Targeted macrophage knock-down C5aR1 AAV virus and application thereof

Abstract

The invention relates to a macrophage-targeted C5aR1 knock-down AAV virus and an application thereof. By adopting an adeno-associated virus vector system driven by an F4 / 80 promoter, macrophage specific C5aR1 gene knock-down is successfully realized through caudal vein injection, and the expression quantity of the macrophage specific C5aR1 gene knock-down is obviously reduced by more than 90% (AAV.shC5aR1 vs AAV.null, Plt, 0.01). The key regulation effect of the C5aR1 gene in the CCl4-induced hepatic fibrosis process is clarified for the first time, it is proved that targeted knock-down macrophage C5aR1 can remarkably improve liver function indexes, relieve inflammatory response and reverse the fibrosis process, an ideal preclinical research model is provided for developing C5aR1-targeted hepatic fibrosis treatment drugs, and the C5aR1-targeted hepatic fibrosis treatment drugs have important clinical application value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and liver disease research, specifically involving AAV viruses that target macrophages to knock down C5aR1 and their applications. Background Technology

[0002] Liver fibrosis is a pathological process resulting from tissue repair dysfunction following chronic liver injury, characterized by excessive extracellular matrix deposition, which can further develop into cirrhosis and even hepatocellular carcinoma. Currently, CCl4 induction is the most commonly used animal model construction method for studying liver fibrosis, but traditional models have limitations such as the inability to specifically regulate key target genes. Macrophages play a core regulatory role in the process of liver fibrosis, and their activation state directly affects the inflammatory response and fibrosis progression. Studies have shown that the complement system component C5a participates in regulating macrophage polarization through its receptor C5aR1, but the specific mechanism of action of C5aR1 in liver fibrosis remains unclear.

[0003] Existing liver fibrosis models have the following main defects: (1) they cannot achieve cell type-specific gene regulation; (2) they cannot simultaneously meet the needs of gene function research and drug screening. Adeno-associated virus vectors have become an important tool for gene therapy due to their strong tissue targeting and high safety, but there are no reports of liver fibrosis models that use F4 / 80 promoter-driven AAV vectors to specifically knock down the macrophage C5aR1 gene.

[0004] Therefore, there is an urgent need in this field to develop an animal model that can accurately simulate the pathological features of human liver fibrosis, achieve macrophage-specific gene regulation, and has a high success rate in construction, so as to provide an ideal research platform for elucidating the role of C5aR1 in liver fibrosis and developing targeted therapeutic drugs. Summary of the Invention

[0005] This invention relates to AAV viruses that target macrophages to knock down C5aR1 and their applications, belonging to the fields of genetic engineering and liver disease research.

[0006] The technical solution of the present invention is as follows: A tool sequence, wherein the tool sequence is a DNA sequence encoded by C5aR1-shRNA, as shown in SEQ ID No. 2.

[0007] A recombinant plasmid, the recombinant plasmid being circular, comprising the tool sequence as described in claim 1, and comprising an EGFP sequence and an F4 / 80 promoter sequence as shown in SEQ ID No. 1.

[0008] An adeno-associated virus for targeted knockdown of the C5aR1 gene in macrophages, packaged with the recombinant plasmid as described in claim 2.

[0009] A gene manipulation tool for treating liver fibrosis, comprising the recombinant adenovirus as described in claim 3.

[0010] The aforementioned gene manipulation tools can specifically target macrophages in the body and are used in screening liver fibrosis treatment drugs that target C5aR1.

[0011] The aforementioned gene manipulation tools can specifically target macrophages in the body and have been applied in studies assessing the regulation of liver fibrosis by the C5aR1 gene. The aforementioned gene manipulation tools can specifically target macrophages in the body and have applications in liver injury, liver fibrosis, and liver cancer.

[0012] A method for constructing a CCl4-induced liver fibrosis mouse model targeting macrophage C5aR1 knockdown, using an adeno-associated virus vector system driven by the F4 / 80 promoter, wherein the F4 / 80 promoter sequence is shown in SEQ ID No. 1, macrophage-specific C5aR1 gene knockdown is achieved via tail vein injection, and the constructed model meets the following conditions: a) Macrophage C5aR1 expression decreased by more than 90%; b) Serum transaminase levels returned to near baseline levels; c) The expression levels of inflammatory factors (TNFα, IL1β, IL6) in liver tissue were significantly lower than those in the CCl4 group; d) The area of ​​inflammatory infiltration in liver tissue was significantly reduced compared to the CCl4 group; e) The area of ​​liver fibrosis was significantly reduced compared to the CCl4 group.

[0013] Furthermore, the adeno-associated virus vector contains a C5aR1-shRNA sequence, and the shRNA sequence targeting C5aR1 is Sh-C5aR1, as shown in SEQ ID No. 2. Its knockout efficiency was verified by qPCR and immunofluorescence detection of C5aR1 mRNA and protein expression levels.

[0014] Furthermore, the model construction includes the following steps: 1) AAV.shC5aR1 virus and control group AAV.Ctrl virus were injected via tail vein; the characteristic sequence of AAV.shC5aR1 virus is shown in SEQ ID No. 3; 2) Adeno-associated virus injection began 2 weeks after CCl4 induction; 3) Administer intraperitoneal injections of 10% CCl4, dissolved in olive oil, twice a week for 6 weeks; 4) Serum liver function was tested 48 hours after the last injection; 5) The expression levels of TNFα, IL1β, and IL6 mRNA in liver tissue were detected by qPCR; 6) Assess the area of ​​inflammatory infiltration using HE staining; 7) Assess the area of ​​fibrosis by Masson and sirus red staining.

[0015] Furthermore, in step 1), the viral injection dose is 5 × 10^11 vg / animal.

[0016] Furthermore, in step 3), the CCl4 injection dose is 0.75 mL / kg body weight.

[0017] Furthermore, the model has a success rate of over 90%.

[0018] The application of liver fibrosis mouse models constructed by any of the above methods in screening liver fibrosis therapeutic drugs targeting C5aR1.

[0019] The application of the liver fibrosis mouse model constructed by any of the above methods in evaluating the study of C5aR1 gene regulation of liver fibrosis process.

[0020] The application of adeno-associated virus vectors with C5aR1 gene knockdown in the preparation of drugs for the treatment of liver fibrosis: macrophage-specific C5aR1 gene knockdown is achieved using the aforementioned adeno-associated virus vector system.

[0021] Furthermore, the adeno-associated virus vector is administered via tail vein injection at a dose of 5 × 10^11 vg / animal.

[0022] Beneficial effects: This invention boasts a high success rate and clinical relevance: the model construction success rate exceeds 90%. It is the first to demonstrate the crucial regulatory role of the C5aR1 gene in the CCl4-induced liver fibrosis process; targeted knockdown of macrophage C5aR1 significantly improves liver function, reduces inflammation, and reverses fibrosis. Drug development value: It provides an ideal preclinical research model for developing C5aR1-targeted therapies for liver fibrosis, possessing significant translational medical implications. This invention provides a stable and efficient liver fibrosis research model that can be used to screen and evaluate C5aR1-targeted treatment strategies, offering an important tool for liver fibrosis drug development. Attached Figure Description

[0023] Figure 1 A schematic diagram of the construction of a CCl4 mouse model by targeting and knocking down the C5aR1 gene in macrophages using an adeno-associated virus vector.

[0024] Figure 2 Verification diagram of mRNA and protein after C5aR1 gene knockdown construction.

[0025] Figure 3 The liver function levels of model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4) were measured.

[0026] Figure 4 The levels of inflammatory factors in model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4) are shown.

[0027] Figure 5 The images show the pathological changes of liver hepatic hematoxylin and eosin (HE) staining in model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4).

[0028] Figure 6 The images show the Masson and Sirus red staining pathological changes in the livers of model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4).

[0029] Figure 7 This is a schematic diagram of the carrier element of the present invention. Detailed Implementation

[0030] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0031] like Figure 1-7 As shown, A method for constructing a CCl4 mouse model that targets and knocks down the C5aR1 gene in macrophages includes the following steps: a. Construction of AAV carrier Using gene cloning technology, a shRNA sequence targeting the C5aR1 gene was inserted into an AAV8 vector driven by the F4 / 80 promoter (AAV8-F4 / 80) to construct a macrophage-specific C5aR1 knockdown vector (AAV.shC5aR1), with an empty AAV vector (AAV.Ctrl) as a control. b. AAV delivery and gene knockdown Healthy C57BL / 6J mice were injected via tail vein with AAV.shC5aR1 (dose 5 × 10⁻⁶). 11(vg / animal), C5aR1 expression in liver tissue was detected 4 weeks after injection, confirming that the knockdown efficiency was over 90% (P<0.01, vs AAV.Ctrl group). c. CCl4 Model Construction Two weeks after establishing a liver fibrosis model with CCl4, AAV injection was performed. Four weeks after injection, serum and liver tissue were collected for functional and pathological analysis.

[0032] Further, in step a, the shRNA sequence targeting C5aR1 is Sh-C5aR1, and its sequence is Sh-C5aR1:5'-GATAACAGCAGCTTTGAAA-3'.

[0033] Furthermore, in step b, after AAV injection, the expression levels of C5aR1 mRNA and protein in liver tissue need to be verified by qPCR and immunofluorescence to ensure that the knockdown efficiency meets the standard (decline >90%).

[0034] Model features Highly efficient gene knockout: The expression levels of C5aR1 mRNA and protein in macrophages decreased by more than 90% (AAV.shC5aR1 vsAAV.Ctrl, P<0.01). Improved liver function: Compared with the CCl4 group, serum transaminase levels in the C5aR1 knockdown group returned to near baseline levels (P<0.0001). Inflammation suppression: The levels of TNFα, IL1β, and IL6 in liver tissue were significantly decreased (vs. CCl4 group, P<0.0001). Pathological remission: HE staining showed a significant reduction in the area of ​​inflammatory infiltration (vs. CCl4 group, P<0.001). Fibrosis reversal: Masson and Sirus red staining confirmed a significant reduction in fibrotic area (vs CCl4 group, P<0.01).

[0035] Experimental Example 1: Preparation of RNAi Gland-Associated Clones I. Experimental Procedure Linearized vectors were obtained by digestion with restriction endonucleases. The target fragment was prepared by primer annealing. Restriction sites were added to both ends of the designed primers (marked in green and blue in the figure). After annealing, these primers contained the same restriction sites at both ends as the linearized cloning vector. A reaction system was prepared using the linearized vector and the annealing product, and ligation was performed. The product was then directly transformed. Single clones were picked from plates for PCR identification, and positive clones were sequenced and the results analyzed. The correctly cloned bacterial culture was expanded and extracted to obtain high-purity plasmids for downstream virus packaging.

[0036] II. Experimental Materials 1. Main reagents Table 1

[0037] Main instruments Table 2

[0038] III. RNAi Target Design Based on the principles of RNAi sequence design, multiple RNAi target sequences were designed for the target gene sequence, and the target with the optimal kinetic parameters was selected for subsequent experimental procedures. In addition to our self-designed RNAi target sequences, we also used some sequences commonly used in RNAi experiments, such as the RNAi negative control (NC) scramble sequence. TTCTCCGAACGTGTCACGT. Additionally, RNAi target sequences can also be provided by the client, and we will construct the target sequences into the corresponding gland-associated vectors according to the client's specific requirements.

[0039] IV. Cloning Instances The detailed experimental procedure is described using the construction of an RNAi-negative gland-related control as an example. 1. Target gene and tool vector information 1.1 Genetic information: NC sequence 1.2 Tool Carrier: The carrier structure is as follows Figure 7 As shown.

[0040] Vector number: GV478 Component sequence: U6-MCS-CAG-EGFP Fluorescent label: EGFP Cloning site: BsmBI Vector digestion Prepare a 50 µL enzyme digestion system according to the list below. Add the reagents in the order listed, gently mix with a pipette, briefly centrifuge, and incubate at 37°C for 3 h or overnight. Perform agarose gel electrophoresis on the vector digestion products and recover the target band.

[0041] Table 3

[0042] 1. The optimal reaction temperature for most restriction endonucleases is 37℃, but some are not, such as ApaI at 25℃ and BslI at 75℃. Determine the appropriate reaction temperature based on the required restriction endonuclease.

[0043] 2. Restriction endonucleases should exhibit at least 50% reactivity in the selected buffer. Please refer to the manufacturer's label for the specific activities of each restriction endonuclease in different buffers.

[0044] 3. Obtaining the target gene fragment 3.1 Core Sequence The vector construction and viral packaging are introduced using the NC sequence as an example.

[0045]

[0046] The NC sequence was compared with genbank and found to have 16 consecutive bases of homology only with two genes in Zebrafish. Apart from that, it did not have 16 consecutive bases of homology with any other sequence in the genome. Therefore, it can be used as a universal negative control.

[0047] 3.2 Viral Vector Construction Framework Table 4

[0048] Note: Due to the special needs of some customers, the number of bases in STEM and the sequence of LOOP may differ from those in this example. Please refer to the sequence in the specific experimental report.

[0049] 3.3 Synthesis of Single-Stranded Primers Table 5

[0050] 3.4 Primer annealing to form double-stranded DNA After synthesis, the paired primer powders were dissolved in annealing buffer, incubated in a 90°C water bath for 15 min, and then allowed to cool naturally to room temperature. The theoretical pairing results of GV112-NC-1 and GV112-NC-2 are as follows: ACCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT-3'

[0051] Note: TTTTT is the termination signal.

[0052] 4. The annealed product is bonded to the carrier. The double-digested linearized vector and annealed double-stranded DNA were ligated using T4 DNA ligase at 16°C for 1-3 hours, or overnight.

[0053] Reaction system: Table 6

[0054] 5. Transformation Add 10 µL of the exchange reaction product to 100 µL of competent cells, gently tap the tube wall several times to mix, and incubate on ice for 30 min. Heat shock at 42℃ for 90 s, then incubate in an ice-water bath for 2 min. Add 500 µL of LB medium and incubate at 37℃ with shaking for 1 h. Spread an appropriate amount of the bacterial culture evenly on a plate containing the appropriate antibiotic and incubate upside down in a constant temperature incubator for 12–16 h.

[0055] 6. Sequencing The identified positive clones were inoculated into an appropriate amount of LB broth containing the corresponding antibiotics and cultured at 37°C for 12-16 h. A suitable amount of bacterial culture was then sequenced. The sequencing results were compared and analyzed with the target gene sequence. The sequencing results are as follows: AGATATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTA GAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATA TGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGA AACACCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTTAG AAATAGCAAGTTAAAATAAGGCTAGTCCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT GCTTTTTTTCTGCAGCGGCTTCGGAATAGGAACTTCCCAGACATGATAAGATACATTGATGA GTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGAT GCTATTGCTTTATTTGTA Note: RNAi gland-associated vectors contain "hairpin structures." The tightness of these hairpin structures is determined by the characteristics of the gene itself. Overly tight hairpin structures directly affect the quality of sequencing results. Although sequencing companies have made numerous optimizations to address this issue, it is difficult to guarantee that every RNAi vector will be successfully sequenced. Therefore, sequencing results may be interrupted prematurely or the first half of the sequencing may be successful, but the second half may contain erratic peaks. Based on years of experience, we believe that if the first half of the sequencing results from two interrupted sequencing runs are identical and consistent with the target sequence, then the clone is a correct clone.

[0056] V. Plasmid Extraction The correctly sequenced bacterial culture was transferred to 50 mL of LB broth containing the appropriate antibiotic and incubated overnight at 37°C. Plasmid extraction was performed using the AmMag Quatro Plasmid Purification Kit-24 prep (water elution) kit. The extracted plasmids were then used in downstream processes. Detailed operating procedures are as follows: 1. Collect the overnight cultured bacterial solution into a 50mL centrifuge tube and centrifuge at 6000rpm for 3min; 2. Discard the supernatant, and mix the bacterial clump at the bottom of the centrifuge tube with the remaining culture medium on a shaker; 3. Place the centrifuge tube from step 2 into the corresponding sample tube position on the automatic extraction instrument; 4. Place 40-45 mL of anhydrous ethanol into the corresponding reaction tube of the automatic extractor; 5. Place the entire set of extraction reagents into the reagent rack of the automatic extractor, and then place the entire reagent rack into the corresponding position of the automatic extractor; 6. Then prepare the appropriate number of pipette tips and collection tubes, and mark the plasmid number on the collection tubes; 7. After preparation, check all equipment and confirm that everything is in order. Then close the automatic extraction chamber door and begin the experiment. 8. After the experiment, the plasmid was collected by centrifuging at 4500 rpm for 6 min using a 15 mL centrifuge. 9. In a laminar flow hood, transfer the collected plasmids into sterilized 1.5 mL EP tubes; 10. Take 20 μL of plasmid from step 9 for quality inspection.

[0057] Experiment Example 2: Packaging and Quality Detection of Adeno-Associated Virus I. Experimental Procedure The AAV Helper-Free System consists of three plasmids: a viral vector, a pAAV-RC vector, and a pHelper vector. This manual will use the most commonly used type 2 AAV as an example for explanation.

[0058] Jikai used a three-plasmid co-transfection technique to transfect HEK293T cells. Virus harvest (i.e., unpurified cell supernatant and cell pellet) was performed 72 hours after transfection. High-purity AAV virus preservation solution was obtained by gradient density centrifugation, and finally, various lentiviral parameters were measured according to strict quality standards.

[0059] II. Experimental Materials 1. Cell lines AAV-293T, a packaging cell for adeno-associated virus, is an adherent, epithelioid cell-like cell, grown in DMEM (containing 10% FBS). The adherent cells proliferate and form a monolayer after culture.

[0060] 2. Viral vector 2.1 GV carrier spectrum: For detailed structure, please refer to "Part One: Viral Vector Construction". reagents Table 7

[0061] III. Plasmid Transfection and AAV Virus Harvesting 1. 24 h before transfection, AAV-293 cells in logarithmic growth phase were digested with trypsin, and the cell density was adjusted to approximately [missing information - likely a specific concentration] in culture medium containing 10% serum. Cells / 15 mL, re-seeded in 10 cm cell culture dishes, 37 ℃, 5% Incubate in an incubator. Once the cell density reaches 70%–80% after 24 hours, it is ready for transfection. 2. Replace the culture medium with one containing 2% serum 2 hours before transfection; 3. Add the prepared DNA solutions (5 μg of GV vector plasmid, 5 μg of pHelper vector plasmid, and 5 μg of AAV-RC plasmid) to a sterile centrifuge tube, mix them with the corresponding volume of Gilead transfection reagent, adjust the total volume to 1 mL, and incubate at room temperature for 15 min. 4. Slowly add the mixture dropwise to the culture medium of AAV-293 cells, mix well, and incubate at 37°C with 5% [temperature missing]. Cultured in a cell culture incubator; Note: The addition process must be uniform, and you should try to avoid blowing the cells up.

[0062] 5. After culturing for 6 h, discard the culture medium containing the transfection mixture, add 10 mL of PBS solution to wash once, gently shake the culture dish to wash away the residual transfection mixture, and then discard it. 6. Slowly add 10 mL of cell culture medium containing 5% serum, and incubate at 37°C with 5% serum. Continue incubation in the incubator for 48-72 hours.

[0063] IV. AAV Virus Concentration and Purification 1. Collect AAV-293 cell supernatant and cells 72 h after transfection (0 h is considered the start time after transfection) according to cell state; 2. Centrifuge at 3000 g for 5 min at 4℃ to separate cells from the supernatant; 3. Add the Gilead AAV virus concentration kit to the supernatant to obtain the virus in the supernatant. Resuspend the cell pellet in resuspension buffer, and freeze-thaw four times in liquid nitrogen at 37°C. Centrifuge. Then combine the two virus fractions. 4. Balance the samples separately, and place each ultracentrifuge tube containing the viral supernatant into a Beckman ultracentrifuge. Set the centrifugation parameters to 63,000 rpm, centrifugation time to 2 h, and centrifugation temperature to 18℃. 5. Aspirate the isolated layer containing the virus. Place it in an ultrafiltration column for ultrafiltration until a colorless or pale pink clear liquid is obtained; 6. Sterilize the obtained virus solution by passing it through a 0.22μm filter membrane and dispense it as required; 7. Prepare samples for testing.

[0064] V. AAV Virus Quality Testing Key aspects of AAV virus quality control include physical condition testing, sterility testing, and virus titer testing.

[0065] 1. Physical index testing 1. Color judgment: By visual inspection, the AAV virus preservation solution developed by Jikai Company is a colorless or light pink clear liquid; 2. Viscosity determination: Slowly aspirate 50 µL of lentivirus preservation liquid using a 20-200 µL pipette. There should be no obvious viscosity or lag in aspiration. 2. Sterility testing The virus was added to AAV-293 cells for verification. After normal culture for 24 hours, microscopic examination showed no bacterial or fungal contamination. In comparison with the empty cell group, no obvious particles were present in the intercellular spaces, and the culture medium was clear and transparent.

[0066] 3. Detection of titer using Q-PCR method Experimental principle: The AAV genome is a linear single-stranded DNA, and the physical titer of the AAV genome packaged into viral particles can be determined using quantitative PCR.

[0067] Experimental steps: 1. Prepare four 90μL water aliquots for each sample, placing them in Eppendorf tubes. Add 10μL of the sample to the first aliquot, mix well, and name it -1. Then, take 10μL of the sample from this aliquot and add it to the second aliquot, naming it -2, and so on. Finally, obtain eight sample dilutions. Use the last five aliquots as templates for quantitative PCR. 2. Take 10 μL of each sample and add it to 40 μL of water, mix well and name it -2. Prepare four 90 μL aliquots of water, place them in Eppendorf tubes, and then take 10 μL of each aliquot and add it to 90 μL of water, name it -3, and so on. The difference is that there are four dilutions; the last three are used for quantitative PCR. 3. Calculate the required number of reaction wells. For each reaction, use 10 μL of 2×SYBR Green Mix, 0.5 μL each of forward and reverse primers, 0.2 μL of Rox reference dye, and add water to bring the total volume to 15 μL. Prepare an extra reaction system for every 20 reactions to avoid reagent shortages.

[0068] 4. Add the prepared reaction mixture to a 96-well plate, 15 μL per well. Add 5 μL to each sample and set up duplicate wells.

[0069] 5. PCR reactions were performed according to the SYBR Green kit instructions.

[0070] 6. After obtaining the Ct value data, obtain the standard curve according to the logarithm of the standard concentration and the average Ct value, and calculate the titer of the sample to be tested according to the standard curve and the calculation formula.

[0071] Calculation formula: Virus particle count (vg / mL) = Measured value / Dilution × 2 * Because qPCR standards are double-stranded DNA, while the AAV viral genome is single-stranded DNA, the AAV titer needs to be multiplied by 2 when calculating the titer. Tier results: Table 8

[0072] Experimental Example 3 In the construction of a CCl4-induced liver fibrosis mouse model induced by adeno-associated virus (AAV) vector targeting and knocking down the C5aR1 gene in macrophages, the construction of the AAV vector was commissioned to a gene company. The specific steps are as follows: 1: Construction and Validation of AAV Vectors shRNA sequence design: Design a shRNA sequence (Sh-C5aR1:5'-GATAACAGCAGCTTTGAAA-3') targeting the mouse C5aR1 gene and synthesize the corresponding DNA fragment.

[0073] The shRNA fragment was inserted into the multiple cloning site of the AAV8 vector (serotype 8) using gene cloning technology, and its expression was driven by the macrophage-specific promoter F4 / 80 to construct the recombinant vector AAV8-F4 / 80-C5aR1-shRNA (abbreviated as AAV.shC5aR1).

[0074] At the same time, an empty control vector AAV8-C5aR1-null (abbreviated as AAV.Ctrl) was constructed.

[0075] Virus packaging and purification: The recombinant vector and helper plasmid were co-transfected into HEK293T cells. After 72 hours, the cell supernatant was collected and AAV8 virus particles were purified by cesium chloride gradient centrifugation.

[0076] Viral titer (≥1×10⁻⁶) was determined by qPCR. 13 (vg / mL), aliquoted and stored at -80℃.

[0077] After obtaining AAV.shC5aR1 and AAV.Ctrl viruses, this invention constructed a CCl4 liver fibrosis mouse model based on adeno-associated virus vector targeting and knocking down the C5aR1 gene in macrophages. The specific steps are as follows: Figure 1 This diagram illustrates the construction of a CCl4 mouse model using adeno-associated virus (AAV) vector to target and knock down the C5aR1 gene in macrophages. Healthy 8-10 week old SPF-grade male C57BL / 6J mice (weighing 20-25g) were randomly divided into a CCl4 group and an Olive oil group, with 12 mice in each group. CCl4 was dissolved in olive oil at a ratio of 1:9, and the CCl4 injection dose was 0.75µL of pure carbon tetrachloride per gram of body weight, twice a week. Two weeks after injection, the CCl4 group was randomly divided into an AAV.Ctrl group and an AAV.shC5aR1 group, with 6 mice in each group. AAV (5×10^11 vg / mouse, 200μL PBS) was injected via the tail vein. Similarly, the Olive oil group was randomly divided into an AAV.Ctrl group and an AAV.shC5aR1 group, with 6 mice in each group. AAV (5×10^11 vg / mouse, 200μL PBS) was injected via the tail vein. Mice were euthanized under deep anesthesia after receiving CCl4 treatment for six weeks. Serum and liver tissue were collected.

[0078] Knockout efficiency test mice: 8-10 week old SPF-grade healthy male C57BL / 6J mice (weighing 20-25g) were randomly divided into an experimental group (AAV.shC5aR1) and a control group (AAV.Ctrl), with 3 mice in each group. After injection, the mice were fed normally, and after 4 weeks, they were sacrificed and liver tissue was collected.

[0079] Figure 2 Image showing the mRNA and protein validation results after C5aR1 gene knockdown. Mouse macrophages were sorted by flow cytometry (see image 3A). Total RNA was extracted from macrophages, reverse transcribed into cDNA, and C5aR1 mRNA expression was detected using the SYBR Green assay (primer sequences: F: 5'-ATGGACCCCATAGATAACAGCA-3', R: 5'-GAGTAGATGATAAGGGCTGCAAC-3'), with GAPDH as an internal control. Results showed that C5aR1 mRNA expression in the AAV.shC5aR1 group was 93% lower than that in the AAV.Ctrl group (P<0.0001). As shown in 3B, the expression of F4 / 80 and C5aR1 in liver tissue was co-localized by immunofluorescence. The results showed that there was obvious co-localization fluorescence of F4 / 80 and C5aR1 in AAV.Ctrl liver tissue (as indicated by the arrows), while there was almost no co-localization fluorescence of F4 / 80 and C5aR1 in AAV.shC5aR1 liver tissue.

[0080] Figure 3 This is a comparative graph showing serum liver function indicators between model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4). Each data point in the graph represents one mouse. Figure 3 As can be seen, compared with the AAV.Ctrl+Olive oil group, the AAV.Ctrl+CCl4 group had higher levels of transaminase and total bilirubin, and the difference was statistically significant (p < 0.05). Compared with the AAV.Ctrl+CCl4 group, the transaminase level of the AAV.shC5aR1+CCl4 group was significantly improved, and the difference was statistically significant (p < 0.0001).

[0081] Figure 4 This is a statistical graph showing the relative expression levels of inflammatory cytokine mRNA in model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4). Each data point in the graph represents one mouse. Figure 4As can be seen, compared with the AAV.Ctrl+Olive oil group, the AAV.Ctrl+CCl4 group had higher levels of inflammatory factors (TNFα, IL-6, IL-1β), and the difference was statistically significant (p < 0.0001). Compared with the AAV.Ctrl+CCl4 group, the inflammatory factors in the AAV.shC5aR1+CCl4 group were significantly improved, and the difference was statistically significant (p < 0.0001).

[0082] Figure 5 This image shows the HE staining pathological images of the livers of model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4). Each data point in the image represents one mouse. Figure 5 The microscope has a magnification of 100x. Figure 5 As can be seen, compared with the AAV.Ctrl+Olive oil group, the inflammatory infiltration area of ​​the AAV.Ctrll+CCl4 group was significantly increased, and the difference was statistically significant (p < 0.0001, **** represents p < 0.0001); compared with the AAV.Ctrl+CCl4 group, the inflammatory infiltration area of ​​the AAV.shC5aR1+CCl4 group was significantly reduced, and the difference was statistically significant (p < 0.05, *** represents p < 0.001).

[0083] Figure 6 This image shows the Masson and Sirus red staining pathological changes in the livers of model mice (AAV.shC5aR1+Olive oil, AAV.shC5aR1+CCl4) and control mice (AAV.Ctrl+Olive oil, AAV.Ctrl+CCl4). Each data point in the image represents one mouse. Figure 5 The microscope has a magnification of 100x. Figure 6 As can be seen, compared with the AAV.Ctrl+Olive oil group, the AAV.Ctrl+CCl4 group showed significantly increased collagen deposition, with a statistically significant difference (p < 0.001, *** represents p < 0.01); compared with the AAV.Ctrl+CCl4 group, the AAV.shC5aR1+CCl4 group showed significantly reduced collagen deposition, with a statistically significant difference (p < 0.01, ** represents p < 0.01).

[0084] Figure 7 This is a schematic diagram of the carrier element of the present invention.

[0085] As can be seen from the above, the AAV.shC5aR1 CCl4 model constructed in this invention has the characteristics of strong targeting and is suitable for: studying the molecular mechanism of C5aR1 gene in the progression of liver fibrosis; screening liver fibrosis treatment drugs that target C5aR1; and evaluating clinical intervention strategies (such as gene therapy or anti-fibrotic therapy).

[0086] The above-described embodiments are merely preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the technical scope disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A tool sequence, said tool sequence being a DNA sequence encoded by C5aR1-shRNA, as shown in SEQ ID No.

2.

2. A recombinant plasmid, said recombinant plasmid being circular, comprising the tool sequence as described in claim 1, and comprising an EGFP sequence and an F4 / 80 promoter sequence, the F4 / 80 promoter sequence being shown in SEQ ID No.

1.

3. An adeno-associated virus for targeted knockdown of the C5aR1 gene in macrophages, packaged with the recombinant plasmid as described in claim 2.

4. A gene manipulation tool for treating liver fibrosis, comprising the recombinant adenovirus as described in claim 3.

5. The gene manipulation tool of claim 4 can specifically act on macrophages in the body and is used in screening liver fibrosis treatment drugs that target C5aR1.

6. The gene manipulation tool of claim 4 can specifically act on macrophages in the body and is used in studies evaluating the regulation of liver fibrosis by the C5aR1 gene.

7. The gene manipulation tool of claim 4 can specifically act on macrophages in the body and has applications in liver injury, liver fibrosis, and liver cancer.

8. A method for constructing a CCl4-induced liver fibrosis mouse model targeting macrophages to knock down C5aR1, characterized in that: An adeno-associated virus vector system driven by the F4 / 80 promoter, the F4 / 80 promoter sequence of which is shown in SEQ ID No. 1, was used to achieve macrophage-specific C5aR1 gene knockdown via tail vein injection. The constructed model met the following conditions: a) Macrophage C5aR1 expression decreased by more than 90%; b) Serum transaminase levels returned to near baseline levels; c) The expression levels of inflammatory factors (TNFα, IL1β, IL6) in liver tissue were significantly lower than those in the CCl4 group; d) The area of ​​inflammatory infiltration in liver tissue was significantly reduced compared to the CCl4 group; e) The area of ​​liver fibrosis was significantly reduced compared to the CCl4 group.

9. The construction method according to claim 8, characterized in that: The adeno-associated virus vector contains a DNA sequence encoded by C5aR1-shRNA, as shown in SEQ ID No.

2. Its knockout efficiency was verified by qPCR and immunofluorescence detection of C5aR1 mRNA and protein expression levels.

10. The construction method according to claim 8, characterized in that: The model construction includes the following steps: 1) AAV.shC5aR1 virus and control group AAV.Ctrl virus were injected via tail vein. The characteristic sequence of AAV.shC5aR1 virus is shown in SEQ ID No. 3; 2) Adeno-associated virus injection began 2 weeks after CCl4 induction; 3) Administer intraperitoneal injections of 10% CCl4 twice a week, dissolved in olive oil at a ratio of 1:9, for 6 weeks. 4) Serum liver function was tested 48 hours after the last injection; 5) The expression levels of TNFα, IL1β, and IL6 mRNA in liver tissue were detected by qPCR; 6) Assess the area of ​​inflammatory infiltration using HE staining; 7) Assess the area of ​​fibrosis using Masson and sirus red staining; In step 1), the viral injection dose is 5 × 10^11 vg / animal; In step 3), the CCl4 injection dose is 0.75 mL / kg body weight.

Images