intercalation sequences. In other embodiments, the template nucleic acid (e.g., template RNA) can be programmed to write edits into the target DNA. For example, the template RNA may be matched to a target DNA sequence except for one or more nucleotides, wherein reverse transcription will cause these edits to be copied into the target DNA, such as causing mutations, such as transition mutations or transversion mutations.

[0300] In some embodiments, the gene-modifying system is capable of inserting at least 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides (and optionally not exceeding 500, 400, 300, 200, or 100 nucleotides) at the target site. In some embodiments, the gene-modifying system is capable of inserting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides (and optionally not exceeding 500, 400, 300, 200, or 100 nucleotides) at the target site. In some embodiments, the gene-modifying system is capable of inserting at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases (and optionally not exceeding 1, 5, 10, or 20 kilobases) at the target site. In some embodiments, the gene-modifying system is capable of producing deletions of at least 81, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally not exceeding 500, 400, 300, or 200 nucleotides). In some embodiments, the gene-editing system is capable of producing deletions of at least 81, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally not exceeding 500, 400, 300, or 200 nucleotides). In some embodiments, the gene-editing system is capable of producing deletions of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally not exceeding 500, 400, 300, or 200 nucleotides). In some implementations, the gene-modification system is capable of producing deletions of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases (and optionally not exceeding 1, 5, 10, or 20 kilobases).

[0301] Methods and compositions for modifying RNA (e.g., template RNA).

[0302] In some embodiments, the RNA component of the system (e.g., the template RNA as described herein) contains one or more nucleotide modifications. In some embodiments, the modification pattern of the template RNA can significantly affect in vivo activity compared to unmodified or terminally modified templates. Without being bound by theory, this process may be at least partly attributed to the stability conferred on the RNA by the modification. Non-limiting examples of such modifications may include 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl) (2'-O-MOE), 2'-fluorine (2'-F), phosphate thioester (PS) bonds between nucleotides, GC substitution, and abasic linkages between nucleotides, and their equivalents.

[0303] In some embodiments, the template RNA (e.g., at its target binding site) includes a 5' terminal region. In some embodiments, the template RNA does not include a 5' terminal region. In some embodiments, the 5' terminal region includes a 5' end modification. In some embodiments, the template RNA includes a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the template RNA includes a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide. In some embodiments, the template RNA includes a 2'-fluorine (2'-F) modified nucleotide. In some embodiments, the template RNA includes an internucleotide phosphate thioester (PS) bond. In some embodiments, the template RNA includes a 5' end modification, a 3' end modification, or both 5' and 3' end modifications. In some embodiments, the 5' end modification includes an internucleotide phosphate thioester (PS) bond. In some embodiments, the 5' end modification comprises a nucleotide modified with 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl)(2'-O-MOE), and / or 2'-fluoro (2'-F). In some embodiments, the 5' end modification comprises at least one phosphate thioester (PS) bond and one or more nucleotides modified with 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl)(2'-O-MOE), and / or 2'-fluoro (2'-F). The terminal modification may comprise phosphate thioester (PS), 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl)(2'-O-MOE), and / or 2'-fluoro (2'-F) modifications. Equivalent terminal modifications are also covered in the embodiments described herein. In some embodiments, the template RNA comprises a combination of terminal modifications and modifications to one or more regions of the template RNA. In some embodiments, structure-guided and systematic approaches are used to introduce modifications (e.g., 2′-OMe-RNA, 2′-F-RNA, and PS modifications) into the template RNA, as described, for example, in Mir et al., Nat Commun 9:2641 (2018) (which is incorporated herein by reference in its entirety). In some embodiments, the incorporation of 2′-F-RNA increases the thermostability and nuclease stability of the RNA:RNA or RNA:DNA duplex, for example, while minimizing interference with C3′-endo sugar puckering. In some embodiments, 2′-F may be better tolerated than 2′-OMe at positions where 2′-OH is important for RNA:DNA duplex stability. In some embodiments, structure-guided and systematic approaches (e.g., as described, Mir et al., Nat Commun 9:2641 (2018); which is incorporated herein by reference in its entirety) are employed to search for modifications to the template RNA.In some implementations, the structure of the polypeptide bound to the template RNA is used to determine the non-protein contact nucleotides of the RNA, which can then be selected for modification, for example, with a lower risk of disrupting the association between the RNA and the polypeptide. Secondary structures in the template RNA can also be predicted computationally using software tools, such as the RNAstructure tool available at rna.urmc.rochester.edu / RNAstructureWeb (Bellaousov et al. Nucleic Acids Res 41:W471-W474 (2013); incorporated herein by reference in its entirety), for example, to determine secondary structures for selecting modifications (e.g., hairpins, stems, and / or protrusions).

[0304] The use of circular and / or linear RNA states during formulation, delivery, or gene modification reactions within target cells is expected to be useful. Therefore, in some embodiments of any aspect described herein, the gene modification system comprises one or more circular RNAs (circRNAs). In some embodiments of any aspect described herein, the gene modification system comprises one or more linear RNAs. In some embodiments, the nucleic acid as described herein (e.g., template nucleic acid, nucleic acid molecule encoding a gene-modified polypeptide, or both) is a circRNA. In some embodiments, the circular RNA molecule encodes a gene-modified polypeptide. In some embodiments, the circRNA molecule encoding the gene-modified polypeptide is delivered to a host cell. In some embodiments, the circRNA molecule encoding the gene-modified polypeptide is linearized prior to translation (e.g., in the host cell, for example, in the host cell nucleus). Circular RNAs are described, for example, on pages 1215-1218 of PCT Publication No. WO / 2021 / 178720.

[0305] This document also includes compositions and methods for assembling all or part of the template RNA molecule. Methods for producing template RNA are described, for example, on pages 1150-1155 of PCT Publication No. WO / 2021 / 178720.

[0306] Additional template features

[0307] In some embodiments, the template (e.g., template RNA) contains certain structural features, for example, determined by a computer. In embodiments, the template RNA is predicted to have a minimum energy structure between -280 and -480 kcal / mol (e.g., between -280 and -300, -300 and -350, -350 and -400, -400 and -450, or -450 and -480 kcal / mol), for example, as measured by RNA structure, as described in Turner and Mathews Nucleic Acids Res38:D280-282 (2009) (included herein by reference in its entirety).

[0308] In some embodiments, the template (e.g., template RNA) contains certain structural features, such as those determined in vitro. In some embodiments, the template RNA is sequence-optimized, for example, to reduce secondary structures determined in vitro, such as by SHAPE-MaP (e.g., as described in Siegfried et al., Nat Methods 11:959-965 (2014); incorporated herein by reference in its entirety). In some embodiments, the template (e.g., template RNA) contains certain structural features, such as those determined in cells. In some embodiments, the template RNA is sequence-optimized, for example, to reduce secondary structures measured in cells, such as by DMS-MaPseq (e.g., as described in Zubradt et al., Nat Methods 14:75-82 (2017); incorporated herein by reference in its entirety).

[0309] Additional functional properties and features of gene modification systems

[0310] In some cases, the gene modification system described herein can be characterized by one or more functional measurements or properties. In some embodiments, the DNA-binding domain has one or more of the following functional properties. In some embodiments, the RNA-binding domain has one or more of the following functional properties. In some embodiments, the endonuclease domain has one or more of the following functional properties. In some embodiments, the reverse transcriptase domain has one or more of the following functional properties. In some embodiments, the template (e.g., template RNA) has one or more of the following functional properties. In some embodiments, the target site for binding to the gene-modified polypeptide has one or more of the following functional properties.

[0311] Gene-modified peptides

[0312] DNA-binding domain

[0313] In some embodiments, the DNA-binding domain is capable of binding the target sequence (e.g., the dsDNA target sequence) with a higher affinity than a reference DNA-binding domain. In some embodiments, the reference DNA-binding domain is the R2_BM DNA-binding domain from the silkworm (B. mori). In some embodiments, the DNA-binding domain is capable of binding the target sequence (e.g., the dsDNA target sequence) with an affinity between 100 pM and 10 nM (e.g., 100 pM-1 nM or 1 nM-10 nM).

[0314] In some implementations, the affinity of the DNA-binding domain for its target sequence (e.g., dsDNA target sequence) is measured in vitro, for example by thermophoresis, as described in, for example, Asmari et al. Methods 146:107-119 (2018) (incorporated herein by reference in its entirety).

[0315] In the implementation, the DNA-binding domain is capable of binding to its target sequence (e.g., dsDNA target sequence), for example, in the presence of a molar excess, such as about 100 times molar excess, of a disordered sequence competitor dsDNA, with an affinity between 100 pM and 10 nM (e.g., between 100 pM and 1 nM or between 1 nM and 10 nM).

[0316] In some embodiments, the association frequency of the DNA-binding domain with its target sequence (e.g., dsDNA target sequence) is found to be higher than the association frequency of any other sequence in the genome of the target cell (e.g., human target cell), for example, as measured by ChIP-seq (e.g., in HEK293T cells), as described in Chapter 21 of He and Pu (2010) Curr. Protoc Mol Biol (incorporated herein by reference in its entirety). In some embodiments, the association frequency of the DNA-binding domain with its target sequence (e.g., dsDNA target sequence) is found to be at least about 5-fold or 10-fold higher than the frequency of any other sequence in the genome of the target cell, for example, as measured by ChIP-seq (e.g., in HEK293T cells), as described in He and Pu (2010), ibid.

[0317] In some embodiments, the genetically modified polypeptide comprises a modification of the DNA-binding domain, for example, relative to a wild-type polypeptide. In some embodiments, the DNA-binding domain comprises an addition, deletion, substitution, or modification of the amino acid sequence of the original DNA-binding domain. In some embodiments, the DNA-binding domain is modified to include a heterologous functional domain that specifically binds to a target nucleic acid (e.g., DNA) sequence of interest. In some embodiments, the functional domain replaces at least a portion (e.g., all) of the polypeptide's previous DNA-binding domain. In some embodiments, the genetically modified polypeptide comprises a modification of the endonuclease domain, for example, relative to a wild-type polypeptide. In some embodiments, the endonuclease domain comprises an addition, deletion, substitution, or modification of the amino acid sequence of the original endonuclease domain. In some embodiments, the endonuclease domain is modified to include a heterologous functional domain that specifically binds to and / or induces endonuclease cleavage of a target nucleic acid (e.g., DNA) sequence of interest.

[0318] RNA-binding domain

[0319] In some embodiments, the RNA-binding domain is capable of binding template RNA with a higher affinity than a reference RNA-binding domain. In some embodiments, the reference RNA-binding domain is the RNA-binding domain of R2_BM from the silkworm. In some embodiments, the RNA-binding domain is capable of binding template RNA with an affinity between 100 pM and 10 nM (e.g., 100 pM–1 nM or 1 nM–10 nM). In some embodiments, the affinity of the RNA-binding domain for its template RNA is measured in vitro, for example by thermophoresis, as described in, for example, Methods 146:107-119 (2018) by Asmari et al. (incorporated herein by reference in its entirety). In some embodiments, the affinity of the RNA-binding domain for its template RNA is measured in cells (e.g., by FRET or CLIP-Seq).

[0320] In some embodiments, the RNA-binding domain associates with template RNA at least 5 to 10 times more frequently in vitro than with out-of-order RNA. In some embodiments, the association frequency between the RNA-binding domain and template RNA or out-of-order RNA is measured by CLIP-seq, for example, as described in Lin and Miles (2019) Nucleic Acids Res47(11):5490-5501 (in its entirety, incorporated herein by reference). In some embodiments, the RNA-binding domain associates with template RNA at least 5 to 10 times more frequently in cells (e.g., HEK293T cells) than with out-of-order RNA. In some embodiments, the association frequency between the RNA-binding domain and template RNA or out-of-order RNA is measured by CLIP-seq, for example, as described above in Lin and Miles (2019).

[0321] Nucleotide endonuclease domain

[0322] In some embodiments, the endonuclease domain associates with target dsDNA at a frequency at least about 5 to 10 times higher than it associates with out-of-order dsDNA in vitro. In some embodiments, the endonuclease domain associates with target dsDNA at a frequency at least 5 to 10 times higher than it associates with out-of-order dsDNA in vitro, for example in cells (e.g., HEK293T cells). In some embodiments, the frequency of association between the endonuclease domain and target DNA or out-of-order DNA is measured by ChIP-seq, for example as described in Chapter 21 of He and Pu (2010) Curr. Protoc Mol Biol (incorporated herein by reference in its entirety).

[0323] In some embodiments, the endonuclease domain can catalyze the formation of a nick at the target sequence, for example, by at least about 5-fold or 10-fold relative to a non-target sequence (e.g., relative to any other genomic sequence in the target cell genome). In some embodiments, the nick formation level is determined using NickSeq, for example as described in Elacqua et al. (2019) bioRxivdoi.org / 10.1101 / 867937 (which is incorporated herein by reference in its entirety).

[0324] In some embodiments, the endonuclease domain is capable of cleaving DNA in vitro. In some embodiments, cleavage results in exposed bases. In some embodiments, the exposed bases can be detected using a nuclease sensitivity assay, for example, as described in Chaudhry and Weinfeld (1995) Nucleic Acids Res 23(19):3805-3809 (into this document by reference in its entirety). In some embodiments, the level of exposed bases (e.g., detected by a nuclease sensitivity assay) is increased by at least 10%, 50%, or more relative to a reference endonuclease domain. In some embodiments, the reference endonuclease domain is the R2_BM endonuclease domain from the silkworm.

[0325] In some embodiments, the endonuclease domain is capable of cleaving DNA in cells. In some embodiments, the endonuclease domain is capable of cleaving DNA in HEK293T cells. In some embodiments, unrepaired cleavages that replicate in the absence of Rad51 result in an increased NHEJ rate at the cleavage site, which can be detected, for example, by using a Rad51 inhibition assay, as described, for example, as in Bothmer et al. (2017) Nat Commun 8:13905 (into this document by reference in its entirety). In some embodiments, the NHEJ rate increases to more than 0-5%. In some embodiments, for example, after Rad51 inhibition, the NHEJ rate increases to 20-70% (e.g., between 30%-60% or 40-50%).

[0326] In some implementations, the endonuclease domain releases the target after cleavage. In some implementations, target release is indirectly indicated by assessing the number of enzyme turnovers, for example, as described in Yourik et al. RNA 25(1):35-44 (2019) (incorporated herein by reference in its entirety) and as... Figure 2 As shown. In some implementations, such as those using this method, the k-value of the nuclease domain is measured. exp For 1 x 10 -3 –1x 10 - 5 min-1.

[0327] In some implementations, the endonuclease domain has a density greater than approximately 1 x 10⁻⁶ in vitro. 8 s -1 M -1 catalytic efficiency (k cat / K m In the implementation plan, the endonuclease domain has a density greater than approximately 1 x 10⁻⁶ in vitro. 5 1x10 6 1x10 7 Or 1x108 s -1 M -1 The catalytic efficiency. In embodiments, the catalytic efficiency is determined as described in Chen et al. (2018) Science 360(6387):436-439 (incorporated herein by reference in its entirety). In some embodiments, the endonuclease domain has a catalytic efficiency greater than about 1 x 10⁻⁶ in the cell. 8 s -1 M -1 catalytic efficiency (k cat / K m In the implementation plan, the endonuclease domain has a size greater than approximately 1 x 10^6 ppm in the cell. 5 1x10 6 1x10 7 Or 1x 10 8 s -1 M -1 catalytic efficiency.

[0328] reverse transcriptase domain

[0329] In some implementations, the reverse transcriptase domain has a lower probability of premature termination (P0) in vitro compared to the reference reverse transcriptase domain. off In some implementations, the reference reverse transcriptase domain is the reverse transcriptase domain of R2_BM from the silkworm or a viral reverse transcriptase domain, such as the RT domain from M-MLV.

[0330] In some implementations, the reverse transcriptase domain exhibits a low probability of premature termination (P0) in vitro. off (), less than approximately 5 x 10 -3 / nt, 5x 10 -4 / nt or 5x 10 -6 / nt, for example, as measured on 1094nt RNA. In the implementation, the in vitro premature termination rate is determined as described in Bibillo and Eickbush (2002) J Biol Chem 277(38):34836-34845 (incorporated herein by reference in its entirety).

[0331] In some implementations, the reverse transcriptase domain is capable of completing at least about 30% or 50% of integration in the cell. The percentage of complete integration can be measured by dividing the number of substantially full-length integration events (e.g., genomic sites containing at least 98% of the expected integration sequence) by the total number of integration events in the cell population (including substantially full-length and partial integration events). In implementations, long-read amplicon sequencing is used to determine integration in the cell (e.g., across integration sites), for example, as described in Karst et al. (2020) bioRxiv doi.org / 10.1101 / 645903 (incorporated herein by reference in its entirety).

[0332] In the implementation, quantifying integration in cells includes counting the integration fractions of at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the DNA sequence containing the template RNA (e.g., at least 0.05, 0.1, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.2, 1.4, 1.4, 1.6, 1.6, 1.8, 1.8, 2, 3, 4, or 4-5 kb).

[0333] In some embodiments, the reverse transcriptase domain is capable of polymerizing dNTPs in vitro. In these embodiments, the reverse transcriptase domain is capable of polymerizing dNTPs in vitro at a rate between 0.1 and 50 nt / s (e.g., between 0.1–1, 1–10, or 10–50 nt / s). In these embodiments, the polymerization of dNTPs by the reverse transcriptase domain is measured by a single-molecule assay, for example, as described in Schwartz and Quake (2009) PNAS 106(48):20294–20299 (incorporated in its entirety by reference).

[0334] In some implementations, the reverse transcriptase domain has a 1 x 10 -3 –1x 10 -4 Or 1x 10 -4 –1x 10 -5 The in vitro error rate (e.g., nucleotide mis-incorporation) between substitutions / nt, for example, as described in Yasukawa et al. (2017) Biochem Biophys Res Commun 492(2):147-153 (incorporated herein by reference in its entirety). In some embodiments, the error rate (e.g., nucleotide mis-incorporation) of the reverse transcriptase domain in cells (e.g., HEK293T cells) is within 1 x 10-1 -3–1x 10 -4 Or 1x 10 -4 –1x 10 -5 Between substitutions / nt, for example by long-read amplicon sequencing, as described in Karst et al. (2020) bioRxiv doi.org / 10.1101 / 645903 (incorporated in its entirety by reference).

[0335] In some embodiments, the reverse transcriptase domain is capable of reverse transcription of the target RNA in vitro. In some embodiments, the reverse transcriptase requires a primer of at least 3 nt to initiate reverse transcription of the template. In some embodiments, reverse transcription of the target RNA is determined by detecting cDNA from the target RNA (e.g., when an ssDNA primer is provided, for example, annealed at the 3' end to a target of at least 3, 4, 5, 6, 7, 8, 9, or 10 nt), for example as described in Bibillo and Eickbush (2002) J Biol Chem 277(38):34836-34845 (incorporated herein by reference in its entirety).

[0336] In some embodiments, the reverse transcriptase domain performs reverse transcription (e.g., via cDNA) with at least 5 or 10 times greater efficiency, for example, when its RNA template is converted to cDNA, for example, compared to an RNA template lacking a protein-binding motif (e.g., 3'UTR). In embodiments, the measurement of reverse transcription efficiency is performed as described in Yasukawa et al. (2017) Biochem Biophys Res Commun 492(2):147-153 (incorporated herein by reference in its entirety).

[0337] In some embodiments, the reverse transcriptase domain binds specifically to a particular RNA template at a higher frequency (e.g., about 5 or 10 times higher) than any endogenous cellular RNA, for example, when expressed in cells (e.g., HEK293T cells). In embodiments, the specific binding frequency between the reverse transcriptase domain and the template RNA is measured by CLIP-seq, for example as described in Lin and Miles (2019) Nucleic Acids Res 47(11):5490-5501 (incorporated herein by reference in its entirety).

[0338] Target sites and integration

[0339] In some embodiments, after gene editing, the target site surrounding the integration sequence contains a limited number of insertions or deletions, for example, in less than about 50% or 10% of integration events, for example, as determined by long-read amplicon sequencing of the target site, as described in Karst et al. (2020) bioRxiv doi.org / 10.1101 / 645903 (into the entirety by reference). In some embodiments, the target site does not show multiple insertion events, such as head-to-tail or head-to-head duplicates, for example, as determined by long-read amplicon sequencing of the target site, as described in Karst et al. bioRxiv doi.org / 10.1101 / 645903 (2020) (into the entirety by reference). In some embodiments, the target site contains an integration sequence corresponding to the template RNA. In some embodiments, in more than about 1% or 10% of events, the target site does not contain an insertion caused by endogenous RNA, for example, as determined by long-read amplicon sequencing of the target site, as described in, for example, Karst et al. bioRxiv doi.org / 10.1101 / 645903 (2020) (inherited herein by reference in its entirety). In some embodiments, the target site contains an integration sequence corresponding to the template RNA.

[0340] In some implementations, the target site contains an integration sequence corresponding to the template RNA. In other implementations, the target site does not contain sequences outside the template, such as those determined by long-read amplicon sequencing of the target site (e.g., as described in Karst et al. bioRxiv doi.org / 10.1101 / 645903 (2020); which are incorporated herein by reference in their entirety).

[0341] DNA damage response

[0342] In some implementations, modifying the genome of cells (e.g., primary cells, such as T cells) using a gene-modification system does not lead to activation of the endogenous DNA damage response (DDR) pathway. In some implementations, modifying the genome of cells (e.g., primary cells) using a gene-modification system results in a lower level of activation of the cellular endogenous DDR pathway compared to other similar cells treated with Cas9.

[0343] In some embodiments, modifying the genome of cells (e.g., primary cells, such as T cells) using a gene-modification system does not lead to activation of the endogenous interferon response. In some embodiments, modifying the genome of cells using a gene-modification system results in a lower level of activation of the cell's interferon response compared to other similar cells treated with a gene-modification system containing elements derived from LINE-1 reverse transposase.

[0344] In some embodiments, the gene-modified peptide system described herein includes a self-inactivation module. The self-inactivation module results in a reduction in the expression of the gene-modified peptide, the gene-modified template, or both. The self-inactivation module is described, for example, on pages 1200-1201 of PCT Publication No. WO / 2021 / 178720.

[0345] In some embodiments, the polypeptides described herein (e.g., genetically modified polypeptides) may be controlled via small molecules. In some embodiments, the polypeptides are dimerized via small molecules. This type of polypeptide is described, for example, on pages 1201-1203 of WO / 2021 / 178720.

[0346] Heterologous gene modification system

[0347] The conjugates (targeted LNPs) described herein can be formulated to include one or more components of a heterogeneous gene modification system or one or more nucleic acids encoding said components. Therefore, in some embodiments, the payload includes a heterogeneous gene modification system or one or more nucleic acids encoding a heterogeneously modified polypeptide component. For example, in some embodiments, the payload includes a template RNA and mRNA encoding a heterogeneously modified polypeptide.

[0348] A heterologous gene modification system may comprise a heterologous gene-modified peptide and a template RNA. The heterologous gene-modified peptide may comprise an endonuclease domain, a DNA-binding domain, an adapter, and a retrovirus-derived reverse transcriptase domain. The heterologous gene-modified peptide may comprise a Cas domain, an adapter, and a retrovirus-derived reverse transcriptase domain. The template RNA compatible with the heterologous gene-modified peptide may comprise (e.g., from 5′ to 3′) (i) a gRNA spacer that binds to the target site, (ii) a gRNA scaffold that binds to the heterologous gene-modified peptide, such as the Cas domain of the heterologous gene-modified peptide, (iii) a heterologous target sequence, and (iv) a primer-binding site (PBS) sequence. These components will now be described in more detail.

[0349] In some aspects, the heterologous gene-modified polypeptides described herein comprise (e.g., the systems described herein comprise gene-modified polypeptides comprising): 1) a Cas domain (e.g., a Cas nickase domain, such as a Cas9 nickase domain); 2) a reverse transcriptase (RT) domain, wherein the RT domain is the C-terminus of the Cas domain; and a linker disposed between the RT domain and the Cas domain.

[0350] In some embodiments, the heterologous genetically modified polypeptide comprises the sequence of SEQ ID NO:4000, which includes a first NLS and a Cas domain, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the heterologous genetically modified polypeptide comprises the sequence of SEQ ID NO:4001, which includes a second NLS, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0351] Exemplary N-terminal NLS-Cas9 domain:

[0352]

[0353] Example C-terminal sequences containing NLS:

[0354] AGKRTADGSEFEKRTADGSEFESPKKKAKVE(SEQ ID NO:75)

[0355] In some embodiments, the heterologous gene-modified polypeptides described herein comprise an RT domain having an amino acid sequence having the sequence of Table 6 of International Application WO / 2023 / 039440 (which is incorporated herein by reference in its entirety), or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with it.

[0356] In some embodiments, the heterologous gene-modified polypeptide comprises: (i) a linker comprising a linker sequence as listed in a row of Table 8, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with it; and (ii) an RT domain comprising an RT domain sequence as listed in the same row of Table 8, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with it. In some embodiments, the heterologous gene-modified polypeptide comprises an amino acid sequence according to Table 9, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with it.

[0357] Table 8. Selection of Exemplary Genetically Modified Peptides

[0358]

[0359]

[0360]

[0361] Table 9. Full-length amino acid sequences corresponding to Table 8

[0362]

[0363]

[0364]

[0365]

[0366]

[0367] In some embodiments, the heterologous genetically modified polypeptide has a sequence disclosed in International Application WO / 2023 / 039424 (which is incorporated herein by reference in its entirety), or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with it. For example, in some embodiments, the heterologous genetically modified polypeptide has an RT domain as described in Table 6 of International Application WO / 2023 / 039424 (which is incorporated herein by reference in its entirety), or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with it. In some embodiments, the heterologous genetically modified polypeptide may include a linker, such as a peptide linker, for example, a linker as described in Table 10 of International Application WO / 2023 / 039424 (which is incorporated herein by reference in its entirety). In some embodiments, the heterologous genetically modified polypeptide has a sequence according to Table T2 of International Application WO / 2023 / 039424 (which is incorporated herein by reference in its entirety), or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with it. In some embodiments, the heterologous genetically modified polypeptide has a sequence according to Table A1 of International Application WO / 2023 / 039424 (which is incorporated herein by reference in its entirety), or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with it.

[0368] In some embodiments, the genetically modified polypeptide comprises an RT domain derived from a retroviral reverse transcriptase (e.g., M-MLVRT), such as containing the following sequence:

[0369] TLNIEDEHRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGNLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGTAGFCRLWIPGFAEMAAPLYPLTKTGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITETPDTSTLL(SEQ ID NO:85), or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0370] In some embodiments, the M-MLV RT domain contains one or more mutations relative to the M-MLV (WT) sequence described above, such as those selected from D200N, L603W, T330P, T306K, W313F, D524G, E562Q, D583N, P51L, S67R, E67K, T197A, H204R, E302K, F309N, L435G, N454K, H594Q, D653N, R110S, K103L, or combinations of mutations such as D200N, L603W, and T330P, optionally further including T306K and W313F. In some embodiments, the M-MLV RT as used herein contains the mutations D200N, L603W, T330P, T306K, and W313F. In the implementation scheme, the mutated M-MLV RT contains the following amino acid sequence:

[0371] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFNEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGNLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGKAGFCRLFIPGFAEMAAPLYPLTKPGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGWLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITETPDTSTLLI(SEQ ID NO:86)

[0372] The exemplary gene modification system comprises a mutated M-MLV RT region:

[0373]

[0374] In some embodiments, the heterologous genetically modified polypeptide comprises the amino acid sequence according to SEQ ID NO:4002, or a sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with it.

[0375] In some embodiments, the template RNA molecule used in this system comprises, from 5′ to 3′, (1) a gRNA spacer; (2) a gRNA scaffold; (3) a heterologous target sequence; and (4) a primer binding site (PBS) sequence. In some embodiments:

[0376] (1) It is a gRNA spacer of approximately 18-22 nt, for example, 20 nt.

[0377] (2) is a gRNA scaffold containing one or more hairpin loops (e.g., 1, 2, or 3 loops) for associating a template with a Cas domain (e.g., a nickase Cas9 domain). In some embodiments, the gRNA scaffold contains the sequence GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGGACCGAGTCGGTCC (SEQ ID NO:88) from 5′ to 3′.

[0378] (3) In some implementations, the length of the heterologous target sequence is, for example, 7-74, such as 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, or 70-80nt or 80-90nt.

[0379] (4) In some embodiments, the PBS sequence that binds to the target initiation sequence after the nick occurs is, for example, 3-20 nt, such as 7-15 nt, such as 12-14 nt. In some embodiments, the PBS sequence has a GC content of 40-60%.

[0380] V. Lipid nanoparticles

[0381] This disclosure provides lipid nanoparticles (LNPs) that are conjugated to target moieties in a site-specific manner via specific enzyme recognition linkers, as disclosed herein. In some embodiments, the lipid nanoparticles comprise one or more ionic lipids, such as non-cationic lipids (e.g., neutral or anionic or zwitterionic lipids); one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers described in Table 5 of WO2019217941; which are incorporated herein by reference in their entirety); one or more sterols (e.g., cholesterol); or combinations thereof. The conjugation methods described herein can be used to site-specifically conjugate target moieties (or multiple target moieties) to the surface of LNPs comprising various formulations and specific lipid compositions.

[0382] Lipids that can be used for nanoparticle formation (e.g., lipid nanoparticles) include, for example, the lipids described in Table 4 of US20210371858, which is incorporated herein by reference—for example, lipid-containing nanoparticles may contain one or more lipids as described in Table 4 of US20210371858. Lipid nanoparticles may contain additional elements, such as polymers, such as those described in Table 5 of US20210371858, which is incorporated herein by reference.

[0383] In some embodiments, when conjugated lipids are present, they may include one or more of the following: PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramides (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEGylated succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2',3')... '-Di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG dialkoxypropylcarbamate, N-(carbonyl-methoxy polyethylene glycol 2000)-1,2-distearate-sn-glycerol-3-phosphate ethanolamine sodium salt, and those described in Table 2 of US20210059953 (incorporated by reference), as well as combinations thereof.

[0384] In some embodiments, the sterols that can be incorporated into lipid nanoparticles include one or more cholesterol or cholesterol derivatives, such as those in US11141378 or US2010 / 0130588, which are incorporated herein by reference. Other exemplary sterols include phytosterols, including those described in Eygeris et al. (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference.

[0385] In some embodiments, the lipid particles comprise ionizable lipids, non-cationic lipids, conjugated lipids that inhibit particle aggregation, and sterols. The amounts of these components can be varied independently to achieve desired properties. For example, in some embodiments, the lipid nanoparticles comprise, in amounts of about 20 mol% to about 90 mol% of total lipids (in other embodiments, this may be 20-70%, 30-60%, or 40-50% mol; or about 50 mol% to about 90 mol% of total lipids present in the lipid nanoparticles), about 5 mol% to about 30 mol% of total lipids, about 0.5 mol% to about 20 mol% of total lipids, and about 20 mol% to about 50 mol% of total lipids. The ratio of total lipids to nucleic acids can be varied as needed. For example, the ratio of total lipids to nucleic acids (by mass or weight) can be about 10:1 to about 30:1.

[0386] In some embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) can range from about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipids and nucleic acids can be adjusted to provide the desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10, or higher. Typically, the total lipid content of lipid nanoparticle formulations can range from about 5 mg / mL to about 30 mg / mL.

[0387] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein include lipids of any one of formulas (i)-(ix).

[0388]

[0389]

[0390]

[0391] Another non-limiting example of a lipid compound that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein includes lipids of formula (x):

[0392]

[0393] in

[0394] X 1 For O, NR 1 Or press the key directly, X 2 It is a C2-5 alkylene group, X 3 For C (=O) or direct bond, R 1 For H or Me, R 3 It is a C1-3 alkyl group, R 2 It is a C1-3 alkyl group, or R 2 With the nitrogen atom to which it is attached and X 2 One to three carbon atoms together form a 4, 5, or 6-membered ring, or X 1 For NR 1 R 1 and R 2 Together with the nitrogen atoms to which they are attached, they form 5- or 6-membered rings, or R 2 With R 3 Together with the nitrogen atoms attached to them, they form 5, 6, or 7-membered rings, Y 1 It is a C2-12 alkylene group, Y 2 Selected from

[0395]

[0396] (Any direction), (Any direction), (Any direction)

[0397] n is between 0 and 3, R 4 It is a C1-15 alkyl group, Z 1 It is a C1-6 alkylene or direct bond.

[0398] Z 2 yes

[0399] (In any direction) or does not exist, provided that Z is... 1 If it is a direct key, then Z 2 It does not exist;

[0400] R 5 It is a C5-9 alkyl or C6-10 alkoxy group, R 6 It is a C5-9 alkyl or C6-10 alkoxy group, W is a methylene group or a direct bond, and R is a C5-9 alkyl group or a C6-10 alkoxy group. 7 It is H or Me, or a salt thereof, provided that R is... 3 and R 2It is a C2 alkyl group, X 1 For O, X 2 It is a straight-chain C3 alkylene group, X 3 For C (=0), Y 1 It is a straight-chain Ce alkylene group, (Y 2 )nR 4 for

[0401]

[0402] R 4 It is a straight-chain C5 alkyl group, Z 1 It is a C2 alkylene group, Z 2 It does not exist, W is methylene, and R 7 If H is the value of R, then R 5 and R 6 It is not a Cx alkoxy group.

[0403] Another non-limiting example of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein includes lipids of formula (xi):

[0404]

[0405] Another non-limiting example of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein includes lipids of any one of formulas (xii)-(xiv):

[0406] in

[0407] Another non-limiting example of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein includes lipids of formula (xv):

[0408]

[0409] Another non-limiting example of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein includes lipids of formula (xvi):

[0410]

[0411] Another non-limiting example of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein includes lipids of any one of formulas (xvii)-(xix):

[0412]

[0413] Another non-limiting example of a lipid compound that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the conjugates described herein includes lipids of any one of formula (xx)(a) or (xx)(b):

[0414]

[0415] In some embodiments, the conjugates described herein comprise an LNP containing an ionizable lipid. In some embodiments, the ionizable lipid is heptadecano-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoic acid (SM-102); for example, as described in Example 1 of US 9,867,888 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is octadecane-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester (LP01), for example, synthesized in Example 13 of US 11420933 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 9-((4-dimethylamino)butyryl)oxy)heptadecanedioic acid di((Z)-non-2-en-1-yl) ester (L319), for example, synthesized in Examples 7, 8, or 9 of US2012 / 0027803 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azadiyl)bis(dodecyl-2-ol) (C12-200), for example, synthesized in Examples 14 and 16 of US8450298 (which is incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is an imidazole cholesterol ester (ICE) lipid 3-(1H-imidazol-4-yl)propionic acid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylhept-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecano-1H-cyclopentan[a]phenanthrene-3-yl ester, for example, structure (I) from US2022 / 0324926 (which is incorporated herein by reference in its entirety).

[0416] In some embodiments, the ionizable lipid can be a cationic lipid, an ionizable cationic lipid (e.g., a cationic lipid that exists in a positively charged or neutral form depending on pH), or an amine-containing lipid that can be readily ionized. In some embodiments, the cationic lipid is a lipid capable of carrying a positive charge, for example, under physiological conditions. Exemplary cationic lipids include one or more positively charged amine groups. In some embodiments, the lipid particles comprise a cationic lipid formulated with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structural lipids (e.g., sterols), PEG, cholesterol, and polymer-conjugated lipids. In some embodiments, the cationic lipid can be an ionizable cationic lipid. Exemplary cationic lipids as disclosed herein can have an effective pKa greater than 6.0. In embodiments, the lipid nanoparticles can comprise a second cationic lipid having an effective pKa different from that of the first cationic lipid (e.g., greater than the first effective pKa). Lipid nanoparticles may comprise 30 to 60 molar percentages of cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and therapeutic agents encapsulated within or associated with the lipid nanoparticles, such as nucleic acids (e.g., RNA) (e.g., template nucleic acids or nucleic acids encoding desired polypeptides) as described herein. In some embodiments, the nucleic acid is co-formulated with the cationic lipid. The nucleic acid may adsorb onto the surface of the LNP, for example, an LNP comprising cationic lipids. In some embodiments, the nucleic acid may be encapsulated within the LNP, for example, an LNP comprising cationic lipids. In some embodiments, the lipid nanoparticle may comprise a targeting portion, for example, coated with a targeting agent. In embodiments, the LNP formulation is biodegradable. In some embodiments, lipid nanoparticles comprising one or more lipids described herein (e.g., formulas (i), (ii), (ii), (vii), and / or (ix)) encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% of RNA molecules (e.g., template RNA and / or mRNA encoding the desired polypeptide).

[0417] Exemplary ionizable lipids that can be used in the disclosed conjugates include, but are not limited to, those listed in Table 1 of US20210059953, which is incorporated herein by reference. Other exemplary lipids include, but are not limited to, one or more of the following formulas: X of US2016 / 0311759; I of US20150376115 or US2016 / 0376224; I, II, or III of US20160151284; I, IA, II, or IIA of US20170210967; Iincorpo-c of US20150140070; A of US2013 / 0178541; I of US2013 / 0303587 or US2013 / 0123338; ​​I of US2015 / 0141678; II, I of US2015 / 0239926. II, IV, or V; I of US2017 / 0119904; I or II of WO2017 / 117528; A of US2012 / 0149894; A of US2015 / 0057373; A of WO2013 / 116126; A of US2013 / 0090372; A of US2013 / 0274523; A of US2013 / 0274504; A of US2013 / 0053572; A of W02013 / 016058; A of W02012 / 162210; I of US2008 / 042973; I, II, or I of US2012 / 01287670 II or IV; I or II of US2014 / 0200257; I, II, or III of US2015 / 0203446; I or III of US2015 / 0005363; I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV of US2014 / 0308304; I, II, III, III, or IV of US2013 / 0338210; I, II, III, or IV of WO2009 / 132131; A of US2012 / 01011478; I or XXXV of US2012 / 0027796; XIV or XVI of US2012 / 0058144. I; of US2013 / 0323269; I of US2011 / 0117125; I, II, or III of US2011 / 0256175; I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII of US2012 / 0202871; I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of US2011 / 0076335; I or II of US2006 / 008378; I of US2013 / 0123338; ​​I or XAYZ of US2015 / 0064242;US2013 / 0022649, XVI, XVII, or XVIII; US2013 / 0116307, I, II, or III; US2013 / 0116307, I, II, or III; US2010 / 0062967, I or II; US2013 / 0189351, IX; US2014 / 0039032, I; US2018 / 0028664, V; US2016 / 0317458, I; US2013 / 0195920, I; US10,221,127, 5, 6, or 10; WO2018 / 081480, III-3; WO2020 / 081938, I-5 or I-8; US9 ,867,888 of 18 or 25; A of US2019 / 0136231; II of WO2020 / 219876; 1 of US2012 / 0027803; OF-02 of US2019 / 0240349; 23 of US10,086,013; cKK-E12 / A6 of Miao et al. (2020); C12-200 of WO2010 / 053572; 7C1 of Dahlman et al. (2017); 304-O13 or 503-O13 of Whitehead et al.; TS-P4C2 of US9,708,628; I of WO2020 / 106946; I of WO2020 / 106946.

[0418] In some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,31Z)-heptadec-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate (DLin-MC3-DMA or MC3), for example, as described in Example 9 of US2021 / 0059953 (into the entirety by reference). In some embodiments, the ionizable lipid is lipid ATX-002, for example, as described in Example 10 of US2021 / 0059953 (into the entirety by reference). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocodec-13,16-dien-1-amine (compound 32), for example, as described in Example 11 of US2021 / 0059953 (into the entirety by reference). In some embodiments, the ionizable lipid is compound 6 or compound 22, for example, as described in Example 12 of US2021 / 0059953 (which is incorporated herein by reference in its entirety).

[0419] The specific ionizable lipids are shown in Table 10.

[0420] Table 10: Ionizable Lipids

[0421]

[0422] Exemplary non-cationic lipids include, but are not limited to, distearyl-sn-glycerol-ethanolamine phosphate, distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), palmitoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleiminomethyl)-cyclohexane-1-carboxylic acid ester (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidyl phosphate ethanolamine (DMPE), distearyl-phosphatidyl-ethanolamine (DSPE), monomethylphosphatidylethanolamine (such as 16-O-monomethylPE), and dimethylphosphatidylethanolamine (such as 16-O-dimethyl PE). PE), l8-l-transPE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine (HSPC), lecithin choline (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearate phosphatidylglycerol (DSPG), disorhoylphosphatidylcholine (DEPC), palmitoyloleoylphosphatidylglycerol (POPG), dialenyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysophosphatidylcholine, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, lecithin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetylphosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine or mixtures thereof. It should be understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably derived from fatty acids having a C10-C24 carbon chain, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. In some embodiments, other exemplary lipids include, but are not limited to, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference. In some embodiments, such lipids include plant lipids (e.g., DGTS) that have been found to improve liver mRNA transfection.

[0423] Other examples of non-cationic lipids suitable for lipid nanoparticles include, but are not limited to, nonphospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glyceryl castor oil, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethoxylated fatty acid amides, dioctadecyl dimethyl ammonium bromide, ceramides, sphingomyelin, etc. Other non-cationic lipids are described in WO2017 / 099823 or US Patent Publication US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety.

[0424] In some embodiments, the noncationic lipid is oleic acid or a compound of formula I, II, or IV of US2018 / 0028664, which is incorporated herein by reference in its entirety. The noncationic lipid may comprise, for example, 0-30% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the noncationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipids present in the lipid nanoparticles. In embodiments, the molar ratio of ionizable lipids to neutral lipids ranges from about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0425] In some implementations, the lipid nanoparticles contain any phospholipids.

[0426] In some aspects, lipid nanoparticles may further comprise components such as sterols to provide membrane integrity. An exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5α-cholesterol, 53-cosanosol, cholesterol-(2,-hydroxy)-ethyl ether, cholesterol-(4'-hydroxy)-butyl ether, and 6-ketocholesterol; non-polar analogs such as 5α-cholesterol, cholesterolenone, 5α-cholesterone, 5p-cholesterone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as cholesterol-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO2009 / 127060 and U.S. Patent Publication US2010 / 0130588, which are incorporated herein by reference in their entirety.

[0427] In some embodiments, the component providing membrane integrity (such as sterols) may comprise 0-50% (mol) of the total lipids present in the lipid nanoparticles (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, this component comprises 20-50% (mol) to 30-40% (mol) of the total lipid content of the lipid nanoparticles.

[0428] In some embodiments, lipid nanoparticles may comprise polyethylene glycol (PEG) or conjugated lipid molecules. Generally, they are used to inhibit the aggregation of lipid nanoparticles and / or provide steric stability. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic-polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, for example, a (methoxy polyethylene glycol) conjugated lipid.

[0429] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerols (DAGs) such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramides (Cer), polyethylene glycol-modified phosphatidylethanolamine (PEG-PE), PEG-succinate diglycerols (PEGS-DAGs) such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG-dialkoxypropylcarbamate, N-(carbonyl-methoxy-polyethylene glycol 2000)-1,2-distearate-sn-glycerol-3-phosphate ethanolamine sodium salt, or mixtures thereof. Other exemplary PEG-lipid conjugates are described, for example, in US 5,885,613, US 6,287,591, etc.

[0430] US2003 / 0077829, US2003 / 0077829, US2005 / 0175682, US2008 / 0020058, US2011 / 0117125, US2010 / 0130588, US2016 / 0376224, US2017 / 0119904, and US / 099823, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-lipid is a compound of formula III I, III-aI, III-a-2, III-b-1, III-b-2, or V of US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-lipid has formula II of US20150376115 or US2016 / 0376224, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearateloxypropyl. PEG-lipids can be one or more of PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-distearatelglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-distearatelglycamide, PEG-cholesterol (l-[8'-(cholest-5-en-3[β]-oxy)carbamoyl-3',6'-dioxaoctanyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB (3,4-bistetradecoxybenzyl-[ω]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine-N-[methoxy(poly(ethylene glycol))-2000]). In some embodiments, the PEG-lipid includes PEG-DMG, 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises a structure selected from the following:

[0431]

[0432]

[0433] In some implementations, lipids conjugated to molecules other than PEG can also be used to replace PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates can be used to replace or supplement PEG-lipids.

[0434] Exemplary conjugated lipids, namely PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in the PCT and LIS patent applications listed in Table 2 of US2021 / 0059953, the contents of which are incorporated herein by reference in their entirety.

[0435] In some embodiments, PEG or conjugated lipids may comprise 0-20% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipids present in the lipid nanoparticles. The molar ratio of ionizable lipids, noncationic lipids, sterols, and PEG / conjugated lipids can be varied as needed. For example, the lipid particles may comprise 30-70% (molar) of ionizable lipids, 0-60% (molar) of cholesterol, 0-30% (molar) of noncationic lipids, and 1-10% (molar) of conjugated lipids. Preferably, the composition comprises 30-40% (molar) of ionizable lipids, 40-50% (molar) of cholesterol, and 10-20% (molar) of noncationic lipids. In some other embodiments, the composition comprises 50-75% by molar or total weight of ionizable lipids, 20-40% by molar or total weight of cholesterol, and 5-10% by molar or total weight of non-cationic lipids and 1-10% by molar or total weight of conjugated lipids. The composition may contain 60-70% by molar or total weight of ionizable lipids, 25-35% by molar or total weight of cholesterol, and 5-10% by molar or total weight of non-cationic lipids. The composition may also contain up to 90% by molar or total weight of ionizable lipids and 2-15% by molar or total weight of non-cationic lipids. The formulation can also be a lipid nanoparticle formulation, for example comprising 8-30% by molar or total weight of ionizable lipids, 5-30% by molar or total weight of non-cationic lipids, and 0-20% by molar or total weight of cholesterol; or 4-25% by molar or total weight of ionizable lipids, 4-25% by molar or total weight of non-cationic lipids, 2-25% by molar or total weight of cholesterol, 10-35% by molar or total weight of conjugated lipids, and 5% by molar or total weight of cholesterol. Cholesterol; or 2-30% by molar or total weight of the composition of ionizable lipids, 2-30% by molar or total weight of the composition of non-cationic lipids, 1-15% by molar or total weight of the composition of cholesterol, 2-35% by molar or total weight of the composition of conjugated lipids and 1-20% by molar or total weight of the composition of cholesterol; or even up to 90% by molar or total weight of the composition of ionizable lipids and 2-10% by molar or total weight of the composition of non-cationic lipids, or even 100% by molar or total weight of the composition of cationic lipids.In some embodiments, the lipid particle formulation comprises ionizable lipids, phospholipids, cholesterol, and polyethylene glycol-modified lipids in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipids, cholesterol, and polyethylene glycol-modified lipids in a molar ratio of 60:38.5:1.5.

[0436] In some embodiments, the lipid particles comprise ionizable lipids, non-cationic lipids (e.g., phospholipids), sterols (e.g., cholesterol), and polyethylene glycol-modified lipids, wherein the molar percentage of lipids ranges from 20 to 70 mol percent for ionizable lipids, with a target of 40-60; the molar percentage of non-cationic lipids ranges from 0 to 30 mol percent, with a target of 0-15; the molar percentage of sterols ranges from 20 to 70 mol percent, with a target of 30-50; and the molar percentage of polyethylene glycol-modified lipids ranges from 1 to 6 mol percent, with a target of 2-5.

[0437] In some embodiments, the lipid particles comprise ionizable lipids / non-cationic lipids / sterols / conjugated lipids in a molar ratio of 50:10:38.5:1.5.

[0438] In one aspect, this disclosure provides a lipid nanoparticle formulation comprising phospholipids, lecithin, phosphatidylcholine, and phosphatidylethanolamine.

[0439] In some embodiments, LNPs are directed to specific cell types or tissues by adding a targeting domain (in addition to the targeting portion of the disclosed conjugate). For example, a biological ligand can be displayed on the surface of the LNP to enhance interaction with cells displaying the homologous receptor, thereby driving association with tissues expressing the receptor and cargo delivery to that tissue. In some embodiments, the biological ligand can be a ligand that drives delivery to the liver; for example, an LNP displaying GalNAc results in nucleic acid cargo delivery to hepatocytes displaying the desialylate glycoprotein receptor (ASGPR). A study by Akinc et al., Mol Ther 18(7):1357-1364 (2010), taught the conjugation of a trivalent GalNAc ligand to a PEG-lipid (GalNAc-PEG-DSG) to produce an ASGPR-dependent LNP, thereby achieving an observable LNP cargo effect (see, for example, Akinc et al. 2010, ibid.). Figure 6Other LNP formulations displaying ligands (e.g., those incorporating folic acid, transferrin, or antibodies) are discussed in WO2017223135, which is incorporated herein by reference in its entirety, in addition to the following references: Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18:1357-1364; Srinivasan et al., Methods MolBiol. 2012 820:105-116; Ben-Arie et al., Methods MolBiol. 2012 757:497-507; Peer 2010 J Control Release. 20:63-68; Peer et al., Proc Natl Acad Sci US A. 2007 104:4095-4100; Kim et al., Methods Mol Biol. 2011 721:339-353; Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat Biotechnol. 2005 23:709-717; Peer et al., Science. 2008 319:627-630; and Peer and Lieberman, Gene Ther. 2011 18:1127-1133.

[0440] In some implementations, tissue-specific activity is achieved by selecting LNPs by adding selective organ-targeting (SORT) molecules to formulations containing conventional components such as ionizable cationic lipids, amphiphilic phospholipids, cholesterol, and poly(ethylene glycol) (PEG) lipids. The teachings of Cheng et al., Nat Nanotechnol 15(4):313-320 (2020), demonstrate that the addition of supplemental “SORT” components can precisely alter the in vivo RNA delivery profile and mediate tissue-specific (e.g., lung, liver, spleen) gene delivery and editing based on the percentage and biophysical properties of SORT molecules.

[0441] In some embodiments, the LNP comprises a biodegradable, ionizable lipid. In some embodiments, the LNP comprises octadecane-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, also known as (9Z,12Z)-octadecane-9,12-dienoic acid)3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester or another ionizable lipid. See, for example, lipids of WO2019 / 067992, WO / 2017 / 173054, WO2015 / 095340 and WO2014 / 136086, and the references provided therein. In some implementations, the terms cationic and ionizable in the context of LNP lipids are interchangeable, for example, where ionizable lipids are cationic depending on pH.

[0442] In some embodiments, the average LNP diameter of the LNP formulation can be between 10 nm and 150 nm, for example, measured by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of the LNP formulation can be between 10 nm and 100 nm, for example, measured by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of the LNP formulation can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average LNP diameter of the LNP formulation can be about 70 nm to about 150 nm, about 80 nm to about 120 nm, about 80 nm to about 110 nm, about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average LNP diameter of the LNP formulation can be about 70 nm to about 100 nm. In a specific embodiment, the average LNP diameter of the LNP formulation can be about 80 nm. In some embodiments, the average LNP diameter of the LNP formulation can be about 100 nm. In some embodiments, the average LNP diameter of the LNP formulation ranges from about 1 mm to about 500 mm, from about 5 mm to about 200 mm, from about 10 mm to about 100 mm, from about 20 mm to about 80 mm, from about 25 mm to about 60 mm, from about 30 mm to about 55 mm, from about 35 mm to about 50 mm, or from about 38 mm to about 42 mm.

[0443] In some cases, LNPs may be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of LNPs, such as the particle size distribution of lipid nanoparticles. A smaller polydispersity index (e.g., less than 0.3) generally indicates a narrower particle size distribution. LNPs can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the LNP can be about 0.10 to about 0.20.

[0444] The zeta potential of a lipid nanoparticle (LNP) can be used to indicate the electrokinetic potential of the composition. In some embodiments, the zeta potential can describe the surface charge of the LNP. Lipid nanoparticles with relatively low charge (positive or negative) are generally desirable because more charged substances may interact undesirably with cells, tissues, and other elements in the body. In some implementations, the zeta potential of the LNP can be approximately -10mV to approximately +20mV, approximately -10mV to approximately +15mV, approximately -10mV to approximately +10mV, approximately -10mV to approximately +5mV, approximately -10mV to approximately 0mV, approximately -10mV to approximately -5mV, approximately -5mV to approximately +20mV, approximately -5mV to approximately +15mV, approximately -5mV to approximately +10mV, approximately -5mV to approximately +5mV, approximately -5mV to approximately 0mV, approximately 0mV to approximately +20mV, approximately 0mV to approximately +15mV, approximately 0mV to approximately +10mV, approximately 0mV to approximately +5mV, approximately +5mV to approximately +20mV, approximately +5mV to approximately +15mV, or approximately +5mV to approximately +10mV.

[0445] The encapsulation efficiency of proteins and / or nucleic acids (e.g., DNA or RNA, such as mRNA) encoding polypeptides describes the amount of protein and / or nucleic acid encapsulated or otherwise associated with LNPs after preparation, relative to the initial amount provided. High encapsulation efficiency (e.g., close to 100%) is desirable. For example, encapsulation efficiency can be measured by comparing the amount of protein or nucleic acid in a solution containing lipid nanoparticles before and after degradation with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid (e.g., RNA) in solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid (e.g., RNA) in solution. For the lipid nanoparticles described herein, the encapsulation efficiency of proteins and / or nucleic acids can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some implementations, the packaging efficiency can be at least 80%. In some implementations, the packaging efficiency can be at least 90%. In some implementations, the packaging efficiency can be at least 95%.

[0446] LNPs may optionally contain one or more coatings. In some embodiments, LNPs may be formulated in coated capsules, films, or tablets. Capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0447] Other specific LNP formulations for delivering nucleic acids are described in US8158601 and US8168775, both of which are incorporated herein by reference, including the formulation used in patisiran sold under the name ONPATTRO.

[0448] In some embodiments, the lipid nanoparticles (or formulations containing lipid nanoparticles) are lacking or contain less than a preselected level of reactive impurities (e.g., aldehydes or ketones). While not wishing to be bound by theory, in some embodiments, lipid reagents are used to manufacture lipid nanoparticle formulations, and these lipid reagents may contain contaminating reactive impurities (e.g., aldehydes or ketones). The lipid reagent used for manufacturing can be selected based on the level of the reactive impurity (e.g., aldehyde or ketone) being below a predetermined level. Without being bound by theory, in some embodiments, aldehydes can cause RNA modification and damage, such as cross-linking between bases and / or covalent conjugation of lipids to RNA (e.g., formation of lipid-RNA adducts). In some cases, this can lead to reverse transcription failure and / or incorporation of inappropriate bases, such as mutations at lesion sites, such as in newly synthesized target DNA.

[0449] In some embodiments, lipid nanoparticle formulations are produced using lipid reagents containing less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of a total reactive impurity (e.g., aldehyde). In some embodiments, lipid nanoparticle formulations are produced using lipid reagents containing less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of any single reactive impurity (e.g., aldehyde). In some embodiments, lipid nanoparticle formulations are produced using lipid reagents comprising: (i) total reactive impurities (e.g., aldehydes) less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%; and (ii) any single reactive impurity (e.g., aldehyde) less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%. In some embodiments, lipid nanoparticle formulations are produced using multiple lipid reagents, and each of the multiple lipid reagents independently meets one or more criteria described in this paragraph. In some embodiments, each of the multiple lipid reagents meets the same criteria, such as those described in this paragraph.

[0450] In some embodiments, the lipid nanoparticle formulation contains less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of total reactive impurities (e.g., aldehydes). In some embodiments, the lipid nanoparticle formulation contains less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of any single reactive impurity (e.g., aldehyde). In some embodiments, the lipid nanoparticle formulation comprises: (i) a total reactive impurity (e.g., aldehyde) content of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%; and (ii) any single reactive impurity (e.g., aldehyde) substance of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%.

[0451] In some embodiments, one or more, or optionally all, lipid reagents used in lipid nanoparticles or formulations thereof as described herein contain less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of total reactive impurities (e.g., aldehydes). In some embodiments, one or more, or optionally all, lipid reagents used in lipid nanoparticles or formulations thereof as described herein contain less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% of any single reactive impurity (e.g., aldehyde). In some embodiments, one or more or optionally all lipid reagents used for lipid nanoparticles or formulations thereof as described herein comprise: (i) a total reactive impurity (e.g., aldehyde) content of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%; and (ii) any single reactive impurity (e.g., aldehyde) substance of less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%.

[0452] In some embodiments, the total aldehyde content and / or the amount of any single reactive impurity (e.g., aldehyde) is determined by liquid chromatography (LC) (e.g., coupled with tandem mass spectrometry (MS / MS), for example, as described herein. In some embodiments, the content and / or amount of the reactive impurity (e.g., aldehyde) is determined by detecting one or more chemical modifications (e.g., in a lipid reagent) of a nucleic acid molecule (e.g., RNA molecule, for example, as described herein) associated with the presence of the reactive impurity (e.g., aldehyde). In some embodiments, the content and / or amount of the reactive impurity (e.g., aldehyde) is determined by detecting one or more chemical modifications (e.g., in a lipid reagent) of a nucleotide or nucleoside (e.g., ribonucleotide or ribonucleoside, for example, contained in or isolated from a template nucleic acid, for example, as described herein), associated with the presence of the reactive impurity (e.g., aldehyde). In the implementation scheme, chemical modifications of nucleic acid molecules, nucleotides, or nucleosides are detected by, for example, using LC-MS / MS analysis to determine the presence of one or more modified nucleotides or nucleosides, as described herein.

[0453] In some embodiments, lipid nanoparticles are liposomes or other similar vesicles. Liposomes are spherical vesicle structures consisting of a single or multiple lipid bilayers surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, capable of delivering hydrophilic and lipophilic drug molecules, protecting their cargo from degradation by plasma enzymes, and transporting their load across biological membranes and the blood-brain barrier (BBB) ​​(see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155 / 2011 / 469679).

[0454] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparing multilayered vesicular lipids are known in the art (see, for example, U.S. Patent No. 6,693,086, whose teachings relating to the preparation of multilayered vesicular lipids are incorporated herein by reference). While vesicles can form spontaneously when the lipid film is mixed with an aqueous solution, vesicle formation can also be accelerated by applying force in the form of shaking using a homogenizer, sonicator, or extrusion device (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155 / 2011 / 469679). Extruded lipids can be prepared by extrusion through a filter of reduced size, as described in Templeton et al., Nature Biotech, 15:647-652, 1997, where the teachings relating to the preparation of extruded lipids are incorporated herein by reference.

[0455] Surprisingly, it was found that increasing the amount of non-PEGylated phospholipids (e.g., DSPC) in the conjugates disclosed herein improves the delivery of payloads (e.g., mRNA) to cells of interest (e.g., T cells or HSCs). In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 7:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 4:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 3:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 2.5:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 2:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is from about 1.5:1 to about 2.5:1. In some embodiments, the ratio between ionizable lipids and non-PEGylated phospholipids (e.g., DSPC) is from about 2:1 to about 2.5:1.

[0456] Furthermore, an increased ratio of non-PEGylated phospholipids (e.g., DSPC) to cholesterol molecules in the conjugates disclosed herein can lead to increased delivery of payloads (e.g., mRNA) to cells of interest (e.g., T cells or HSCs). In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 6:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 3:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 2:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 1.5:1 to about 0.5:1. In some embodiments, the ratio between cholesterol molecules and non-PEGylated phospholipids (e.g., DSPC) is about 1:1 to about 0.5:1. In some implementations, the ratio between cholesterol molecules and non-polyethylene glycol-modified phospholipids (e.g., DSPC) is about 1:2 to about 0.8:1.

[0457] Lipids bound to the click handle

[0458] According to this disclosure, a click handle (i.e., a second click handle) can chemically react with lipid molecules to provide modified lipids capable of reacting with a complementary click handle (i.e., a first click handle), which has been site-specifically introduced into a target moiety (e.g., an antibody, a Fab fragment, or a ScFv). The click reaction between the first and second click handles can be completed before or after LNP formation. For example, in one embodiment ( Figure 22 Various components constituting an LNP (e.g., lipids) can be mixed with lipid molecules containing a second click handle to generate an LNP containing a second click handle. This LNP can then react in a click reaction with a targeting moiety (e.g., an antibody, Fab fragment, or ScFv) containing a first click handle to produce a conjugate. Alternatively, lipids modified with a second click handle can react directly with a first click handle that has been site-specifically introduced onto a targeting moiety (e.g., an antibody, Fab fragment, or ScFv). The resulting modified lipids can then be inserted into a pre-formed LNP that has not yet undergone surface modification. This procedure allows for click reactions to occur on a single lipid molecule rather than on the surface of the LNP.

[0459] The second click handle can be introduced onto any lipid constituting the LNP. In some embodiments, the conjugate may comprise one or more PEGylated lipid molecules. In some embodiments, the second click handle is covalently bonded to at least one PEGylated lipid molecule, thereby generating the structural lipid-PEG. x - Click handles, where x is 5-120. In such embodiments, the click product is formed by a reaction between a first click handle bonded to an antibody and a second click handle bonded to one or more polyethylene glycol-modified lipids constituting the LNP. In some embodiments, the LNP comprises about 0.05 mol% to about 2 mol% of polyethylene glycol-modified lipids bonded to the second click handle. In some embodiments, the PEG spacer between the lipid and the second click handle comprises at least about 5, 10, 20, 30, 50, 50, 60, 70, 80, 90, 200, or 110 ethylene glycol units. In some embodiments, the PEG spacer comprises about 10-120 ethylene glycol units. In some embodiments, the polyethylene glycol-modified lipids bonded to the second click handle have a molecular weight of about 500 (i.e., PEG500) to about 5,000 (i.e., PEG5000). In some embodiments, the PEGylated lipid bonded to the second click handle has a molecular weight of about 1,000 (i.e., PEG1000) to about 3,000 (i.e., PEG5300). In some embodiments, the lipid component of the PEGylated lipid bonded to the second click handle is selected from DMG, DPG, DSG, DTA, DOPE, DPPE, DMPE, DSPE, sphingosine, sphingomyelin, and stearic acid. Figure 3Examples of polyethylene glycol-modified lipids bonded to a second click handle (TCO) are shown.

[0460] In some implementations, the second click handle is bonded to at least one non-polyethylene glycol phospholipid constituting the LNP. Figure 4 Examples of non-PEGylated lipids bonded to a second click handle (TCO) are shown.

[0461] In some implementations, the second click handle is bonded to at least one ionizable lipid constituting the LNP. Figure 5 Examples of ionizable lipids bonded to a second click handle (TCO) are shown.

[0462] In some implementations, the second click handle is bonded to at least one sterol molecule constituting the LNP. Figure 6 Examples of sterols bonded to a second click handle (TCO) are shown.

[0463] Example

[0464] Example 1: Anti-CD3 Fab Modification and Analysis

[0465] An anti-CD3 Fab fragment was generated, with a sorting enzyme tag (LPETG (SEQ ID NO:89)) at the C-terminus of its heavy chain. 10 μM of anti-CD3 Fab-LPETG and 1 mM glycine methyltetraazine (GGG-meTz) were prepared in sorting enzyme buffer (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, pH 7.4). Then, sorting enzyme A5 (2 μM) was added to initiate the transpeptidation reaction. Figure 7 The above solution was incubated at 30°C with shaking at 800 rpm for 3 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 mM EDTA through a 10K Amicon centrifuge filter. Metz-modified Fab was analyzed using full-spectrum mass spectrometry.

[0466] The sorting enzyme-modified Fab was analyzed using full-scale mass spectrometry. Modification occurred only at the C-terminus of Fab, and successful modification resulted in a 363 Da mass transfer. Figure 8 As shown, the sorting enzyme-mediated reaction achieved approximately 92% site-specific modification (i.e., 92% of the Fab fragments were modified by the sorting enzyme tag).

[0467] Example 2: Degree of modification and labeling (DOL) of Fab fragments conjugated using sorting enzyme-mediated conjugation.

[0468] Different Fab fragments (anti-CD117, anti-CD3, and anti-CD5) with an asortase tag (LPETG (SEQ ID NO:89)) at the C-terminus of the heavy chain were generated. For each Fab, 10 μM Fab-LPETG and 1 mM triglycine methyltetraazine (GGG-meTz) were prepared in sorting enzyme buffer (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, pH 7.4). Sorting enzyme A5 (2 μM) was then added to initiate the reaction. The above solutions were incubated at 30 °C with shaking at 800 rpm for 3 h. Excess reagents were removed, and the buffer was replaced with PBS containing 10 mM EDTA through a 10K Amicon centrifuge filter. For DOL analysis, the meTz-modified Fab was reacted with 5 eq AF594 containing a TCO group in PBS at room temperature for 2 h. After the reaction, excess dye was removed by two runs through a Zeba desalting column. DOL is measured using a DOL calculator by measuring absorbance at A280 and A590.

[0469] As a control, the experiment aimed to generate randomly designed antibodies. The buffer was concentrated to approximately 5 mg / ml, and the buffer was exchanged for PBS using an Amicon centrifugal filter (MWCO of 50 K for IgG). Then, NHS ester containing meTz was added, and the reaction was incubated at room temperature for 1 hour. After the reaction, excess NHS ester was removed using a Zeba desalting column. To analyze DOL, NHS ester-modified IgG was reacted with 5 eq AF594 containing TCO groups in PBS at room temperature for 2 hours. After the reaction, excess dye was removed by two runs using a Zeba desalting column. DOL was measured using a DOL calculator by absorbance at A280 and A590.

[0470] Table 11 shows the results for Fab fragments with different modifications, where the Fab fragments were prepared using site-specific modifications based on sorting enzymes. The results indicate that the DOL values ​​produced by site-specific modifications are close to the target (DOL = 1). Table 12 shows the experimental results for random modifications of the antibody using the NHS ester reaction. The results in Tables 11 and 12 show that the DOL values ​​produced by site-specific modifications using the sorting enzyme-based method are closer to the target (DOL = 1), and the standard deviations are much smaller than those using the random modification method (0.0045 vs. 0.266).

[0471] Table 11: Labeling levels of sorting enzyme / meTz-modified Fab fragments and click chaperone reactions after reaction

[0472] Date of experiment Ab construct DOL 1 Anti-CD117-1 Fab Sortase 1.01 2 Anti-CD117-1 Fab Sortase 1.02 3 Anti-CD117-1 Fab Sortase 0.99 4 Anti-CD3 Fab Sortase 0.93 5 Anti-CD5 Fab Sortase 1.04

[0473] Table 12: Labelling degree of randomly modified antibodies (randomly attached meTz groups) after reaction with click chaperone

[0474] Date of experiment Ab construct DOL 1 Anti-CD117 IgG 0.84 2 Anti-CD117 IgG 01.33 3 Anti-CD5 IgG 0.83 4 Anti-CD117 IgG 0.6 5 Anti-CD117 IgG 0.88

[0475] Example 3: Transfection of site-specific modified LNPs in T cells

[0476] Production of LNP without anti-CD5 antibody (LNP-TCO, unconjugated): An ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:8%:43.5%:1%:0.5%. An aqueous phase consisted of mRNA encoding green fluorescent protein (eGFP) dissolved in 25 mM acetate buffer. The two phases were mixed using a microfluidic apparatus to prepare LNP-TCO at a total flow rate of 18 ml / min (aqueous phase:ethanol phase = 3:1). Three volumes of CBS were added to the LNP solution, and the resulting solution was neutralized after 15 minutes with 1% (v / v) 1M Tris-HCl, pH 8. The resulting LNP was dialyzed overnight with storage buffer (50 mM Tris-HCl, 50 mM NaCl, 9% sucrose, pH 7.2) and concentrated using an Amicon centrifugal filter (50 K MWCO).

[0477] Generation of LNPs with anti-CD5 IgG (randomly conjugated): Anti-CD5 IgG was concentrated to approximately 5 mg / ml, and the buffer was exchanged with PBS using an Amicon centrifugal filter (MWCO of IgG: 50 K). NHS ester containing meTz was then added, and the reaction was incubated at room temperature for 1 hour. After the reaction, excess NHS ester was removed by passing it through a Zeba desalting column. To confirm that each antibody was close to 1 meTz in DOL (dopylene oxidase level), the NHS ester-modified anti-CD5 IgG was reacted with 5 eq AF594 containing a TCO group in PBS at room temperature for 2 hours. After the reaction, excess dye was removed by two runs through a Zeba desalting column. DOL was measured using a DOL calculator by absorbance at A280 and A590. The resulting meTz-modified anti-CD5 IgG was added to a TCO-modified LNP solution for antibody-LNP conjugation, with a mass ratio of antibody to mRNA (eGFP) of 1.5:1. The solution was incubated at room temperature for 2 hours, followed by overnight incubation at 4°C. Any unreacted anti-CD5 IgG was removed through a 300K MPES TFF membrane, and the resulting antibody-LNP product was further concentrated using an Amicon column.

[0478] Generation of LNPs (site-specific conjugations) with anti-CD5 Fab: Anti-CD5 Fab was generated using an additional sorting enzyme tag (LPETG (SEQ ID NO: 89)) on the C-terminus of the heavy chain. 10 μM anti-CD5 Fab-LPETG and 1 mM triglycine methyltetraazine (GGG-meTz) were prepared in sorting enzyme buffer (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, pH 7.4). Then, 2 μM sorting enzyme A5 was added to initiate the reaction. The solution was incubated at 30 °C with shaking at 800 rpm for 3 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 mM EDTA through a 10K Amicon centrifuge filter. To confirm that each antibody was close to 1 meTz in DOL (dosage level of labeling), the sorting enzyme-modified anti-CD5 Fab was reacted with 5 eq AF594 containing a TCO group in PBS at room temperature for 2 hours. After the reaction was complete, excess dye was removed by two runs of a Zeba desalting column. DOL was measured using a DOL calculator at absorbance at A280 and A590. The resulting meTz-modified anti-CD5 Fab was added to a TCO-modified LNP solution for Fab-LNP conjugation, with a 1:1 mass ratio of Fab to mRNA (eGFP). The solution was incubated at room temperature for 2 hours, followed by overnight incubation at 4°C. Any unreacted anti-CD5 Fab was removed using a 300K MPES TFF membrane. The resulting Fab-LNP product was further concentrated using an Amicon column.

[0479] Transfection assay: Activated and inactivated human T cells were treated with a control LNP lacking the anti-CD5 targeting moiety or a conjugate containing the targeting moiety (sortase-mediated site-specific conjugate anti-CD5 Fab LNP or randomly conjugated anti-CD5 IgG LNP), the conjugates being generated as described above. After 24 hours of treatment, the percentage of cells expressing GFP (%GFP+) was determined by flow cytometry. Figure 9A and Figure 9C ) and GFP expression level (median fluorescence intensity, MFI) Figure 9B and Figure 9D The mRNA transfection efficacy was quantified using [a specific method / method]. Results showed that in both activated and inactivated T cells, site-specific LNPs labeled with anti-CD5 Fab induced stronger transfection than LNPs randomly labeled with anti-CD5 IgG. Control LNPs lacking the anti-CD5 targeting moiety were the least effective at delivering GFP mRNA to both activated and inactivated cells.

[0480] Example 4: Transfection of site-specific modified LNPs in CD34+ cells

[0481] Production of antibody-free LNP (LNP-TCO, unconjugated): An ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:8%:43.5%:1%:0.5%. The aqueous phase consisted of mRNA (encoding eGFP) dissolved in 25 mM acetate buffer. The two phases were mixed using a microfluidic apparatus to prepare LNP-TCO at a total flow rate of 18 ml / min (aqueous phase:ethanol phase = 3:1). Three volumes of CBS were added to the LNP solution, and the resulting solution was neutralized after 15 minutes with 1% (v / v) 1M Tris-HCl, pH 8. The resulting LNP was dialyzed overnight with storage buffer (50 mM Tris-HCl, 50 mM NaCl, 9% sucrose, pH 7.2) and concentrated using an Amicon centrifugal filter (50 K MWCO).

[0482] Generation of LNPs with NHS-modified (randomly conjugated) anti-CD117 IgG: Anti-CD117 IgG was concentrated to approximately 5 mg / ml, and the buffer was exchanged with PBS using an Amicon centrifugal filter (MWCO of IgG: 50 K). NHS ester containing meTz was then added, and the reaction was incubated at room temperature for 1 hour. After the reaction, excess NHS ester was removed by passing it through a Zeba desalting column. To confirm that each antibody was close to 1 meTz in DOL (dopylene oxidase level), the NHS ester-modified anti-CD117 IgG was reacted with 5 eq AF594 containing a TCO group in PBS at room temperature for 2 hours. After the reaction, excess dye was removed by two runs through a Zeba desalting column. DOL was measured using a DOL calculator by absorbance at A280 and A590. The resulting meTz-modified anti-CD117 IgG was added to the TCO-modified LNP solution as described above for antibody-LNP conjugation, with a mass ratio of antibody to mRNA (encoding eGFP) of 1.5:1. The solution was incubated at room temperature for 2 hours, followed by overnight incubation at 4°C. Any unreacted anti-CD117 IgG was removed through a 300K MPES TFF membrane, and the resulting antibody-LNP product was further concentrated using an Amicon column.

[0483] Generation of LNPs (site-specific conjugations) with anti-CD117 Fab: Anti-CD117 Fab with an additional sorting enzyme tag (LPETG (SEQ ID NO:89)) at the C-terminus of the heavy chain was generated. 10 μM anti-CD117 Fab-LPETG and 1 mM triglycine methyltetraazine (GGG-meTz) were prepared in sorting enzyme buffer (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, pH 7.4). Then, 2 μM sorting enzyme A5 was added to initiate the reaction. The solution was incubated at 30 °C with shaking at 800 rpm for 3 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 mM EDTA through a 10K Amicon centrifuge filter. To confirm that each antibody was close to 1 meTz in DOL (dosage level of labeling), the sorting enzyme-modified anti-CD117 Fab was reacted with 5 eq AF594 containing a TCO group in PBS at room temperature for 2 hours. After the reaction was complete, excess dye was removed by two runs of a Zeba desalting column. DOL was measured using a DOL calculator at absorbance at A280 and A590. The resulting meTz-modified anti-CD117 Fab was added to a TCO-modified LNP solution (prepared as above) for Fab-LNP conjugation, with a 1:1 mass ratio of antibody to mRNA (encoding eGFP). The solution was incubated at room temperature for 2 hours, followed by overnight incubation at 4°C. Any unreacted anti-CD117 Fab was removed using a 300K MPES TFF membrane. The resulting Fab-LNP product was further concentrated using an Amicon column.

[0484] Transfection assay: Human CD34+ cells were treated with anti-CD117 IgG-LNP, anti-CD117 Fab-LNP, or naked LNP (antibody-free). The efficacy of mRNA transfection was quantified after 8 hours of treatment. Specifically, flow cytometry was used to assess the percentage of CD34+ cells expressing GFP (%GFP+ cells). Figure 10A ) and the median fluorescence intensity (MFI) of GFP ( Figure 10B Compared to LNPs with randomly conjugated anti-CD117 IgG, LNPs with site-specific conjugated anti-CD117 Fab induced stronger transfection and higher MFI in CD34+ cells. Both conjugated anti-CD117 LNPs (site-specific and randomly conjugated) induced stronger transfection and higher MFI levels in CD34+ cells compared to control LNPs without conjugated anti-CD117 targeting moieties.

[0485] Example 5: Comparison of LNPs decorated with Fab fragments by random modification and site-specific modification (sorting enzyme method)

[0486] Production of Fab-free LNP (LNP-TCO): An ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:8%:43.5%:1%:0.5%. The aqueous phase consisted of mRNA (encoding eGFP) dissolved in 25 mM acetate buffer. The two phases were mixed using a microfluidic apparatus to prepare LNP-TCO at a total flow rate of 18 ml / min (aqueous phase:ethanol phase = 3:1). Three volumes of CBS were added to the LNP solution, and the resulting solution was neutralized after 15 minutes with 1% (v / v) 1M Tris-HCl, pH 8. The resulting LNP was dialyzed overnight with storage buffer (50 mM Tris-HCl, 50 mM NaCl, 9% sucrose, pH 7.2) and concentrated using an Amicon centrifugal filter (50 K MWCO).

[0487] The generation of LNPs (site-specific conjugations) with anti-CD117 Fab ( Figure 11A Anti-CD117 Fab was generated using an additional sorting enzyme tag (LPETG (SEQ ID NO:89)) on the C-terminus of the heavy chain. 10 μM anti-CD117 Fab-LPETG and 1 mM triglycine methyltetraazine (GGG-meTz) were prepared in sorting enzyme buffer (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, pH 7.4). Then, 2 μM sorting enzyme A5 was added to initiate the reaction. The solution was incubated at 30 °C with shaking at 800 rpm for 3 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 mM EDTA through a 10K Amicon centrifuge filter. To confirm that each antibody was close to 1 meTz in DOL (labeling degree), the sorting enzyme-modified anti-CD117 Fab was reacted with 5 eq AF594 containing a TCO group in PBS at room temperature for 2 hours. After the reaction, excess dye was removed by two runs through a Zeba desalting column. DOL was measured using a DOL calculator via absorbance at A280 and A590. The resulting meTz-modified anti-CD117 Fab was added to the TCO-modified LNP solution described above for Fab-LNP conjugation, with a 1:1 mass ratio of antibody to mRNA (encoding eGFP). The solution was incubated at room temperature for 2 hours, followed by overnight incubation at 4°C. Any unreacted anti-CD117 Fab was removed using a 300K MPES TFF membrane. The resulting Fab-LNP product was further concentrated using an Amicon column. Figure 9A As shown, a site-specific sorting enzyme method that conjugates the target portion to the LNP produces the LNP, in which only the C-terminal residues of the conjugated Fab fragment bind to the LNP.

[0488] Generation of LNPs (random concatenations) with resistance to CD117 Fab ( Figure 11B Anti-CD117 Fab was concentrated to approximately 5 mg / ml, and the buffer was exchanged for PBS using an Amicon centrifugal filter (MWCO of 50 K for IgG). Then, NHS ester containing meTz was added, and the reaction was incubated at room temperature for 1 hour. After the reaction, excess NHS ester was removed using a Zeba desalting column. To confirm that each antibody was close to 1 meTz in DOL (dopylene oxidase level), the NHS ester-modified anti-CD117 Fab was reacted with 5 eq AF594 containing a TCO group in PBS at room temperature for 2 hours. After the reaction, excess dye was removed by two runs using a Zeba desalting column. DOL was measured using a DOL calculator by absorbance at A280 and A590. The resulting meTz-modified anti-CD117 Fab was added to the aforementioned TCO-modified LNP solution for Fab-LNP conjugation, with a mass ratio of antibody to mRNA (encoding eGFP) of 1.5:1. The solution was incubated at room temperature for 2 hours, then overnight at 4°C. Any unreacted anti-CD117Fab was removed using a 300K MPESTFF membrane, followed by further concentration of the resulting Fab-LNP product using an Amicon column. Figure 9B As shown, a random modification method that conjugates the target portion with an LNP produces LNPs in which different amino acid residues of the Fab fragment are conjugated with LNPs.

[0489] Transfection assay: Kasumi-1 cells (CD117+ cell line) were treated with LNPs conjugated with randomly modified Fab, site-specific modified Fab, or no Fab. The efficacy of mRNA transfection was quantified after 8 hours of treatment. Specifically, the percentage of cells expressing GFP (%GFP+ cells) was assessed using flow cytometry. Figure 12A ) and the median fluorescence intensity (MFI) of GFP ( Figure 12B Compared to LNPs with random conjugation of anti-CD117 Fab, site-specific conjugated anti-CD117 Fab LNPs induced stronger transfection and higher MFI in Kasumi-1 cells. Both types of conjugated anti-CD117 Fab LNPs (site-specific and random conjugated) induced stronger transfection and higher MFI levels in cells compared to LNPs without conjugated anti-CD117 targeting moieties.

[0490] Example 6: In vivo experiment (mouse) - Specific targeting of LNP (sorting enzyme method) and non-specific targeting of LNP to deliver GFP mRNA to HSC

[0491] Production of Fab-free LNP (LNP-TCO): An ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:8%:43.5%:1%:0.5%. An aqueous phase consisted of GFP-encoding mRNA dissolved in 25 mM acetate buffer. The two phases were mixed using a microfluidic apparatus to prepare LNP-TCO at a total flow rate of 18 ml / min (aqueous phase:ethanol phase = 3:1). Three volumes of CBS were added to the LNP solution, and the resulting solution was neutralized after 15 minutes with 1% (v / v) 1M Tris-HCl, pH 8. The resulting LNP was dialyzed overnight with storage buffer (50 mM Tris-HCl, 50 mM NaCl, 9% sucrose, pH 7.2) and concentrated using an Amicon centrifugal filter (50 K MWCO).

[0492] Generation of LNPs (site-specific conjugations) with Fab 1, Fab 5, and Fab 6: Different Fabs (Fab 1, Fab 5, and Fab 6) with an additional sorting enzyme tag (LPETG (SEQ ID NO:89)) at the C-terminus of the heavy chain were generated, each specific to CD117. 10 μM anti-CD117 Fab-LPETG and 1 μM triglycine methyltetraazine (GGG-meTz) were prepared in sorting enzyme buffer (50 Mm Tris, 150 Mm NaCl, 10 Mm CaCl2, pH 7.4). Then, 2 μM sorting enzyme A5 was added to initiate the reaction. The solution was incubated at 30 °C with shaking at 800 rpm for 3 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 Mm EDTA through a 10 kAmicon centrifuge filter. To confirm the DOL (diolate concentration) of each antibody close to 1 meTz, meTz-modified Fab was reacted with 5 eq AF594 containing TCO groups in PBS at room temperature for 2 hours. After the reaction, excess dye was removed by two runs of a Zeba desalting column. DOL was measured using a DOL calculator by absorbance at A280 and A590. The resulting meTz-modified Fab was added to a TCO-modified LNP solution for Fab-LNP conjugation, with a 1:1 mass ratio of antibody to RNA (encoding GFP). The solution was incubated at room temperature for 2 hours, followed by overnight incubation at 4°C. Any unreacted Fab was removed using a 300K MPES TFF membrane. The resulting Fab-LNP product was further concentrated using an Amicon column.

[0493] Administered to mice: NBSGW mice transplanted with human HSPCs (>12 weeks) were intravenously injected with anti-CD117 Fab-functionalized LNPs (LNPs containing Fab 6, Fab 5, or Fab 1) or non-functionalized LNPs carrying GFP-encoding Mrna (basic LNPs as described above, without anti-CD117 Fab conjugation). Mice were sacrificed 16 hours after administration, and bone marrow cells were collected for staining. HSCs and early progenitor cells (HSPCs) were defined as Hcd45+ / Lin- / CD34+ / CD38-, while long-term HSCs (LT-HSCs) were defined as Hcd45+ / Lin- / CD34+ / CD38- / CD90+ / CD45RA-.

[0494] result: Figure 13A The results showed that up to 58% of HSCs plus early progenitor cells received LNPs with a Fab fragment modified with sorting enzyme, while 20% of HSCs plus early progenitor cells received basal LNPs, as determined by the percentage of cells expressing GFP (%GFP+ cells). Control mice not exposed to LNPs did not show GFP expression. Figure 13B The results showed that up to 62% of long-term (LT)-HSCs received LNPs with sorting enzyme-modified Fab fragments, compared to slightly over 20% of LT-HSCs exposed to basal LNPs. Therefore, LNPs with sorting enzyme-modified Fab fragments exhibited significantly higher in vivo transfection levels in both HSCs plus early progenitor cells and LT-HSCs, compared to LNPs without site-specific conjugation to anti-CD117 Fab fragments. Furthermore, as... Figure 13C As shown, there is a good correlation between in vitro transduction of primary HSPC and in vivo targeting of HSPC. Figure 13C As shown, there is separation between nonspecific IgG and site-specific conjugated (sorting enzyme method) Fab LNPs.

[0495] Example 7: In vivo experiment (mice) – Targeted delivery of LNP (sorting enzyme method) containing an alternative agent to HSCs

[0496] Production of Fab-free LNP (LNP-TCO) (LNP A): An ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:22%:28.5%:2%:0.5%. Compared to the LNP prepared in Example 6, the LNP contained an increased percentage of accessory lipids (DSPC) and a decreased percentage of cholesterol (22% and 8% DSPC, respectively). The aqueous phase consisted of GFP-encoding RNA dissolved in 25 M acetate buffer. The two phases were mixed using a microfluidic apparatus to prepare LNP-TCO at a total flow rate of 18 ml / min (aqueous phase:ethanol phase = 3:1). Three volumes of CBS were added to the LNP solution, and the resulting solution was neutralized after 15 min with 1 volume% 1 M Tris-HCl, pH 8. The obtained LNP was dialyzed overnight with storage buffer (50 Mm Tris-HCl, 50 Mm NaCl, 9% sucrose, pH 7.2) and concentrated using an Amicon centrifugal filter (50 K MWCO).

[0497] Generation of LNP with anti-CD117 Fab (LNP B): LNP conjugated with anti-CD117 Fab is generated as described in Example 6, but with the molar ratio of ionizable lipid (VO003), DSPC, cholesterol, DMG-PEG and DSPE-PEG2K-TCO being 47%:22%:28.5%:2%:0.5%.

[0498] Administer to mice: 0.5 x 10 6 CD34+ human bone marrow hematopoietic stem cells were transplanted into 8-10 week old NBSGW mice via tail vein injection (NOD.Cg-Kit). W-41J Tyr + Prkdc scid Il2rg tm1Wjl / ThomJ). HSPCs were allowed to transplant for 12 weeks, then three animals were treated via tail vein injection with either LNP A (without conjugated Fab fragments) or LNP B (with conjugated anti-CD117 Fab) at 2.0 mg / kg. Sixteen hours post-injection, the treated cohort and one untreated cohort were euthanized, and femoral bone marrow was collected by centrifugation. Cells were stained and analyzed by FACS to determine the percentage of human HSPCs positive for GFP protein expression.

[0499] result: Figure 14The results showed that LNP A (without anti-CD117 Fab) delivered GFP Mrna to approximately 38% of human HSPCs in mice, while LNP B (conjugated with anti-CD117 Fab) delivered GFP Mrna to approximately 82% of human HSPCs in mice. These results indicate that the conjugates of this disclosure with a targeting motif can deliver Mrna to more HSPCs in the bone marrow microenvironment compared to conjugates without a targeting motif. Surprisingly, increasing the percentage of accessory lipids in the LNP to 22% resulted in a significant increase in GFP delivered to HSPCs compared to LNPs with 8% DSPC (compare results with Example 6, ...). Figure 13A (Comparison)

[0500] Example 8 In vivo experiment (non-human primates) - Targeted LNP (sorting enzyme method) delivery of GFP mRNA to HSC

[0501] This embodiment demonstrates that the conjugate of this disclosure can deliver a GFP mRNA payload to the HSC of cynomolgus monkeys.

[0502] To modify anti-CD117 Fab with a click handle methyltetrazine (meTz), anti-CD117 Fab with an additional sorting enzyme tag (LPETG (SEQ ID NO:89)) at the C-terminus of the heavy chain was generated. 10 μL of CD117 Fab-LPETG and 1 μL of triglycine meTz were prepared in sorting enzyme buffer (50 Mm Tris, 150 Mm NaCl, 10 Mm CaCl2, pH 7.4). Then, 2 μL of sorting enzyme A5 was added to initiate the reaction. The solution was incubated at room temperature with shaking at 800 rpm for 4 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 μL of EDTA through tangential flow filtration (10 K MWCO).

[0503] To prepare LNPs with a click handle TCO, an ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:8%:42.5%:2%:0.5%. An aqueous phase consisted of Egfp mRNA dissolved in 25 M acetate buffer. The two phases were mixed using a multi-inlet vortex mixer (MIVM) at a total flow rate of 120 mL / min (aqueous phase:ethanol phase = 3:1) to prepare the LNP-TCO. The resulting LNPs were diluted online with 3 volumes of CBS. After 15 minutes, the resulting solution was neutralized with 1% (v / v) 1 M Tris-HCl, Ph 8. Following neutralization, modified anti-CD117 Fab was added to the solution (Fab:mRNA = 1:1 weight ratio), and the TCO-modified LNPs were reacted with the solution at room temperature for 2 hours, followed by overnight incubation at 4°C. Following the overnight reaction, tangential flow filtration (300 K MWCO) was performed to exchange the buffer for storage buffer (50 Mm Tris-HCl, 50 Mm NaCl, 9% sucrose, pH 7.2), concentrating the Fab-LNP to the desired concentration and removing any unreacted Fab. The final Fab-conjugated LNP was stored at -80°C until further use.

[0504] Cynomolgus monkeys aged 3–5 years were pretreated to mobilize bone marrow hematopoietic stem cells (HSCs) into peripheral blood (NHP#3 and #4) or without HSC mobilization (NHP#1 and #2). To mobilize HSCs, animals were treated with G-CSF from day -4 to day 1 prior to LNP infusion, and with Plerixa for one hour on day 1. All animals were treated with dexamethasone, famotidine, and diphenhydramine on day 1, followed by LNP infusion one hour later. Sixteen hours after LNP infusion, animals were anesthetized and bone marrow aspirate was collected from the humerus. After hypotonic lysis of erythrocytes, the remaining bone marrow cells were stained and analyzed by FACS to determine the percentage of HSCs positive for GFP protein expression.

[0505] Figure 15 This demonstrates that the illustrative LNP delivers GFP mRNA to over 20% of HSPCs. These results indicate that the conjugates disclosed herein can deliver mRNA to HSPCs within the NHP bone marrow microenvironment.

[0506] Example 9: In vivo experiment (mouse) - Targeted LNP (sorting enzyme method) delivery of GFP mRNA to human T cells of "humanized" mice

[0507] This embodiment demonstrates that the conjugate of this disclosure can deliver GFP Mrna into human T cells in a humanized mouse model.

[0508] To modify anti-CD3 and anti-CD5 Fab with click handle methyltetrazine (meTz), a Fab fragment with an additional sorting enzyme tag (LPETG (SEQ ID NO:89)) at the C-terminus of the heavy chain was generated. 10 μM Fab-LPETG and 1 mM triglycine meTz were prepared in sorting enzyme buffer (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, pH 7.4). Then, 2 μM sorting enzyme A5 was added to initiate the reaction. The solution was incubated at room temperature with shaking at 800 rpm for 4 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 mM EDTA via an Amicon column (10K MWCO).

[0509] To prepare LNPs with a click handle TCO, an ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:8%:42.5%:2%:0.5%. The aqueous phase consisted of eGFP mRNA dissolved in 25 mM acetate buffer. The two phases were mixed using a microfluidic apparatus at a total flow rate of 18 ml / min (aqueous phase:ethanol phase = 3:1) to prepare the LNP-TCO. Three volumes of CBS were added to the LNP solution, and the resulting solution was neutralized after 15 minutes with 1% (v / v) 1M Tris-HCl, pH 8. After neutralization, modified anti-CD3 or anti-CD5 Fab was added to the solution (Fab:mRNA = 1:1 weight ratio), and the TCO-modified LNPs were reacted with the solution at room temperature for 2 hours, followed by overnight incubation at 4°C. Following the overnight reaction, tangential flow filtration (300 K MWCO) was performed to exchange the buffer for storage buffer (50 mM Tris-HCl, 50 mM NaCl, 9% sucrose, pH 7.2), concentrating the Fab-LNP to the desired concentration and removing any unreacted Fab. The final Fab-conjugated LNP was stored at -80°C until further use.

[0510] Nine-week-old female NSG mice were obtained from Jackson Labs (Bar Harbor, ME). After acclimatizing in the animal enclosure for a few days, the animals were injected with 5 x 10^6 mg of NSG via the tail vein. 6Immature human T cells (Hemacare, Northridge, CA) were used to induce graft-versus-host disease (GVHD). Human cells involved in the GVHD response were activated against mouse antigens, proliferated, and secreted human cytokines measurable in mouse serum. Two weeks after T cell injection, animals in each group were either left untreated or treated via tail vein injection of LNP A (with anti-CD3 Fab) and LNP B (with anti-CD5 Fab) containing GFP mRNA (1 mg / kg or 2 mg / kg). Sixteen hours after treatment, the animals were euthanized, and GFP protein expression in huCD45+ T cells of their spleen was analyzed by FACS.

[0511] Figure 16 The images show that LNP A (with anti-CD3 Fab) and LNP B (with anti-CD5 Fab) delivered GFP mRNA to huCD45+ T cells in the spleen of 78% and 84% humanized NSG mice, respectively. These data demonstrate that the exemplary LNPs deliver RNA to human lymphocytes located within secondary lymphoid tissue.

[0512] Example 10: LNP delivery of GFP mRNA to CD3+ T cells in peripheral blood and lymphoid tissue of non-human primates

[0513] This embodiment demonstrates that the conjugate of this disclosure can deliver a GFP mRNA payload to peripheral blood lymphocytes of cynomolgus monkeys.

[0514] To modify anti-CD5 Fab with a click handle methyltetraazine (meTz), Fab with an additional sorting enzyme tag (LPETG (SEQ ID NO:89)) at the C-terminus of the heavy chain was generated. 10 μM Fab-LPETG and 1 mM triglycine meTz were prepared in sorting enzyme buffer (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, pH 7.4). Then, 2 μM sorting enzyme A5 was added to initiate the reaction. The above solution was incubated at room temperature with shaking at 800 rpm for 4 hours. Excess reagents were removed, and the buffer was replaced with PBS containing 10 mM EDTA by tangential flow filtration (10 K MWCO).

[0515] To prepare LNPs with a click handle TCO, an ethanol phase was prepared using five lipids containing ionizable lipids (V003), DSPC, cholesterol, DMG-PEG, and DSPE-PEG2K-TCO in a molar ratio of 47%:8%:42.5%:2%:0.5%. An aqueous phase consisted of eGFP mRNA dissolved in 25 mM acetate buffer. The two phases were mixed using a multi-inlet vortex mixer (MIVM) at a total flow rate of 120 ml / min (aqueous phase:ethanol phase = 3:1) to prepare the LNP-TCO. The resulting LNPs were diluted online with 3 volumes of CBS. After 15 minutes, the solution was neutralized with 1% (v / v) 1M Tris-HCl, pH 8. After neutralization, modified anti-CD5 Fab was added to the solution (Fab:mRNA = 1:1 weight ratio), and the TCO-modified LNPs were reacted with the solution at room temperature for 2 hours, followed by overnight incubation at 4°C. Following the overnight reaction, tangential flow filtration (300 K MWCO) was performed to exchange the buffer for storage buffer (50 mM Tris-HCl, 50 mM NaCl, 9% sucrose, pH 7.2), concentrating the Fab-LNP to the desired concentration and removing any unreacted Fab. The final Fab-conjugated LNP was stored at -80°C until further use.

[0516] A cynomolgus macaque of approximately 5 years was treated with dexamethasone, famotidine, and diphenhydramine on day 1, followed by an infusion of LNP one hour later. Subsequently, the animal was treated with 1 mg / kg of T-cell-specific LNP via intravenous infusion as described above. Sixteen hours after the LNP infusion, the animal was anesthetized, and peripheral blood samples and lymph node biopsies were collected and analyzed by FACS to determine the percentage of GFP-positive CD3+ T cells in each compartment.

[0517] Figure 17 The illustrated conjugates demonstrate that they deliver GFP mRNA to approximately 10% and approximately 37% of CD3+ T cells in lymph nodes and peripheral blood, respectively. These results indicate that the disclosed conjugates can deliver mRNA to T cells in both peripheral blood and secondary lymphoid tissues.

[0518] Example 11: LNP delivery of GFP mRNA to non-human primate peripheral blood T cells (CD4+ and CD8+)

[0519] The LNP was prepared and formulated as described in Example 10, except that the LNP was conjugated to an anti-CD3Fab fragment. Two approximately 5-year-old cynomolgus monkeys were treated with famotidine and diphenhydramine on day 1, followed by LNP infusion one hour later. The animals were then treated with an IV infusion of 1 mg / kg of the anti-CD3Fab-modified T-cell-specific LNP. Sixteen hours after LNP infusion, the animals were anesthetized, and peripheral blood samples were collected and analyzed by FACS to determine the percentage of T cells (including CD4+ and CD8+ T cells) positive for GFP protein expression. Total T cells were defined as CD45+CD3+CD5+. CD4+ and CD8+ T cells were defined as CD45+CD3+CD5+CD4+ and CD45+CD3+CD5+CD8+, respectively.

[0520] Figure 18 The illustrative conjugates demonstrate that they effectively deliver GFP mRNA to CD4+ T cells and CD8+ T cells in the peripheral blood of NHP. Following administration of the conjugates containing a site-specific conjugate targeting anti-CD3 moiety, an average of over 20% of CD4+ T cells expressed GFP, and an average of approximately 60% of CD8+ T cells expressed GFP.

[0521] Example 12: Evaluation of different click chemistry reactions between conjugated antibodies and LNPs

[0522] The purpose of this experiment was to evaluate the efficiency of conjugating antibodies to LNPs using the disclosed method to produce the conjugates described herein. Conjugation efficiency was determined by quantifying the conjugated and unconjugated antibodies using a fluorescence-based method. If the conjugation efficiency is 80%, then when 100 antibodies react in each LNP, the final conjugate will contain 80 antibodies per LNP. Increasing the conjugation efficiency increases the antibody density on the LNP surface (…). Figure 19A High antibody density (the number of antibodies per LNP) is advantageous for targeting specific cell types. Higher conjugation efficiency can facilitate the production of LNPs with high antibody density.

[0523] Different click chemistry pairs (azide-BCN, azide-DBCO, Tz-TCO, and meTz-TCO) were evaluated. Figure 19B To determine which pairings yield the highest conjugation efficiency, LNPs and antibodies are modified with matching click handles. The antibodies are also labeled with a fluorescent dye. Following the antibody-LNP conjugation reaction, the remaining unconjugated antibodies are separated using size exclusion chromatography (SEC). Because the antibodies are labeled with fluorescent dyes, antibody conjugation efficiency is quantified using a fluorescence plate reader. A general procedure is outlined below.

[0524] Experimental Procedure

[0525] Step 1: Modifying LNPs with Click Ligands: An ethanol phase was prepared using five lipids conta...

Claims

1. A conjugate comprising a targeting moiety and a lipid nanoparticle (LNP) encapsulating a therapeutic agent, wherein the targeting moiety is conjugated to the lipid nanoparticle via a linker, and wherein the linker comprises an enzyme recognition sequence and a click product formed by a click reaction between a first click handle on the targeting moiety and a second click handle on the LNP.

2. The conjugate of claim 1, wherein the enzyme recognition sequence comprises a sorting enzyme recognition motif.

3. The conjugate of claim 2, wherein the sorting enzyme recognition motif comprises an LPXT motif, wherein X is any amino acid.

4. The conjugate according to claim 3, wherein the sorting enzyme recognition motif is LPET (SEQ ID NO:8).

5. The conjugate of claim 2 or claim 3, wherein the linker comprises 3-10 glycine residues between the sorting enzyme recognition motif and the click product.

6. The conjugate of claim 5, wherein the linker comprises 3-6 glycine residues between the sorting enzyme recognition motif and the click product.

7. The conjugate of claim 6, wherein the linker comprises three glycine residues between the sorting enzyme recognition motif and the click product.

8. The conjugate of claim 1, wherein the enzyme recognition sequence comprises a lipoic acid ligase (LplA) receptor peptide.

9. The conjugate of claim 8, wherein the LplA receptor peptide has the sequence GFEDKVWYDLDA (SEQ ID NO: 15).

10. The conjugate of claim 1, wherein the enzyme recognition sequence comprises a transglutaminase recognition sequence (LLQG(SEQ ID NO:16)).

11. The conjugate of claim 10, wherein the enzyme recognition sequence comprises a sequence recognized by a formylglycine generating enzyme.

12. The conjugate according to any one of claims 1-11, wherein the targeting portion is a protein comprising at least one C-terminus and at least one N-terminus.

13. The conjugate of claim 12, wherein the enzyme recognition sequence is covalently bonded to at least one C-terminus of the protein.

14. The conjugate of claim 12, wherein the protein is an antibody.

15. The conjugate of claim 14, wherein the C-terminus of one or both of the heavy chains of the antibody is covalently bonded to the enzyme recognition sequence.

16. The conjugate of claim 12 or claim 13, wherein the protein is a Fab fragment.

17. The conjugate of claim 12 or claim 13, wherein the protein is a single-stranded variable fragment (ScFv).

18. The conjugate according to any one of claims 1-17, wherein the click product is formed by a reverse electron-demanding Diels-Alder reaction between the trans-cyclooctene (TCO) moiety on the first or second click handle and the tetrazine ring on the first or second click handle.

19. The conjugate of claim 18, wherein the first click handle comprises a tetrazine ring and the second click handle comprises a TCO portion.

20. The conjugate of claim 18 or claim 19, wherein the tetrazine ring is unsubstituted.

21. The conjugate according to any one of claims 18-20, wherein the tetrazine ring is methyltetrazine.

22. The conjugate of claim 21, wherein the tetrazine ring is 6-methyltetrazine.

23. The conjugate according to any one of claims 18-20. The tetrazine ring thereon has one of the following structures:

24. The conjugate according to any one of claims 1-23, wherein the LNP comprises one or more lipid molecules.

25. The conjugate of claim 24, wherein the second click handle is covalently bonded to at least one of the lipid molecules.

26. The conjugate of claim 25, wherein the lipid molecule bonded to the second click handle is a polyethylene glycol-modified lipid.

27. The conjugate of claim 26, wherein the lipid component of the polyethylene glycol-modified lipid is selected from DMG, DPG, DSG, DTA, DOPE, DPPE, DMPE, DSPE, sphingosine, sphingomyelin, and stearic acid.

28. The conjugate of claim 26 or claim 27, wherein the LNP comprises about 0.05 to about 2 mol% of the polyethylene glycol-modified lipid bonded to the second click product.

29. The conjugate of claim 26 or claim 27, wherein the LNP comprises about 0.1% to about 1% mol% of the polyethylene glycol-modified lipid bonded to the second click product.

30. The conjugate of claim 26 or claim 27, wherein the LNP comprises about 0.5% to about 1% mol% of the polyethylene glycol-modified lipid bonded to the second click product.

31. The conjugate according to any one of claims 26-30, wherein the polyethylene glycol-modified lipid bonded to the second click product has a molecular weight of about 500 to about 5,000.

32. The conjugate according to any one of claims 26-30, wherein the polyethylene glycol-modified lipid bonded to the second click product has a molecular weight of about 1,000 to about 3,000.

33. The conjugate of claim 27, wherein the polyethylene glycol-modified lipid has the formula DSPE-PEG2000-second click product.

34. The conjugate of claim 27, wherein the polyethylene glycol-modified lipid has the formula DSPE-PEG3000-second click product.

35. The conjugate of claim 27, wherein the polyethylene glycol-modified lipid has the formula DSPE-PEG5000-second click product.

36. The conjugate according to any one of claims 1-35, wherein the LNP comprises one or more cholesterol molecules.

37. The conjugate of claim 36, wherein the second click handle is covalently bonded to at least one of the cholesterol molecules.

38. The conjugate of claim 37, wherein the cholesterol molecule bonded to the second click handle is β-sitosterol, hydroxycholesterol, or stigmasterol.

39. The conjugate according to any one of claims 1-38, wherein the LNP comprises at least one unpolyglycolated phospholipid.

40. The conjugate of claim 39, wherein the second click handle is bonded to the unpolyglycolated phospholipid.

41. The conjugate of claim 39, wherein the unpolyethylene glycolated phospholipid is POPC, DOPC, DOPE or DSPC.

42. The conjugate according to any one of claims 1-41, wherein the LNP comprises at least one ionizable lipid molecule.

43. The conjugate of claim 42, wherein the second click handle is covalently bonded to the ionizable lipid molecule.

44. The conjugate of claim 43, wherein the ionizable lipid is selected from V003, V004, V005 and V040.

45. The conjugate of claim 14, wherein the conjugate has the structural antibody-LPXT(G). n (SEQ ID NO:19)-click product-LNP, where X is any amino acid and n is an integer between 3 and 10.

46. ​​The conjugate of claim 16, having the structural Fab fragment -LPXT(G) n (SEQ ID NO:19)-click product-LNP, where X is any amino acid and n is an integer between 3 and 10.

47. The conjugate of claim 17, having the structure ScFv-LPXT(G) n (SEQ ID NO:19)-click product-LNP, where X is any amino acid and n is an integer between 3 and 10.

48. The conjugate according to claims 1-47, wherein the targeting portion binds to an antigen on a T cell.

49. The conjugate of claim 48, wherein the targeting portion is bound to CD2, CD3, CD4, CD5, CD6, CD7 or CD8.

50. The conjugate according to any one of claims 1-47, wherein the targeting portion binds to an antigen on a hematopoietic stem cell (HSC).

51. The conjugate of claim 50, wherein the targeting portion is bound to CD90 or CD117.

52. The conjugate according to any one of claims 1-51, wherein the number of target portions conjugated with each LNP is greater than 10 or greater than 20.

53. The conjugate according to any one of claims 1-51, wherein the number of target portions conjugated with each LNP is greater than 50.

54. The conjugate according to any one of claims 1-51, wherein the number of target portions conjugated with each LNP is greater than 100.

55. The conjugate according to any one of claims 1-51, wherein the number of target portions conjugated with each LNP is from about 10 to about 150.

56. The conjugate according to any one of claims 1-51, wherein the number of targeting portions conjugated with each LNP is from about 10 to about 30.

57. The conjugate according to any one of claims 1-51, wherein the number of target portions conjugated with each LNP is from about 50 to about 100.

58. The conjugate according to any one of claims 1-51, wherein the number of target portions conjugated with each LNP is about 100 to about 130.

59. The conjugate according to any one of claims 1-58, wherein the conjugate comprises a therapeutic agent.

60. The conjugate of claim 59, wherein the therapeutic agent comprises a nucleic acid molecule.

61. The conjugate of claim 60, wherein the nucleic acid molecule is a DNA molecule, such as a DNA plasmid, closed-terminal DNA (ceDNA), or small circular DNA.

62. The conjugate of claim 60, wherein the nucleic acid molecule is an mRNA molecule.

63. The conjugate of claim 62, wherein the mRNA encodes a chimeric antigen receptor (CAR).

64. The conjugate of claim 62, wherein the mRNA encodes an enzyme.

65. The conjugate of claim 64, wherein the enzyme comprises a nuclease, recombinase, integrase, transposase, reverse transcriptase, helicase, transcriptase, polymerase, reverse transcriptase, deaminase, methylase, demethylase, or ligase, or a combination thereof.

66. The conjugate of claim 65, wherein the enzyme comprises a nuclease.

67. The conjugate of claim 66, wherein the nuclease comprises a CRISPR-Cas nuclease.

68. The conjugate of claim 67, wherein the CRISPR-Cas nuclease is a nicking enzyme.

69. The conjugate of claim 67 or claim 68, wherein the CRISPR-Cas nuclease is Cas9.

70. The conjugate of claim 67, wherein the CRISPR-Cas nuclease is Cas12a.

71. The conjugate according to any one of claims 67-70, wherein the conjugate further comprises a gRNA molecule.

72. The conjugate of claim 59, wherein the therapeutic agent comprises a gRNA molecule.

73. The conjugate of claim 59, wherein the therapeutic agent comprises a genetically modified polypeptide.

74. The conjugate of claim 73, wherein the gene-modifying polypeptide comprises a retrotransposon.

75. The conjugate of claim 73 or claim 74, wherein the conjugate further comprises template RNA that binds to the gene-modifying polypeptide.

76. The conjugate of claim 75, wherein the template RNA encodes a CAR.

77. The conjugate of claim 59, wherein the therapeutic agent comprises a template RNA molecule, such as a template RNA bound to a gene-modifying polypeptide.

78. The conjugate of claim 77, wherein the template RNA molecule encodes a CAR.

79. The conjugate of claim 59, wherein the therapeutic agent comprises a gene-modifying system.

80. The conjugate of claim 79, wherein the gene modification system comprises a gene-modifying polypeptide and template RNA.

81. The conjugate of claim 80, wherein the gene-modifying polypeptide comprises a retrotransposon.

82. The conjugate of claim 80, wherein the template RNA encodes CAR.

83. The conjugate of claim 60, wherein the nucleic acid molecule comprises siRNA, miRNA, or non-coding RNA (ncRNA) molecules.

84. The conjugate of claim 59, wherein the therapeutic agent comprises a peptide or a protein.

85. The conjugate of claim 59, wherein the therapeutic agent comprises a small molecule.

86. The conjugate of claim 59, wherein the therapeutic agent comprises a heterologous gene modification system or a component thereof.

87. A pharmaceutical composition comprising the conjugate as described in any one of claims 1-86.

88. A cell comprising the conjugate as described in any one of claims 1-86.

89. A method of treating cancer, comprising administering the pharmaceutical composition of claim 87 to a patient in need.

90. The method of claim 89, wherein the cancer is a leukemia.

91. The method of claim 90, wherein the blood cancer is multiple melanoma.

92. A method of treating sickle cell disease, comprising administering the pharmaceutical composition of claim 87 to a patient in need.

93. An antibody, Fab fragment, or ScFv, wherein a sorting enzyme recognition motif is attached to a click handle via the C-terminus of one or more of the heavy or light chains of the antibody, the C-terminus of the heavy or light chain of the Fab fragment, or the C-terminus of the ScFv, wherein the click handle comprises a tetrazine ring capable of reacting with the trans-cyclooctene (TCO) moiety.

94. The antibody, Fab fragment, or ScFv of claim 93, wherein the sorting enzyme recognition motif comprises the sequence LPXT, wherein X is any amino acid.

95. The antibody, Fab fragment, or ScFv of claim 93, wherein the sorting enzyme recognition motif comprises the sequence LPET (SEQ ID NO: 8).

96. The antibody, Fab fragment, or ScFv of any one of claims 93-95, wherein the linker further comprises between 3 and 10 glycine residues, wherein one of the glycine residues is covalently bonded to the sorting enzyme recognition motif, and wherein one of the glycine residues is covalently bonded to the click handle.

97. The antibody, Fab fragment, or ScFv of claim 96, wherein the linker comprises three glycine amino acids, wherein one of the glycine amino acids is covalently bonded to the sorting enzyme recognition motif, and wherein one of the glycine amino acids is covalently bonded to the click handle.

98. A structural antibody -LPXT(G) n (SEQ ID NO:19) - An antibody for a click handle, wherein X is any amino acid residue, n is an integer between 3 and 10, and wherein the click handle comprises a tetrazine or methyltetrazine ring capable of reacting with the trans-cyclooctene (TCO) moiety.

99. The antibody of claim 98, wherein X is E.

100. A Fab fragment with structure -LPXT(G) n (SEQ ID NO:19) - A Fab fragment of a click handle, wherein X is any amino acid residue, n is an integer between 3 and 10, and wherein the click handle comprises a tetrazine or methyltetrazine ring capable of reacting with the trans-cyclooctene (TCO) moiety.

101. The Fab fragment of claim 100, wherein X is E.

102. A structure with ScFv-LPXT(G) n (SEQ ID NO:19) - ScFv of a click handle, wherein X is any amino acid residue, n is an integer between 3 and 10, and wherein the click handle comprises a tetrazine or methyltetrazine ring capable of reacting with the trans-cyclooctene (TCO) moiety.

103. The Fab fragment of claim 102, wherein X is E.

104. An antibody, Fab fragment, or ScFv connected to a click handle via a lipoic acid ligase (LplA) receptor peptide through the C-terminus of one or more of the heavy or light chains of the antibody, the C-terminus of the heavy or light chain of the Fab fragment, or the C-terminus of the ScFv, wherein the click handle comprises a tetrazine ring capable of reacting with the trans-cyclooctene (TCO) moiety.

105. The antibody of claim 93, wherein the LplA receptor peptide has the sequence GFEDKVWYDLDA (SEQ ID NO: 15).

106. A method for conjugating an LNP to an antibody, a Fab fragment, or a single-chain variable fragment (ScFv), wherein the antibody Fab fragment or ScFv is covalently linked to a first click handle via a linker comprising an enzyme recognition sequence, and the LNP is covalently linked to a second click handle, the method comprising contacting the LNP with the antibody, Fab fragment, or ScFv such that the first click handle reacts with the second click handle to form a click reaction product conjugating the antibody, Fab fragment, or ScFv to the LNP.

107. The method of claim 106, wherein the enzyme recognition sequence is a sorting enzyme recognition motif or an LplA receptor peptide.

108. The method of claim 106 or claim 107, wherein the first click handle comprises a tetrazine ring or a trans-cyclooctene (TCO) portion.

109. The method of claim 108, wherein the first click handle comprises a tetrazine ring.

110. The method of claim 108 or claim 109, wherein the tetrazine ring is unsubstituted.

111. The method of claim 110, wherein the tetrazine ring is methyltetrazine.

112. The method of any one of claims 106, wherein the second click handle comprises a tetrazine ring or a TCO portion.

113. The method of claim 112, wherein the second click handle includes a TCO portion.

114. The method of any one of claims 106-113, wherein the second click handle is covalently bonded to a polyethylene glycol-modified lipid molecule.

115. The method of claim 114, wherein the lipid component of the polyethylene glycol-modified lipid is selected from DMG, DPG, DSG, DTA, DOPE, DPPE, DMPE, DSPE and stearic acid.

116. The method of claim 115, wherein the lipid component of the polyethylene glycol-modified lipid is DSPE.

117. The method of any one of claims 106-116, wherein the joining efficiency is greater than 50%.

118. The method of any one of claims 106-116, wherein the joining efficiency is greater than 70%.

119. The method of any one of claims 106-116, wherein the joining efficiency is greater than 80%.

120. The method of any one of claims 106-116, wherein the joining efficiency is greater than 90%.

121. The method of any one of claims 106-116, wherein the joining efficiency is about 60% to about 95%.

122. The method of any one of claims 106-116, wherein the joining efficiency is about 75% to about 90%.

123. The method of any one of claims 106-132, wherein the conjugate comprises more than 10 antibody, Fab fragment, or ScFv molecules per LNP.

124. The method of any one of claims 106-121, wherein the conjugate comprises more than 20 antibody, Fab fragment, or ScFv molecules per LNP.

125. The method of any one of claims 106-121, wherein the conjugate comprises more than 100 antibody, Fab fragment, or ScFv molecules per LNP.

126. The method of any one of claims 106-121, wherein the conjugate comprises about 50 to about 200 antibody, Fab fragment, or ScFv molecules per LNP.

127. The method of any one of claims 106-121, wherein the conjugate comprises about 10 to about 50 antibody, Fab fragment, or ScFv molecules per LNP.

128. A method for manufacturing lipid nanoparticles conjugated to antibodies, Fab fragments, or ScFv in a site-specific manner, the method comprising: (i) Covalently attaching a peptide having a sorting enzyme recognition site to one or more C-termini of the antibody or Fab fragment, or covalently attaching it to the C-terminus of the ScFv; (ii) In the presence of a sorting enzyme, and under conditions suitable for the sorting enzyme to link the antibody, Fab fragment or ScFv to a first click handle, the product of step (i) is contacted with the first click handle covalently bound to three or more glycine residues. (iii) Contact the product of step (ii) with lipid nanoparticles (LNP), wherein one or more lipids constituting the LNP contain a second click handle capable of reacting with a first click handle, thereby generating a click product.

129. A method for manufacturing lipid nanoparticles conjugated to antibodies, Fab fragments, or ScFv in a site-specific manner, the method comprising: (i) Covalently attaching the LplA receptor peptide site to the antibody, Fab fragment, or ScFv; (ii) Under conditions suitable for lipoic acid ligase to link the antibody, Fab fragment or ScFv to the first click handle, the product of step (i) is contacted with a carboxylic acid containing the first click handle; (iii) Contact the product of step (ii) with lipid nanoparticles (LNP), wherein one or more lipids constituting the LNP contain a second click handle capable of reacting with a first click handle, thereby generating a click product.

130. The method of claim 129, wherein the carboxylic acid is a fatty acid.

131. The method of any one of claims 128-130, wherein the first click handle comprises a tetrazine ring.

132. The method of any one of claims 128-130, wherein the second click handle includes a TCO portion.

133. A conjugate prepared by the method according to any one of claims 106-132.

Images