RNA biopesticide as well as application and preparation method thereof

Abstract

The invention discloses an RNA biopesticide as well as application and a preparation method thereof. A first aspect of the present application discloses an RNA biopesticide comprising a double-stranded RNA molecule, the glycosyl moiety of at least one nucleotide of the double-stranded RNA molecule having a 2 '-OMe modification. Research results show that when 2 '-OMe-NTPs is doped into the dsRNA, the dsRNA can bear ultraviolet radiation for a long time, and the stability of the dsRNA can be remarkably improved in a high-temperature environment. More importantly, the composition is prevented from being degraded by nuclease in leaf surfaces or lepidoptera pest cotton bollworm intestinal juice environment, and the control effect on cotton aphids and cotton bollworms is remarkably improved. Therefore, the stability of the dsRNA and the RNAi efficiency are improved by modifying the binding site and only depending on the structural change of the dsRNA under the condition of not introducing other materials.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological pesticides, in particular to RNA biological pesticides and application and preparation method. BACKGROUND

[0002] RNA interference (RNAi) has been proven to silence the expression of target genes using double-stranded RNA (dsRNA) since its discovery by Fire et al. in 1998. Therefore, it is widely used as a tool for gene function research in animals and plants where genetic manipulation tools are not perfect. Two studies in 2002 found that silencing specific target genes can cause abnormal development of insects, deformities and even death of the next generation of embryos, so RNAi technology has become a very promising direction in the field of agricultural pest control. Further studies have shown that expressing insect dsRNA using transgenic plants can achieve insecticidal effects, which also provides strong evidence for the application of RNAi technology in pest control.

[0003] Therefore, the pesticides developed using this technology are called RNA biological pesticides (or nucleic acid pesticides, RNA pesticides), and the core component is a polynucleotide that can specifically bind to the mRNA transcribed from the target gene in the target organism. Its working principle is to use the specific fragment of the endogenous functional gene in the organism, synthesize it in vitro and then introduce it into the target organism, to efficiently and specifically silence the expression of the target gene, thereby hindering the function of the gene and ultimately affecting the growth and development of the target organism, and even leading to the death of the target organism. Therefore, based on the characteristics of target species specificity, target development convenience and easy degradation, RNA biological pesticides are also the green pesticides that are currently concerned by many scientists and pesticide companies.

[0004] One of the major problems of RNA biological pesticides is the poor stability of "naked" dsRNA in the environment, such as poor tolerance to high temperature, ultraviolet light, RNase and target organism intestinal fluid. The current solution is to develop nanomaterials for encapsulation and protection. This technology not only protects dsRNA from being degraded by RNase, but also accelerates the endocytosis process to overcome the delivery bottleneck. Common nanomaterials include biopolymer nanomaterials, cationic lipids, dendritic polymers and peptides, etc. However, exogenous materials may have problems of cytotoxicity, ecological risk and high cost.

[0005] It is found in the experiment that D-ribose can improve the stability of dsRNA in RNase environment, specifically, competes with dsRNA for the binding site of RNase, and reduces the cutting efficiency of RNase on dsRNA. Considering that when dsRNA is released into the environment as a biological pesticide, the exogenously added ribose will separate from dsRNA, and it is difficult to provide sustained protection for dsRNA in the insect body. Therefore, chemical modification of ribose in the structure of dsRNA itself is attempted. At present, the modification types of chemical modification of nucleic acid molecules in the ribose part include 2' site alkylation, such as 2'-O-methyl (2'-OMe) and 2'-O-methoxyethyl (2'-MOE). These modifications are mainly used to increase the binding affinity to RNA complements, but whether they can be used to enhance the tolerance of RNA biological pesticides to high temperature, ultraviolet rays, RNase and target biological intestinal juice has not been reported. SUMMARY

[0006] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application provides an RNA biological pesticide with enhanced tolerance to high temperature, ultraviolet rays, RNase and target biological intestinal juice.

[0007] In a first aspect, the present application provides an RNA biological pesticide, which comprises a double-stranded RNA molecule, and the sugar moiety of at least one nucleotide of the double-stranded RNA molecule has a 2'-OMe modification.

[0008] The RNA biological pesticide according to the first aspect of the present application has the following beneficial effects:

[0009] The research results show that the incorporation of 2'-OMe-NTPs into dsRNA can make dsRNA withstand longer ultraviolet irradiation, and also significantly improve the stability of dsRNA in high temperature environment. More importantly, it can avoid degradation by nucleases in the leaf surface or lepidopteran pest cotton bollworm midgut environment, and significantly improve the control effect on cotton aphids and cotton bollworms. Therefore, by modifying the binding site, the stability and RNAi efficiency of dsRNA are improved without introducing other materials, relying only on the structural change of dsRNA itself.

[0010] The term "nucleotide" generally refers to a compound comprising a base, a sugar moiety, and optionally a monophosphate or polyphosphate group. Among the bases are one or more of the natural or non-natural types of bases including adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), inosine (I), xanthine, inosine, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil, 4-thiouracil, 8-halo-adenine or guanine, 8-amino-adenine or guanine, 8-thioladenine or guanine, 8-thiolalkyladenine or guanine, 8-hydroxyladenine or guanine, 5-halogen substituted uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, and the like. The sugar moiety generally includes ribose or deoxyribose, whereby the nucleotide is a ribonucleotide or a deoxyribonucleotide, polymerized to form an RNA molecule or a DNA molecule.

[0011] The term "2'-OMe modification" refers to the replacement of the -OH at the 2 position of the sugar moiety of a nucleotide with -OCH3, with reference to Figure 2 a.

[0012] In some embodiments of the application, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 180, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000 nucleotides of the sugar moiety of the double-stranded RNA molecule have a 2'-OMe modification.

[0013] In some embodiments of the application, at least 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 15%, 16%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% of the nucleotides of the double-stranded RNA molecule have a 2'-OMe modification of the sugar moiety.

[0014] In some embodiments of the application, the double-stranded RNA molecule targets any one of the genes of Cadherin, Carboxylesterase, Hemocytin, and CYP6DA2.

[0015] In some embodiments of the application, the double-stranded RNA molecule targets any one of the genes of Cadherin, Carboxylesterase, Hemocytin, and CYP6DA2 in an insect.

[0016] The term "insect" refers to a general term for animals of the phylum Arthropoda, class Insecta in a narrow sense, and also includes some arthropods that are not taxonomically classified as class Insecta in a broad sense.

[0017] In some embodiments of the application, the insect includes an agronomic pest, such as a crop pest, a forest pest, a grassland pest, and the like.

[0018] In some embodiments of this application, the insects include pests belonging to the orders Lepidoptera, Hemiptera, Diptera, Orthoptera, Coleoptera, Blattodea, Hymenoptera, Homoptera, Thysanoptera, and Arachnida. Lepidoptera pests include those belonging to the families Triticum, Tocopheridae, Pyralidae, Geometridae, Swallowtails, Pieridae, Skippers, Noctuidae, Lymantidae, Nasal Moths, Tridacnae, Sphingomycetes, Fruit Borers, Diamondback Moths, Clearwing Moths, Wood-boring Moths, Bombyx Moths, Saturniidae, Lycopodidae, Hepialidae, Scaly Moths, Spotted Moths, Papilionopodidae, Tuberculidae, Chinese Moths, Bagworms, Licetamoles, Leaf Miners, Owl Moths, Leaf-rolling Moths, Winged Moths, and Scale Moths. Specific examples include wheat moths, pink bollworms, potato tuber moths, sweet potato wheat moths, brown-banded leaf rollers, codling moths, soybean fruit borers, pear fruit borers, corn borers, rice stem borers, brown-edged stem borers, Taiwan rice stem borers, and large-scaled rice borers. Insects include: tea geometrid moth, cabbage white butterfly, cotton bollworm, fall armyworm, beet armyworm, cutworm, gypsy moth, apple leafminer moth, fall webworm, grape hawk moth, bean hawk moth, peach fruit moth, diamondback moth, etc.; Hemiptera pests include those from the families Stink bugs, scutellaria, bryozoa, styrax, mirid bugs, and lace bugs. Specifically, these can include rice stink bugs, green rice stink bugs, shield stink bugs, broad shield stink bugs of camellia oleifera, round turtle stink bugs, bean turtle stink bugs, rice spiny-edged stink bugs, red-backed long stink bugs, sorghum long stink bugs, cotton red stink bugs, and green mirid bugs, etc.; Diptera pests include pests from the families Flyflies, Leafminers, Fruit Flies, and Gall midges, specifically including gray ground fly, radish ground fly, onion ground fly, larch cone flower fly, and leaf fly. The pests include leaf miners, citrus fruit flies, Mediterranean fruit flies, apple fruit flies, cherry fruit flies, melon fruit flies, wolfberry fruit flies, wheat gall midges, rice gall midges, and pear gall midges; Orthoptera pests include pests from the suborders Acrididae, Tettigoniidae, and Mole Crickets, specifically including at least one of the following: East Asian migratory locust, Siberian locust, yellow-spined bamboo locust, green-spined bamboo locust, yellow-spotted locust, Chinese rice locust, short-horned grasshopper, cotton-spotted grasshopper, Japanese broad-winged grasshopper, green grasshopper, peanut cricket, oil cricket, African mole cricket, and North China mole cricket; Coleoptera pests include pests from the families Gemstoneidae, Longhorn beetles, Chrysomelidae, Weevils, Click beetles, Bark beetles, Longhorn beetles, Powder beetles, Bryophyllidae, Scarab beetles, and Bean weevils, specifically including grubs, wireworms, and leaf beetles. Beetles, flea beetles, ground beetles, longhorn beetles, weevils, bean weevils, scarab beetles, click beetles, spotted ground beetles, black ground beetles, yellow mealworms, black mealworms, etc.; Blattodea pests include termite pests, specifically Formosan subterranean termite, yellow-breasted subterranean termite, black-breasted subterranean termite, black-winged subterranean termite, yellow-winged giant termite, truncated sand termite, shovel-headed sand termite, etc.; Hymenoptera pests include leaf wasps, stem wasps, broad-shouldered wasps, tree wasps, gall wasps, specifically at least one of the following: tea oil leaf wasp, white wax leaf wasp, camphor leaf wasp, pear fruit wasp, pine saw wasp, pear stem wasp, wheat stem wasp, black locust seed wasp, wood thorn seed wasp, bamboo broad-shouldered wasp, fir tree wasp, blue-black tree wasp, tobacco horn tree wasp, chestnut gall wasp;Homoptera pests include those belonging to the families Cicadidae, Cicadidae, Leafhoppers, Aphididae, Psyllididae, and Scale Insects. Specifically, they can include cicadas, crickets, red cicadas, black cicadas, horse cicadas, thin-winged cicadas, buffalo-shaped hornhoppers, oak-banded hornhoppers, four-banded oak hornhoppers, large green leafhoppers, black-tailed leafhoppers, white-winged leafhoppers, small green leafhoppers, rhomboid leafhoppers, wheat aphids, wheat two-forked aphids, cotton aphids, peach aphids, radish aphids, camphor psyllids, paulownia psyllids, mulberry psyllids, cottony cushion scale, citrus mealybug, citrus scale, citrus glandular mealybug, coconut round shield scale, yellow flame shield scale, Comstock mealybug, sugar mealybug, mulberry shield scale, elm oyster shield scale, Japanese pine dry scale, pearl cotton scale, etc. Pterygoptera include pests of the families Thripsidae and Pithidae, specifically including onion thrips, rice thrips, western flower thrips, flower thrips, palm thrips, bean thrips, and tea thrips; Arachnidae include pests of the superfamilies Tarsoidea, Tetranychus, and Galloidea, specifically including *Tetranychus cyclamen*, *Tetranychus stylosa*, *Tetranychus lateralis*, alfalfa moth, wheat mite, fruit moth, jujube leaf mite, cotton leaf mite, two-spotted leaf mite, hawthorn leaf mite, carmine leaf mite, truncate leaf mite, citrus pteridomastoides, apple pteridomastoides, citrus leaf mite, six-spotted leaf mite, cypress leaf mite, rice leaf mite, bamboo leaf mite, millet gall mite, and *Tetranychus turcica*.

[0019] In some embodiments of this application, double-stranded RNA molecules target the Cadherin gene of the cotton bollworm.

[0020] In some embodiments of this application, double-stranded RNA molecules target the Carboxylesterase gene of the cotton bollworm.

[0021] In some embodiments of this application, double-stranded RNA molecules target the Hemocytin gene of the cotton aphid.

[0022] In some embodiments of this application, double-stranded RNA molecules target the CYP6DA2 gene of the cotton aphid.

[0023] In some embodiments of this application, the double-stranded RNA molecule is a siRNA precursor molecule.

[0024] The term "precursor molecule" refers to a substance that reacts in a living organism to generate siRNA. Specifically, it can be a substance that directly generates siRNA after being cleaved by the Dicer enzyme.

[0025] In some embodiments of this application, RNA biopesticides are used to control at least one of cotton bollworm and cotton aphid.

[0026] A second aspect of this application provides the use of a nucleotide with a 2'-OMe modified glycosyl moiety in the preparation of products A1) to A6):

[0027] A1) An RNA biopesticide with enhanced heat resistance;

[0028] A2) RNA biopesticide with enhanced UV resistance;

[0029] A3) RNA biopesticide with enhanced RNase resistance;

[0030] A4) RNA biopesticide with enhanced resistance to intestinal fluid;

[0031] A5) RNA biopesticide with enhanced RNA interference effect;

[0032] A6) RNA biopesticide with enhanced lethal effect.

[0033] In some embodiments of the present application, the RNA biopesticide comprises a double-stranded RNA molecule incorporating at least one nucleotide with a 2'-OMe-modified sugar moiety.

[0034] In some embodiments of the present application, at least 30%, 40% or 50% of the nucleotides in the double-stranded RNA molecule are nucleotides with a 2'-OMe-modified sugar moiety.

[0035] In some embodiments of the present application, the RNA biopesticide is used for controlling at least one of Helicoverpa armigera and Aphis gossypii.

[0036] In some embodiments of the present application, the double-stranded RNA molecule is an siRNA precursor molecule.

[0037] In a third aspect of the present application, a method for preparing an RNA biopesticide with enhanced effect is provided, the method comprising the following steps:

[0038] providing a nucleic acid template molecule, an RNA polymerase and rNTPs, and generating a double-stranded RNA molecule in the reaction to obtain the RNA biopesticide;

[0039] wherein the rNTPs comprise 2'-OMe-NTPs.

[0040] In some embodiments of the present application, the RNA polymerase comprises at least one of a eukaryotic RNA polymerase (such as RNA polymerase II), a prokaryotic RNA polymerase (such as E. coli RNA polymerase), a bacteriophage RNA polymerase (such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase) and the like.

[0041] In some embodiments of the present application, the nucleic acid template molecule comprises a full-length nucleic acid molecule or a truncated nucleic acid molecule fragment of at least one gene selected from the group consisting of Cadherin, Carboxylesterase, Hemocytin and CYP6DA2.

[0042] In some embodiments of the present application, the nucleic acid template molecule comprises a full-length nucleic acid molecule or a truncated nucleic acid molecule fragment derived from at least one gene of Cadherin, Carboxylesterase, Hemocytin and CYP6DA2 of insects.

[0043] In some embodiments of the present application, the insect comprises Helicoverpa armigera and Aphis gossypii.

[0044] In some embodiments of the present application, the reaction condition is 20-60°C for 1-10h. It can be understood that the specific reaction temperature is based on the optimum temperature of the RNA polymerase, for example, it can be 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C for 1h, 2h, 3h, 4h, 5h, 6h, 7h, 8h, 9h, 10h.

[0045] In some embodiments of the present application, the molar percentage of 2'-OMe-NTPs in rNTPs is 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 15%, 16%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100%.

[0046] In some embodiments of the present application, the rNTPs further comprise unmodified rNTPs.

[0047] Additional aspects and advantages of the present application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS

[0048] Figure 1 is the high-temperature ultraviolet stability experimental result in the embodiments of the present application. Among them, A is the agarose gel electrophoresis result of 100°C incubation for 10min in high-temperature experiment, B is the capillary electrophoresis result of 100°C incubation for 10min in high-temperature experiment, C is the capillary electrophoresis result of 100°C incubation for 15min in high-temperature experiment, D is the agarose gel electrophoresis result of 16h exposure under UVC irradiation in ultraviolet experiment, B is the capillary electrophoresis result of 16h exposure under UVC irradiation in ultraviolet experiment, C is the capillary electrophoresis result of 24h exposure under UVC irradiation in ultraviolet experiment.

[0049] Figure 2are the results of enzyme and midgut liquid stability experiments in the embodiments of the present application. Wherein, a is the structural diagram of rNTP and 2'-OMe-NTP, b is the schematic diagram of 2'-OMe-dsRNA anti-enzymolysis, c is the agarose gel electrophoresis result of RNase A incubation for 1 h in the enzyme stability experiment, d is the capillary electrophoresis result of RNase A incubation for 1 h, 3 h, 24 h, 48 h in the enzyme stability experiment, e is the agarose gel electrophoresis result of midgut liquid incubation for 4 h in the midgut liquid stability experiment, d is the capillary electrophoresis result of midgut liquid incubation for 4 h, 8 h, 24 h, 48 h in the midgut liquid stability experiment.

[0050] Figure 3 are the results of RNAi efficiency experiments in the embodiments of the present application. Wherein, a is the change of mRNA expression level of Cad target gene after 12 h, 24 h, 48 h of dsRNA targeting HaCad treatment; b is the change of mRNA expression level of CarE target gene after 12 h, 24 h, 48 h of dsRNA targeting HaCarE treatment; c is the change of mRNA expression level of AgHem target gene after 12 h of dsRNA targeting AgHem treatment; d is the change of mRNA expression level of AgCYP6DA2 target gene after 12 h of dsRNA targeting AgCYP6DA2 treatment; e is the result of cumulative mortality observed after different times of ingesting dsRNA targeting AgHem; f is the result of cumulative mortality observed after different times of ingesting dsRNA targeting AgCYP6DA2. DETAILED DESCRIPTION

[0051] The concept and the technical effects produced by the present application will be described clearly and completely in combination with the embodiments below, so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0052] The embodiments of the present application are described in detail below, and the described embodiments are exemplary and are only used to explain the present application, and cannot be understood as a limitation of the present application.

[0053] In the description of the present application, the meaning of several is more than one, the meaning of multiple is more than two, greater than, less than, more than, etc. are understood as not including the number, above, below, etc. are understood as including the number, the meaning of about refers to the range of ±20%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, 0.1%, etc. of the number. If it is described as first, second, it is only used for the purpose of distinguishing technical features, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features or implicitly indicating the sequence of indicated technical features.

[0054] In the description of the present application, the description of the terms "one embodiment", "some embodiments", "exemplary embodiment", "example", "specific example", or "some examples" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the exemplary description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the described specific features, structures, materials or characteristics can be combined in any one or more embodiments or examples in a suitable manner.

[0055] The present application is described below in conjunction with specific embodiments.

[0056] Some of the primer sequences are shown in Table 1:

[0057] Table 1. Primer sequences

[0058]

[0059] Example 1: Synthesis of dsRNA

[0060] 1.2'-OMe-dsRNA synthesis

[0061] Design DNA templates of different gene fragments, this embodiment contains 5 gene fragments: EGFP, Cadherin (Cad), Carboxylesterase (CarE), Hemocytin (Hem) and CYP6DA2.

[0062] For each dsRNA, 1 μL of T7 RNA polymerase premix (Belongbio), 5 μL of 10× reaction buffer (Belongbio), 1 μL of DNA template, 8 μL of unmodified rNTPs mixture (Bidepharm), 1 μL of 2'-OMe-NTPs mixture (Bidepharm), and 50 μL of nuclease-free water were added, the reaction solution was mixed uniformly, and the reaction was carried out at 37°C for 2-8 hours.

[0063] Wherein, the unmodified rNTPs mixture is an equimolar mixture of rATP, rCTP, rGTP and rUTP, and the 2'-OMe-NTPs mixture is an equimolar mixture of 2'-OMe-rATP, 2'-OMe-rCTP, 2'-OMe-rGTP and 2'-OMe-rUTP. The molar amount of rNTPs and 2'-OMe-NTPs in the unmodified rNTPs mixture and the 2'-OMe-NTPs mixture is also equal. Half of the ribose of the nucleotides in the 2'-OMe-dsRNA prepared by the method is modified by 2'-OMe.

[0064] After the synthesis of dsRNA, the dsRNA magnetic bead purification kit (Shanghai Shengyouguo Biological Technology Co., Ltd., ZS-PU002) was used for purification according to the operation requirements of the instruction manual.

[0065] 2. Synthesis of unmodified dsRNA

[0066] Referring to the synthesis of 2'-OMe-dsRNA, the difference is that the 2'-OMe-NTPs mixture in the system is replaced by an equal amount of rNTPs mixture.

[0067] Wherein, the sequence of dsEGFP is:

[0068] > dsEGFP

[0069] GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTG (SEQ ID NO. 27).

[0070] Example 2: High temperature ultraviolet stability experiment

[0071] The dsRNA (control group) and 2'-OMe-dsRNA (experimental group) of unmodified EGFP prepared in Example 1 were subjected to high temperature (incubated at 100°C for 10 min / 15 min) or ultraviolet (exposed to UVC for 16 h / 24 h), and the dsRNA and 2'-OMe-dsRNA before and after treatment were subjected to agarose gel electrophoresis and capillary electrophoresis.

[0072] The results are shown in Figure 1 From the figure, it can be seen that the unmodified dsRNA was degraded by 93.86% after incubation at 100°C for 10 min, while the 2'-OMe-dsRNA was only degraded by 60.66% under the condition of 100°C, which shows that the 2'-OMe modification significantly improves the tolerance of dsRNA to high temperature; the remaining content of unmodified dsRNA exposed to UVC for 16 h was 21.64%, and the remaining content after exposure for 24 h was 0.77%, while the remaining content of 2'-OMe-dsRNA after exposure for 16 h was 94.28%, and the remaining content after exposure for 24 h was 79.2%, which shows that the 2'-OMe modification also significantly improves the tolerance of dsRNA to ultraviolet light. In summary, the addition of 2'-OMe-NTPs significantly improves the survival ability of dsRNA under high temperature and ultraviolet conditions.

[0073] Example 3: Enzyme and midgut liquid stability experiment

[0074] (1) 1 μg of unmodified dsRNA or 1 μg of 2'-OMe-dsRNA of EGFP gene prepared in Example 1 was respectively incubated with 10 -3 μL of RNase A enzyme solution (Thermofisher, EN0531) for 1 h, 3 h, 24 h and 48 h, and the dsRNA and 2'-OMe-dsRNA before and after incubation were subjected to agarose gel electrophoresis and capillary electrophoresis.

[0075] The results are shown in Figure 2 capillary electrophoresis results show that after incubation with RNase A, the unmodified dsRNA is rapidly degraded to 5.79% within 1 h, while the content of 2'-OMe-dsRNA is still not less than 52.8% after incubation with RNase A for 24 h. Therefore, 2'-OMe-dsRNA can avoid rapid degradation by RNase A.

[0076] (2) 10 μg unmodified dsRNA or 10 μg 2'-OMe-dsRNA of EGFP gene prepared in Example 1 was respectively incubated with 100 μL of cotton bollworm midgut fluid (cotton bollworms were bred in the laboratory, the midgut of four instar cotton bollworms was dissected and placed in a 1.5 mL centrifuge tube containing 500 μL of PBS solution, tissue homogenate was prepared by repeated blowing with a pipette, centrifuged at 2400 g for 3 minutes at 4°C, the supernatant was collected and diluted ten times with PBS for standby) for 4 h, 8 h, 24 h and 48 h, and the dsRNA and 2'-OMe-dsRNA before and after incubation were subjected to agarose gel electrophoresis and capillary electrophoresis.

[0077] The results are shown in e and f of Figure 2 The capillary electrophoresis results show that the dsRNA is completely degraded in the cotton bollworm midgut fluid within 24 h, while 57.29% of the 2'-OMe-dsRNA remains after incubation in the midgut fluid for 48 h. This indicates that 2'-OMe-NTP can significantly improve the resistance of dsRNA to midgut fluid.

[0078] Example 4: RNAi efficiency experiment

[0079] (1) The Cadherin (Cad) and Carboxylesterase (CarE) genes of cotton bollworm were selected as RNAi targets, which play a key role in the synaptic development of neurons and metabolic detoxification of insects, and are essential for the survival of cotton bollworm.

[0080] Cotton bollworm larvae were injected subcutaneously with 10 μg of dsRNA (concentration of 5 μg / μL dsRNA, 2 μL injection) each, dsEGFP, dsCad / dsCarE, 2'-OMe-dsCad / 2'-OMe-dsCarE prepared in Example 1, and then sampled at 12, 24 and 48 h after injection, and the RNA was extracted by Trizol method, and then the mRNA expression level of Cad and CarE target genes was detected by real-time fluorescent quantitative PCR method, the primer sequences of Cad, CarE and internal reference genes (ACTIN and EF5α) are shown in Table 1, and the sequences of each dsRNA are as follows:

[0081] >dsCadherin (Cad)

[0082] ACTGCTTGGTGACCGTAGTGTTTGTTCCCACGCAGGGAGAGCCCGTGTTCGAGGAGAGTACCTACACGGTTGCTTTTGTTGAAAAAGATGAGGGTATGGAGGAGAGGGCGGAACTACCTCGCGCCTCAGACCCGAGGAACATCATGTGTGAAGATGATTGTCACGACACCTATTACAGCATTGTTGGAGGCAATTCGGGTGAACACTTCAGAGTAGACCCTCGTACCAACGTGCTGACCCTTGTGAAGCCGCTGGACCGCTCCGAGCAGGACACTCATACTCTCATCATCGGAGCCAGCGACACTCCCAACCCGGCCGCCGTCCTGCAGGCTTCTACACTCACTGTCACTGTTAATGTTCGAGAAGCGAACCCGCGACCAGTGTTCCAGAGAGCACTCTACACAGCTGGCATCTCTGCTGGCGATTTCATCGAAAGAAATCTGCTGACTGTAGTAGCGACACATTCAGAAGGTCTGCCCATCACTTACACTCTGGTACAAGAGTCCATGGAAGCAGACCCCACACTCGAAGCTGTTCAGGAGTCAGCC (SEQ ID NO. 28).

[0083] >ds Carboxylesterase (CarE)

[0084] GACGGGTACAGCGCGGGTTCTGTCTCAGTAGATCTGTTAATGTTGTCTAAGTCAGCAGAAGGACTATTCCAAAGAGTCATACCTGAAAGTGGAGGAAACCTGGCAGCTCTTGCAATCCAGCGAGATCCTGTAGAGATTGCAAAAACGCATGCTAGGAAGTTGAACTTCACTAATGTAGATGATATCTACGCTTTAGAAGATTTCTATAGGAAAGCTCCATTGGAGCTATTATTAACCCCAGATGACTTATTTGATAGAACAGATTCCATATTCAAGTTTTCACCGTGTGTAGAACGTGACACAGGAGACGGAGCGTTCCTAACTGAATCACCTCTGACTATACTCAAGAGTGGCAACTACAGAAAAGTACCACTATTATATGGTTTCGCAAATATGGAAGGGTTGTTACGCATTGGTTTCTTTGATATCTGGAAGCATAAGATGAATGAAAAGTTTTCTGATTTCTTGCCACCTGACTTAAAGTTTGATTCTGTCGAAGAAAGAGAAGAAGTGGCAAATAAGATTAAGAAGTTTTACTTTGGTGACAAGCCAGTCGACAATGACAATATTTTAAAATACGTTGATTTCTTCTCGGACGTCATCTTTGCTTATCCCATGCTTAGAGCTGTAAAGTTGCACGCGGAGGCTGG (SEQ ID NO. 29).

[0085] The results are shown in a and b of Figure 3 The silencing efficiency of 2'-OMe-dsRNA was significantly improved compared with unmodified dsRNA targeting Cad or CarE: the silencing efficiency of 2'-OMe-dsCad was improved by 16.1% at 12h, 24.1% at 24h, and 23.1% at 48h; the silencing efficiency of 2'-OMe-dsCarE was improved by 24.6% at 12h, 35.2% at 24h, and 38.9% at 48h. The above results showed that 2'-OMe-dsRNA was more effective than dsRNA in gene knockdown.

[0086] (2) Select Hemocytin (Hem) and CYP6DA2 genes in cotton aphids as targets, and test the effectiveness of 2'-OMe-dsRNA in preventing and controlling pests. Hem and CYP6DA2 genes play a key role in blood clotting and metabolic detoxification of insects, and are essential for the survival of cotton aphids.

[0087] The dsRNA application method of foliar spraying was used to treat cotton aphids, and the specific method was as follows: healthy adult aphids were selected and introduced into the upper leaves of healthy growing cotton seedlings, and after colonization for 2h, micro-sprayer was used for spraying treatment, 100μg of dsEGFP, dsCYP6DA2, dsHem, 2'-OMe-dsCYP6DA2 or 2'-OMe-dsHem was sprayed on each cotton plant. After treatment, the mortality rate was counted, and each biological repeat was 30 cotton aphids, and 3 biological repeats were set for statistical analysis, and the gene expression was detected by real-time fluorescent quantitative PCR method, and the primer sequences of CYP6DA2, Hem (Hemocytin) and internal reference genes (18S and EF5α) were as shown in Table 1, and the sequences of each dsRNA were as follows:

[0088] >dsHemocytin (Hem)

[0089] CGACGGACGGTGGAGAACGCAAGCGCTCTGAAAATGAGAGGACCGTAGATTTGAAACAGTTGAACGATAGTTGGGAAGACGGTCCTTGCCGATCGTGTTACTGTGATATAACGTCTATACGAGGAACTTGTAACAAAATTGAATGTGCTCCTCCATTAATAAGTTCCGACTACGTAATAGTGTCGCACACAAAATATGGTCAATGTTGTCCAAGTTACAAGAAAGAGTCTTGTATTTTCAATGGAACGGTTCACGATGTCGGAAGCGAATGGTCTTCATTTGATCCCTGCGTATCTATGAGCTGTAAACTCGATAACAATGGCGAAGCATTTATTACTGAATCCGTAAAAAGTTGCAACACTGAGTGTCCACTGGGATGGACGTATACACCTTCGACAAACAGTTGTTGTGGAACGTGCGTGCA (SEQ ID NO. 30).

[0090] >ds CYP6DA2

[0091] CTGTCAGTGCCGACGCCGTTTCCGGCGGACGTATATAGTGCGGCACATCGGCCACAACAATACAGCTGCAGTGGCCGCACCGACCGTTTGCGTCGTTCGTGATGATCTGCTTCGGTTGTTGGCGGGACATCTTGCCGGTCGCCGCGGCCGCCACTGTTGTGTCGGTGTTACTGGCGTACGCGTACTGCACGCGCCACTATGGCCACTGGGCGACGCTGGGCGTTCCGCACACCAAACCGGCACCGTTGCTGGGCCACTTCGCCGGGCCAACGTTGGGCCGCGAGTCGGGCACCGTCACCGTGGACACGCTGTACCGGCGGTTCGCCGGTCACCGGTACTTCGGGCTGTACCAGCTCCGACACCCCATGCTGGTGCTGCGCGACCCCGTGCTGGTGCACTCGGTGCTGGCCACAGAGTTCGCGTCGTTCCACGACCG (SEQ ID NO. 31).

[0092] The results are shown in c and d of Figure 3 The silencing efficiency of 2'-OMe-dsRNA on Hem and CYP6DA2 was significantly improved compared with naked dsRNA, which were 29.0% and 21.0% respectively, indicating that 2'-OMe-dsRNA could more efficiently exert RNAi effect in vivo in cotton aphids.

[0093] The results of cumulative mortality observed after ingesting dsRNA are shown in e and f of Figure 3 The mortality of cotton aphids induced by 2'-OMe-dsHem and 2'-OMe-dsCYP6DA2 was significantly increased, which were increased by 21.1% and 17.8% respectively at 72h, 17.8% and 22.2% respectively at 96h, and 16.7% and 18.9% respectively at 120h.

[0094] In summary, the above results further confirmed that 2'-OMe-dsRNA could cause better RNAi inhibition effect in insects compared with naked dsRNA, and produce stronger lethal phenotype / control effect.

[0095] The above embodiments of the present application are described in detail, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. RNA biopesticide, characterized in that, The double-stranded RNA molecule comprises at least one nucleotide with a 2'-OMe modified sugar moiety.

2. The RNA biopesticide according to claim 1, characterized in that, The double-stranded RNA molecule targets any one of Cadherin, Carboxylesterase, Hemocytin and CYP6DA2 genes.

3. The RNA biopesticide according to claim 1, characterized in that, The double-stranded RNA molecule is an siRNA precursor molecule.

4. The RNA biopesticide according to claim 1, characterized in that, The RNA biopesticide is used for controlling at least one of cotton bollworm and cotton aphid.

5. Use of nucleotides with 2'-OMe modified sugar moiety in the preparation of products of A1) to A6) below: A1) RNA biopesticide with enhanced high temperature resistance; A2) RNA biopesticide with enhanced UV resistance; A3) RNA biopesticide with enhanced RNase resistance; A4) RNA biopesticide with enhanced intestinal fluid resistance; A5) RNA biopesticide with enhanced RNA interference effect; A6) RNA biopesticide with enhanced lethal effect.

6. Use according to claim 5, characterized in that, The RNA biopesticide comprises a double-stranded RNA molecule incorporating at least one nucleotide with a 2'-OMe modified sugar moiety.

7. Use according to claim 6, characterized in that, At least 30%, 40% or 50% of the nucleotides in the double-stranded RNA molecule are nucleotides with a 2'-OMe modified sugar moiety.

8. Use according to claim 5, characterized in that, The RNA biopesticide is used for controlling at least one of cotton bollworm and cotton aphid.

9. Use according to claim 5, characterized in that, The double-stranded RNA molecule is an siRNA precursor molecule.

10. A method for preparing an RNA biopesticide having an enhancing effect, characterized by, The method comprises the following steps: providing a nucleic acid template molecule, an RNA polymerase and rNTPs, and allowing the reaction to generate a double-stranded RNA molecule to obtain the RNA biopesticide; wherein the rNTPs comprise 2'-OMe-NTPs.

Images