MiR-12136 inhibitor and application thereof in preparation of medicine for preventing and / or treating mechanical ventilation induced lung injury

Abstract

The invention discloses a miR-12136 inhibitor and application thereof in preparation of a medicine for preventing and / or treating mechanical ventilation induced lung injury, and belongs to the technical field of biological medicine. The nucleotide sequence of the miR-12136 inhibitor disclosed by the invention is AAGG CCUCCAUGACUUUUUC, and the nucleotide sequence of the miR-12136 inhibitor disclosed by the invention is The small RNA is a specific non-coding small RNA, and can inhibit the activity of miR-12136 in a targeted manner, increase the protein expression level of cell nest protein 2 and inhibit the expression of inflammatory factors, thereby inhibiting lung injury caused by mechanical ventilation. The invention discloses a medicine for directionally regulating and controlling airway smooth muscle cell inflammatory factor secretion by utilizing specific miRNA design for the first time. Therefore, the miR-12136 inhibitor can be used for preparing the medicine for preventing and / or treating mechanical ventilation induced lung injury, so that the miR-12136 inhibitor can be used for patients with mechanical ventilation and the like, and has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a miR-12136 inhibitor and application thereof in preparation of a drug for preventing and / or treating mechanical ventilation induced lung injury. BACKGROUND

[0002] Mechanical ventilation provides respiratory support for patients with critical respiratory system diseases, and can improve the blood oxygen content of the patients in time, but causes new lung injury, i.e. mechanical ventilation induced lung injury (VILI). Although protective mechanical ventilation strategies are widely used in patients with acute respiratory distress syndrome (ARDS), the mortality rate is still close to 50%.

[0003] The main clinical manifestation of VILI is inflammation. In order to explore the mechanism and possible treatment targets of VILI, a large number of studies have explored the inflammation of airway epithelial cells and immune cells caused by high stretching (> 10% strain) in mechanical ventilation, and tried to develop antibodies or small molecule drugs targeting inflammatory factors such as tumor necrosis factor alpha (TNF-α), interleukin (IL), transforming growth factor beta (TGF-β), but the drug experiments for VILI all ended in clinical failure, which suggests that the mechanism of VILI needs to be explored from a new angle.

[0004] Airway smooth muscle cells are cells in the airway that are extremely sensitive to stretching stimulation, and will change their phenotypes and participate in the pathological process of various chronic airway inflammatory diseases such as asthma under the action of stretching, but the role of airway smooth muscle cells in VILI and its signal response mechanism need to be further explored.

[0005] In recent years, small RNA, as a new type of post-transcriptional regulatory molecule, mediates mRNA inhibition and degradation, and is proved to be widely involved in the occurrence and development process of various airway diseases, which provides a new idea for exploring the mechanical signal response mechanism of VILI and possible drug action targets.

[0006] At present, there is no report on the use of miR-12136 inhibitor for treating mechanical ventilation induced lung injury. SUMMARY

[0007] Invention purposes: The present application aims to provide a miR-12136 inhibitor and its application in preparing a drug for preventing and / or treating mechanical ventilation induced lung injury. The present application discloses for the first time that the miR-12136 inhibitor can be used in preparing a drug for reducing lung injury caused by mechanical ventilation, thereby being used in preventing and treating mechanical ventilation induced lung injury, etc., and has a wide application prospect.

[0008] Technical solutions: The purposes of the present application are achieved by the following technical solutions:

[0009] The present application provides a miR-12136 inhibitor, which comprises a nucleotide sequence as shown in SEQ ID No. 1.

[0010] SEQ ID No. 1: AAGGCCUCCAUGACUUUUUC.

[0011] The present application also provides an application of the above-mentioned miR-12136 inhibitor in preparing a drug for preventing and / or treating mechanical ventilation induced lung injury.

[0012] The miR-12136 inhibitor targets and inhibits the function of non-coding small RNA miR-12136 in cells, thereby specifically increasing the expression of caveolin 2.

[0013] The miR-12136 inhibitor prevents the secretion of cell inflammatory factors caused by mechanical stretching by down-regulating the level of airway cell miR-12136, especially prevents the increase of TGF-beta 2 and IL-6 secretion.

[0014] The miR-12136 inhibitor inhibits mechanical ventilation induced lung injury by increasing the expression of caveolin 2.

[0015] The present application also provides a drug for preventing and / or treating mechanical ventilation induced lung injury, which comprises a safe and effective amount of the above-mentioned miR-12136 inhibitor.

[0016] The dosage of the miR-12136 inhibitor is 0.05-10 mg / kg.

[0017] The drug also comprises a pharmaceutically acceptable carrier.

[0018] The "pharmaceutically acceptable carrier" includes any or all of physiologically compatible solvents, dispersion media, coatings, isotonic agents, absorption promoters and absorption retardants, etc. Examples of the pharmaceutically acceptable carrier include water, salt solutions, phosphate buffered saline (PBS), monosaccharides, disaccharides, oligosaccharides, polysaccharides (dextrin, dextran, isomaltodextrin, cellulose, pullulan, chitin, chitosan, guar gum, carrageenan, etc.), saccharides and their derivatives, glycerol, alcohols such as ethanol, and the like, which can be used alone or in appropriate combination.

[0019] Preferably, the pharmaceutically acceptable carrier is a phosphate buffered solution or physiological saline.

[0020] The dosage form of the drug is an injection or a spray.

[0021] When used as an injection, one or more of a pH adjuster, an isotonic agent, and the above-mentioned saccharides, sugar alcohols such as mannitol, sorbitol, maltitol, and sodium chloride can be appropriately combined.

[0022] One preferred aspect of the use of the miR-12136 inhibitor as an effective ingredient in the preparation of a drug for reducing mechanical ventilation-induced lung injury is that the miR-12136 inhibitor is a drug for treating mechanical ventilation-induced lung injury.

[0023] The "treatment" of the present application refers to reducing, inhibiting and / or reversing the development of mechanical ventilation-induced lung injury in a subject in need thereof. The term "treatment" includes any indication of successful prevention or improvement of mechanical ventilation-induced lung injury, including any objective or subjective parameters, such as reduction, alleviation; reduction of symptoms or making the subject more tolerant of the injury, pathology or condition; delay or slowing of the rate of development, etc. The measurement of treatment or improvement can be based on the results of physical examination, pathological examination and / or diagnostic examination known in the art, for example.

[0024] Advantages:

[0025] The present application provides a miR-12136 inhibitor. It has been found through experiments that the miR-12136 inhibitor of the present application can inhibit the function of miR-12136, promote the expression of caveolin 2, and inhibit the secretion of inflammatory factors, thereby improving mechanical ventilation-induced lung injury. The present application first discloses the use of specific miRNA design to prepare a drug for directional regulation of airway smooth muscle cell inflammatory factor secretion, thereby inhibiting lung injury caused by mechanical ventilation. Therefore, the miR-12136 inhibitor of the present application can be used to prepare a drug for preventing and / or treating mechanical ventilation-induced lung injury, and has a wide application prospect when used to prevent or treat mechanical ventilation-induced lung injury. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 Effects of mechanical stretch on airway smooth muscle cell miRNAs expression; wherein, Figure 1 A is the length distribution of miRNAs; Figure 1 B is the principal component analysis of differentially expressed miRNAs; Figure 1 C is the miRNAs differentially expressed wein plot; Figure 1 D is the volcano plot of differentially expressed miRNAs; Figure 1 E is the column chart of miRNAs with significant changes (│log2FC│>1, P<0.01, count>10).

[0027] Figure 2 Effects of mechanical stretch on airway smooth muscle cell differentially expressed mRNAs volcano plot (A), differentially expressed miRNAs-differentially expressed mRNAs interaction plot (B). Figure 2 Figure 2

[0028] Figure 3 Effects of miR-12136 mimic and miR-12136 inhibitor on airway smooth muscle cell miR-12136 expression (A), cell activity (B), caveolin 2 (CAV2) expression (C) and specificity analysis of targeting miR-12136 (D). Figure 3 Figure 3 Figure 3 Figure 3

[0029] Figure 4 Effects of miR-12136 inhibitor on mechanical stretch-induced increase of airway smooth muscle cell inflammatory factor secretion; wherein, Figure 4 A is the change of TGF-β2 secretion; Figure 4 B is the change of IL-6 secretion; Figure 4 C is the change of CAV2 expression; Figure 4 D is the number of caveolae; Figure 4 E, Figure 4 F are the changes of TGF-β2 and IL-6 secretion under mechanical stretch, respectively.

[0030] Figure 4 Effects of miR-12136 inhibitor on mechanical ventilation-induced lung injury in mice; wherein, Figure 5 A is the HE and IHC staining results; Figure 5 B is the analysis of airway epithelial cell shedding; Figure 5 C is the expression of CAV2 by immunohistochemical analysis; Figure 5 D, Figure 5 E are the secretion of TGF-β2 and IL-6 in bronchoalveolar lavage fluid, respectively. DETAILED DESCRIPTION​​​​​​

[0031] The technical solutions of the present application will be described in detail below through specific examples, but the protection scope of the present application is not limited to the examples.

[0032] Unless otherwise specified, the experimental methods, detection methods, and preparation methods used in the present application all use conventional techniques in the art.

[0033] Example 1 Mechanical ventilation-related high stretch causes changes in miR-12136-CAV2 signal of airway smooth muscle cells

[0034] (1) Experimental subjects

[0035] Primary cultured human airway smooth muscle cells (#BNCC339826, Beina Biological Technology Co., Ltd.).

[0036] (2) Experimental instruments

[0037] Flexcell 5000 cell stretcher, 6-well stretching plate, clean bench, CO2 cell incubator, low-speed centrifuge, cell counting plate, constant temperature water bath, autoclave.

[0038] (3) Experimental methods

[0039] After the primary cultured human airway smooth muscle cells were cultured on the surface of the stretching plate for 24 h using DMEM basic medium + 10% fetal bovine serum (37°C, saturated humidity), they were replaced with serum-free medium; one group of stretching plates was placed in the Flexcell 5000 cell stretcher, set to 13% stretching amplitude, and stretched for 72 h (frequency 0.5 Hz) to simulate the mechanical stretching conditions of mechanical ventilation. Another group of stretching plates were cultured statically (as a control group).

[0040] The RNA of the mechanically stretched in vitro cultured airway smooth muscle cells was collected, and high response miRNAs molecules and their target genes were screened through whole genome RNA sequencing (RNASeq) and bioinformatics analysis (KEGG, GO, and PPI network analysis).

[0041] (4) Experimental results

[0042] To screen the miRNAs that respond to mechanical stretching of in vitro cultured airway smooth muscle cells, miRNA sequencing analysis was performed.

[0043] Figure 5 The miRNAs length analysis results shown in A indicate that the miRNAs expressed by airway smooth muscle cells are mainly 22 bases long.

[0044] Figure 1The principal component analysis of B showed that the expression profile of miRNAs in airway smooth muscle cells changed significantly after stretching treatment, indicating that stretching had a significant effect on the expression of miRNAs in airway smooth muscle cells. The first two principal components (principal components 1, PC1; principal components 2, PC2) accounted for 61.87% of the changes in the data set, of which PC1 accounted for 46.23% and PC2 accounted for 15.64%.

[0045] Figure 1 The Venn diagram shown in C shows that in the stretched airway smooth muscle cells, 33 miRNAs are up-regulated, 43 miRNAs are down-regulated, and 1428 miRNAs have no significant change in expression.

[0046] Figure 1 The volcano plot of D shows the distribution of differentially expressed miRNAs (│log2FC│>1, P<0.01, count value>10). The results show that miR-12136 is the miRNA with the highest degree of differential expression.

[0047] Figure 1 E shows that stretching causes 12 differentially expressed miRNAs in airway smooth muscle cells to be up-regulated and down-regulated, respectively, which are miR-12136, miR-192-5p, miR-146a-5p, miR-194-5p, miR-29b-3p, miR-148a-3p, miR-137-3p, and miR-335-3p, miR-485-3p, miR-543, miR-27b-5p, miR-370-5p. The results show that miR-12136 is the miRNA with the highest fold change in expression.

[0048] To screen the target genes of differentially expressed miRNAs, the mRNA sequencing results of airway smooth muscle cells treated with stretching or not were analyzed.

[0049] Figure 1 The volcano plot shows the distribution of differentially expressed genes in airway smooth muscle cells (│log2FC│>1, P<0.05). The results show that 2858 differentially expressed genes (1466 down-regulated, 1392 up-regulated) are identified. The top 10 differentially expressed genes up-regulated are LAMP3, GPR1, HYOU1, ERO1B, RPLP0P2, SDF2L1, INHBE, PDIA4, CRELD2, IL31RA. The top 10 differentially expressed genes down-regulated are LBH, LMOD1, NREP, TUBA1A, TUBA1B, CNN1, PDLIM7, TAGLN, GBP1, IRAG1.

[0050] The 283 target genes of the 12 differentially expressed miRNAs were identified by analyzing the target genes of the 12 differentially expressed miRNAs through the miRand website, overlapping gene screening with 2858 differentially expressed genes, and defining them as target genes of the differentially expressed miRNAs. The miRNA-mRNA interaction network was constructed by String (see Figure 2 B), consisting of a total of 390 pairs of miRNA-mRNA pairs.

[0051] Among them, miR-12136 is the most sensitive miRNA to the stretching reaction, and only two target genes (CAV2 and ZNF106). Caveolin 2 (CAV2) is an important component of caveolae, which controls the phenotypic plasticity of airway smooth muscle cells, and studies have shown that the absence of caveolin 2 induces lung inflammation. This suggests that miR-12136 mediates the inflammatory response of airway smooth muscle cells induced by stretching by targeting CAV2.

[0052] Example 2 miR-12136 inhibitor targets to inhibit the function of miR-12136 to promote the expression of CAV2

[0053] (1) Experimental object

[0054] Primary cultured human airway smooth muscle cells (#BNCC339826, BeNa Biotech), HEK-293T cells (#BNCC353535, BeNa Biotech).

[0055] (2) Experimental instrument

[0056] Microplate reader, live cell workstation, clean bench, CO2 cell incubator, low-speed centrifuge, cell counting plate, constant temperature water bath, autoclave, confocal culture dish, real-time fluorescence quantitative PCR, confocal microscope.

[0057] (3) Experimental method

[0058] Airway smooth muscle cells (1×10 5 cell / cm 2 ) were inoculated into a 6-well plate and cultured in a 37℃ incubator for 24h. When the cells adhered and grew to 60%-70% density, the primary cultured human airway smooth muscle cells were treated with miR-12136 mimic and the corresponding mimic control, miR-12136 inhibitor and the corresponding inhibitor control (50nM per group, transfection was performed with lipofectamine 3000 (Invitrogen), and the operation method was performed according to the manufacturer's instructions, 37℃, saturated humidity for 48h).

[0059] miR-12136 mimic:

[0060] GAAAAAGUCAUGGAGGCCUU; GGCCUCCAUGACUUUUUCUU; working concentration 50 nM (solvent is DEPC water), universal biosynthesis.

[0061] miR-12136 mimic control:

[0062] UUCUCCGAACGUGUCACGUUU; ACGUGACACGUUCGGAGAAUU; working concentration 50 nM (solvent is DEPC water), universal biosynthesis.

[0063] miR-12136 inhibitor:

[0064] AAGGCCUCCAUGACUUUUUC, working concentration 50 nM (solvent is DEPC water), universal biosynthesis.

[0065] miR-12136 inhibitor control:

[0066] CAGUACUUUUGUGUAGUACAA, working concentration 50 nM (solvent is DEPC water), universal biosynthesis.

[0067] qPCR, CCK8 analysis, dual luciferase reporter analysis were used to detect the expression of airway smooth muscle cell miR-12136 and CAV2, cell activity and specific targeting CAV2, and whether miR-12136 mimic and miR-12136 inhibitor affect the expression of miR-12136 in cells and whether they target and regulate the expression of CAV2.

[0068] The reverse transcription reaction of miR-12136 was completed using a microRNA stem loop reverse transcription kit (Nanjing Novozyme Bio).

[0069] The specific steps are as follows:

[0070] In 200 μL of enzyme-free EP tube, add about 1000 ng of total RNA and 2 μL of 5×gDNA wiper mix, and then add DEPC water to prepare 10 μL of system reaction solution. Mix gently and centrifuge for a few seconds, and incubate at 42°C for 2 min on a PCR instrument. Add 1 μL of Stem-loop primer (2 μM), 2 μL of 10×RT Mix, 2 μL of HiScriptⅡEnzyme Mix, and 5 μL of DEPC water in sequence in the mixed solution to prepare 20 μL of system. Mix gently and centrifuge for a few seconds, and complete 25°C for 5 min, 50°C for 15 min, and 85°C for 5 min on a PCR instrument. Detect the cDNA concentration by a NanoDrop 2000 spectrophotometer, and store at -20°C.

[0071] miR-12136 primer:

[0072] Forward primer: CGCGCGGAAAAAGTCATG;

[0073] Reverse primer: AGTGCAGGGTCCGAGGTATT.

[0074] CAV2 primer:

[0075] Forward primer: CCGCTCGAGAGACAGTTTTGCTTTAGT;

[0076] Reverse primer: AAGGAAAAAAGCGGCCGCTATTCTCAGTATGCCAGT.

[0077] The above primers are synthesized by General Biosystems.

[0078] The CCK8 kit (C0038, Bi Yun Tian) is used to detect cell activity.

[0079] The specific process is as follows: after treatment with miR-12136 mimics, inhibitors, and respective controls (50 nM per group, transfection is performed using lipofectamine 3000 (Invitrogen), and the operation method is performed according to the instructions provided by the manufacturer, incubation at 37°C under saturated humidity conditions for 48 h), 10 μL of CCK8 solution is added to each well, incubation at 37°C for 4 h, and the absorbance is detected at 450 nm by an enzyme-labeled instrument.

[0080] The qPCR of miR-12136 is completed using the miRNA Universal SYBR qPCR Master Mix (Nanjing Novozyme Biological Technology).

[0081] The internal reference gene is Rnu6 (U6 small nuclear RNA), and the primer information is as follows:

[0082] Forward primer: CTCGCTTCGGCAGCACA;

[0083] Reverse primer: AACGCTTCACGAATTTGCGT.

[0084] The above primers were synthesized by General Biosynthesis.

[0085] 10 μL qPCR reaction system contained DEPC water, 8.2 μL; cDNA, 1 μL; 10 μM forward primer, 0.4 μL; 10 μM reverse primer, 0.4 μL; SYBR, 10 μL.

[0086] After all reagents were added, the qPCR 96-well plate was covered with film, centrifuged briefly at 4°C, and then the StepOne software was used to run the reaction program (95°C for 5 min; 95°C for 10 s, 56°C for 30 s, 72°C for 30 s, cycle 40 times; 4°C for 1 h). The 2 -ΔΔCT method was used for calibration and normalization. The fold change of miRNA expression was calculated as the ratio of the experimental group to the control group according to the 2 -ΔΔCT values obtained from three independent experiments.

[0087] The dual luciferase reporter experiment was used to verify that miR-12136 targets CAV2. A dual luciferase reporter plasmid (psiCHECK-2-CAV2-3'-UTR) containing the 3'-UTR sequence of CAV2 (NM 001206747) was constructed. The specific method was as follows:

[0088] After the base sequence of the 3'-UTR segment of the CAV2 gene was retrieved from the NCBI database, PCR primers were designed using Primer 5.0 software (forward primer: CCGCTCGAGAGACAGTTTTGCTTTAGT; reverse primer: AAGGAAAAAAGCGGCCGCTATTCTCAGTATGCCAGT), and the primers were synthesized by Anhui General Biosynthesis Company.

[0089] PCR was performed using HEK293T cell genomic cDNA as template. The reaction system was 50 μL: 2x PhantaMax Buffer 25 μL; dNTPMix (10 mM) 1 μL; upstream and downstream primers (10 μM) 2 μL each; cDNA 5 μL; PhanptaMax Super-Fidelity DNA polymerase 1 μL; add water to 50 μL. The reaction conditions were: 95 °C pre-denaturation for 5 min, 95 °C denaturation for 15 s, then 56 °C annealing for 15 s, 72 °C extension for 30 s, for a total of 35 cycles; 72 °C continued extension for 5 min, then 4 °C storage. After the PCR reaction, 2 μL of the product was subjected to 1% agarose electrophoresis analysis. After purifying the product according to the gel purification kit instructions, the above PCR product and the vector were double-digested with XhoI and NotI, and the double luciferase reporter vector (psiCHECK-2) was connected to the CAV2 gene 3'-UTR fragment using T4 DNA ligase. The reaction system was a mixture of PCR product and luciferase reporter vector at a ratio of 3:1. 100 μL of the ligation reaction product was added to the competent DH5a, plated and single colony bacteria were picked, and the plasmid was extracted after amplification. After single and double digestion, the correct one was verified by agarose gel, and the recombinant double luciferase reporter vector was sent for sequencing identification (Anhui General System Co., Ltd.). The recombinant vector with correct sequencing identification was named psiCHECK-2-CAV2-3'-UTR.

[0090] HEK-293T cells were seeded into opaque white 96-well plates. Before transfection, the medium was replaced with serum-free medium, and lipofectamine 3000 was used for transfection according to the manufacturer's instructions.

[0091] The experimental groups were as follows: transfection of miR-12136 mimic; transfection of psiCHECK-2-CAV2-3'-UTR plasmid; co-transfection of miR-12136 mimic and psiCHECK-2-CAV2-3'-UTR plasmid.

[0092] Dual luciferase reporter gene detection kit (Bi Yun Tian) was used to detect the luciferase activity 48 h after transfection, and the specific operation was carried out according to the kit instructions. The activation of the reporter gene was identified according to the fluorescence ratio.

[0093] (4) Experimental results

[0094] Figure 2A shows the change of miR-12136 expression in airway smooth muscle cells after transfection of miR-12136 mimics and inhibitors detected by qPCR. The results show that miR-12136 mimics can significantly up-regulate miR-12136, while miR-12136 inhibitors can significantly down-regulate miR-12136.

[0095] Figure 3 B shows the cell activity of airway smooth muscle cells detected by CCK8. The results show that miR-1216 mimics and miR-12136 inhibitors have no significant effect on the cell activity of airway smooth muscle cells.

[0096] Figure 3 C shows the mRNA expression of CAV2 in airway smooth muscle cells detected by qPCR. The results show that the expression of CAV2 in airway smooth muscle cells transfected with miR-12136 mimics is significantly reduced compared with the mimic control. On the contrary, the expression of CAV2 in airway smooth muscle cells transfected with miR-12136 inhibitors is significantly increased compared with the inhibitor control. This suggests that miR-12136 targets CAV2 and directly affects the expression of CAV2 in airway smooth muscle cells.

[0097] Figure 3 D shows the results of HEK-293T cell dual luciferase reporter experiment. The binding site of miR-12136 on CAV2 is as shown in Figure 3 D shows the results of HEK-293T cell dual luciferase reporter experiment. The binding site of miR-12136 on CAV2 is as shown in Figure 3 D shows the results of HEK-293T cell dual luciferase reporter experiment. The binding site of miR-12136 on CAV2 is as shown in

[0098] Example 3: miR-12136 inhibitor reduces the secretion of inflammatory factors caused by mechanical ventilation related stretching

[0099] (1) Experimental object

[0100] Primary cultured human airway smooth muscle cells (#BNCC339826, Beina Biological Technology Co., Ltd.)

[0101] (2) Experimental instruments

[0102] Flexcell 5000 cell stretching instrument, 6-well stretching plate, microplate reader, confocal microscope live cell workstation, detachable 96-well plate, super-clean workbench, CO2 cell incubator, low-speed centrifuge, cell counting plate, constant temperature water bath, high-pressure sterilization pot, confocal culture dish.

[0103] (3) Experimental method

[0104] After culturing airway smooth muscle cells in DMEM basic medium + 10% fetal bovine serum medium for 24 h, the medium was replaced with serum-free medium, and the cultured cells were treated with miR-12136 mimic, miR-12136 inhibitor and corresponding controls (miR-12136 mimic, mimic control, miR-12136 inhibitor, and inhibitor control, which are the same as in Example 2) for 72 h. The culture supernatant was collected, and ELISA was used to detect the secretion of TGF-β2 (EK9162, Link Biological) and IL-6 (EK0410, Doctor Deer Biological) from airway smooth muscle cells.

[0105] Primary cultured human airway smooth muscle cells were seeded on the surface of a stretching plate. After culturing in DMEM basic medium + 10% fetal bovine serum medium (37°C, saturated humidity) for 24 h, the medium was replaced with serum-free medium, and one group of stretching plates was placed in a Flexcell5000 cell stretcher, set to a stretching amplitude of 13%, and stretched for 72 h (frequency 0.5 Hz) to simulate the mechanical stretching conditions of mechanical ventilation. Another group of stretching plates was cultured statically (control group). The supernatant of the in vitro cultured airway smooth muscle cells subjected to mechanical stretching was collected, and ELISA was used to detect the secretion of inflammatory factors from airway smooth muscle cells.

[0106] After treating primary cultured human airway smooth muscle cells with miR-12136 inhibitor and then subjecting them to the above mechanical stretching, ELISA was used to detect the secretion of TGF-β2 and IL-6 from airway smooth muscle cells, Western blot and immunofluorescence techniques were used to analyze the expression of CAV2, and the effect of miR-12136 inhibitor treatment on the secretion of inflammatory factors and the expression of CAV2 under mechanical stretching conditions was analyzed.

[0107] (4) Experimental results

[0108] Figure 3 A, Figure 4 B shows the detection of inflammatory factors TGF-β2 and IL-6 in airway smooth muscle cells treated with miR-12136 mimic, inhibitor and controls by ELISA. The data show that, compared with the control group, upregulation of miR-12136 in airway smooth muscle cells increases the secretion of inflammatory factors TGF-β2 and IL-6 to varying degrees. After downregulation of miR-12136, the expression of these inflammatory factors is significantly reduced. The experimental results show that miR-12136 regulates the expression of inflammatory factors in airway smooth muscle cells.

[0109] Figure 4 C, Figure 4D Western blot and immunofluorescence staining were used to detect the expression changes of CAV2 in airway smooth muscle cells. Figure 4 C The results showed that mechanical stretch significantly reduced the expression of CAV2, but the miR-12136 inhibitor prevented the expression changes in airway smooth muscle cells caused by mechanical stretch. Figure 4 D The results of immunofluorescence staining detection were similar to those of Western blot detection, suggesting that the miR-12136 inhibitor can prevent the decrease in intracellular CAV2 expression caused by mechanical stretch.

[0110] Figure 4 E、 Figure 4 F The results of ELISA detection of TGF-β2 and IL-6 expression in airway smooth muscle cells after mechanical stretch treatment also showed that the miR-12136 inhibitor can prevent the secretion of TGF-β2 and IL-6 in cells caused by mechanical stretch.

[0111] Example 4 miR-12136 inhibitor reduces mechanical ventilation-induced lung injury

[0112] (1) Experimental subjects

[0113] C57BL / 6 mice (Changzhou Cavens Experimental Animal Co., Ltd.), 18-22 grams, 6-8 weeks old.

[0114] (2) Experimental instruments

[0115] Ultra-clean workbench, constant temperature water bath, microscope, FlexiVent small animal lung function instrument, paraffin sectioning machine.

[0116] (3) Experimental method

[0117] Mechanical ventilation: C57BL / 6 mice were randomly divided into healthy group, mechanical ventilation group and miR-12136 inhibitor treatment group (i.e. miR-12136 inhibitor + mechanical ventilation).

[0118] After weighing, the mice were intraperitoneally injected with 1% sodium barbital at a dose of 60 mg / kg to anesthetize the mice. After 2-3 min, the mice fell down and were placed on their backs. The head and four legs of the mice were fixed, and the neck of the mice was wiped with an alcohol cotton ball. A T-shaped opening was cut under the neck with surgical scissors, and the connective tissue of the neck was torn off with forceps to expose the main trachea. A suture soaked in normal saline was passed under the main trachea, and the main trachea was cut 1 / 3 open at 2-3 cartilage rings under the neck with surgical scissors. An 18G intravenous indwelling needle was inserted into the main trachea for about 4 mm long and fixed with the suture under the trachea. The mouse with the inserted tube was placed on the experimental table, and the indwelling needle was connected to the atomization adapter so that the mouse and the atomization adapter were at the same horizontal plane. The FlexiVent small animal lung function instrument was used for mechanical ventilation, and the lung resistance was measured. The parameter settings were as follows: tidal volume 18 mL / kg, 60 breaths per minute, and ventilation time 3 h.

[0119] The miR-12136 inhibitor treatment group was subjected to mechanical ventilation after inhaling 0.5 mg / kg of miR-12136 inhibitor (the same as in Example 2) for 30 min before mechanical ventilation.

[0120] Collection of alveolar lavage fluid: the mouse with measured lung function was taken off the operating table, 0.5 mL of 4°C pre-cooled 1xPBS was slowly injected, soaked for 30 s, recovered in an EP tube, and lavaged back and forth for 3 times to ensure that the recovery rate was above 80%, and stored on ice; the lavage fluid was centrifuged with a 4°C refrigerated centrifuge, the supernatant was recovered, and the centrifuge parameters were set to 1500 rpm for 10 min. The supernatant was stored at -80°C. The content of TGF-β2 (ab277719, abcam) and IL-6 (SRAB0308, Sigma-Aldrich) in the alveolar lavage fluid was detected by an ELISA kit.

[0121] (4) Experimental results

[0122] Figure 4 A shows the results of HE and IHC staining after mechanical ventilation of mice. The results of HE staining show that a large number of airway epithelial cells are shed, alveoli are collapsed, and the shape of the airway is irregular after mechanical ventilation. However, after the mice were pretreated with the miR-12136 inhibitor and then subjected to mechanical ventilation, the above-mentioned phenomena were not obvious. The results of IHC staining show that the expression of CAV2 in the lung tissue significantly decreased after mechanical ventilation, and pretreatment with the miR-12136 inhibitor prevented the decrease in the expression of CAV2 caused by mechanical ventilation.

[0123] Figure 5 B and Figure 5 C shows the results of counting the shedding of airway epithelial cells and quantifying the expression of CAV2. The experimental results show that mechanical ventilation induces the shedding of airway epithelial cells and the decrease in the expression of CAV2, and the miR-12136 inhibitor prevents the above-mentioned phenomena.

[0124] The results showed that the miR-12136 inhibitor prevented the increase of TGF-β2 and IL-6 in the bronchoalveolar lavage fluid induced by mechanical ventilation (see Fig. 6A and Fig. 6B). Figure 5 D、 Figure 5 Figure 5 E). The results suggested that the miR-12136 inhibitor inhibited the secretion of airway inflammatory factors induced by mechanical ventilation.

[0125] The present application first revealed that the high amplitude (13%) mechanical stretch simulating mechanical ventilation increased the expression of miR-12136 and the secretion of inflammatory factors in airway smooth muscle cells in vitro, and the miR-12136 inhibitor could prevent the decrease of CAV2 expression and the secretion of inflammatory factors induced by mechanical stretch. At the animal level, mechanical ventilation induced airway inflammation and tissue collapse. The miR-12136 inhibitor could prevent the secretion of inflammatory factors induced by mechanical ventilation at the animal level, thereby preventing the lung injury induced by mechanical ventilation. It is suggested that the miR-12136 inhibitor can be used for preparing a drug for inhibiting lung injury induced by mechanical ventilation, thereby being used for mechanical ventilation patients, etc., and has a broad application prospect.

[0126] As described above, although the present application has been shown and described with reference to specific preferred embodiments, it is to be understood that various modifications and changes can be made thereto without departing from the spirit and scope of the application as defined in the appended claims.

Claims

1. A miR-12136 inhibitor, characterized in that, The inhibitor comprises a nucleotide sequence as shown in SEQ ID No. 1: SEQ ID No. 1: AAGGCCUCCAUGACUUUUUC.

2. Use of the miR-12136 inhibitor of claim 1 in the preparation of a medicament for preventing and / or treating mechanical ventilation-induced lung injury.

3. Use according to claim 2, characterized in that, The miR-12136 inhibitor targets and inhibits the function of non-coding small RNA miR-12136 in cells, thereby specifically increasing the expression of caveolin 2.

4. Use according to claim 2, characterized in that, The miR-12136 inhibitor prevents the increase in secretion of cell inflammatory factors TGF-β2 and IL-6 caused by mechanical stretching by down-regulating the level of miR-12136 in airway cells.

5. Use according to claim 2, characterized in that, The miR-12136 inhibitor inhibits mechanical ventilation-induced lung injury by increasing the expression of caveolin 2.

6. A drug for preventing and / or treating mechanical ventilation-induced lung injury, characterized by, The medicament comprises a safe and effective amount of the miR-12136 inhibitor of claim 1.

7. The medicament according to claim 6, characterized in that, The medicament further comprises a pharmaceutically acceptable carrier.

8. The medicament according to claim 7, characterized in that, The pharmaceutically acceptable carrier is a phosphate buffer solution or physiological saline.

9. The medicament according to claim 6, characterized in that, The dosage form of the medicament is an injection or a spray.

Images