Gene for regulating chicken follicular granular cell proliferation and hormone synthesis and application thereof

By preparing the IGFBP1 gene, which regulates the proliferation and hormone synthesis of chicken follicle granulosa cells, we revealed its role in chicken follicle development. By expressing recombinant IGFBP1 protein in vitro, we significantly promoted the proliferation and hormone synthesis of primary chicken follicle granulosa cells, solving the problem of low reproductive performance in local chickens and improving their egg production performance.

CN121160705APending Publication Date: 2025-12-19HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511292726.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-11
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

In existing technologies, the reproductive performance of local chickens is relatively low, especially with a short peak egg production period and a rapid decline in performance in the later stages of egg production, which affects their industrial development. There is a lack of research into the molecular mechanisms by which genes related to the reproduction of local chickens regulate follicle growth and development.

Method used

By preparing the IGFBP1 gene, which regulates the proliferation and hormone synthesis of chicken follicular granulosa cells, and using gene function acquisition techniques, we revealed its important role in the proliferation of chicken follicular granulosa cells and the synthesis of steroid hormones. We provided the amino acid and base sequence of the IGFBP1 gene and used in vitro expression of recombinant IGFBP1 protein to affect the proliferation and hormone synthesis of primary chicken follicular granulosa cells.

Benefits of technology

IGFBP1 recombinant protein can increase the proliferation activity of chicken primary follicular granulosa cells by 20% to 81%, increase the number of S-phase cells by 2%, increase the number of cells by 2.3 times, increase estrogen secretion by 61%, and increase progesterone secretion by 7%. It provides key experimental evidence for molecular marker-assisted breeding of chicken egg production traits and improves the breeding efficiency of high-quality laying hens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121160705A_ABST
    Figure CN121160705A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering, in particular to a gene for regulating chicken follicular granular cell proliferation and hormone synthesis and application thereof. The invention provides application of an IGFBP1 gene in regulation and control of chicken follicular granular cell proliferation and hormone synthesis. The amino acid sequence of the IGFBP1 gene is as shown in SEQ ID NO. 2. The technology can shorten the breeding period of new varieties of high-quality laying hens, has a wide application prospect, can assist in coping with related breeding challenges, improves breeding economic benefits, and provides support for innovation of a poultry genetic breeding technology.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, and in particular to a gene for regulating proliferation and hormone synthesis of chicken follicular granulosa cells and application thereof. BACKGROUND

[0002] Egg-laying traits are the key to chicken production performance, although they are controlled by multiple genes, have low heritability, and are difficult to select, they have been significantly improved with the development of quantitative genetics and the application of related technologies. Whole-genome selection technology has further pushed the breeding level to a new height. Internationally, laying hens have extended the laying period while ensuring egg quality, and some have achieved the goal of "500 eggs in 100 weeks" and formed multiple brands. The National Livestock and Poultry Genetic Resources Variety Catalog (2024 Edition) includes 140 local chicken breeds, each with its own characteristics, good meat and egg quality, and strong resistance, making them excellent materials for breeding new varieties. However, the reproductive performance of local chickens is generally low, especially the short duration of the egg-laying peak and the rapid decline in egg-laying performance during the post-egg-laying period, which is an important factor restricting their industrial development. Therefore, it is of great significance to protect local chicken germplasm resources, excavate excellent traits, and develop new varieties by excavating local chicken reproduction-related genes, studying the molecular mechanisms of regulating reproductive traits, and developing efficient molecular markers with breeding value.

[0003] Poultry follicle growth and development is closely related to egg-laying performance, and its genetic basis and regulatory mechanism is a hot research topic in poultry genetics. Follicle development is a complex and coordinated physiological process that goes through stages such as primordial follicle formation and post-ovulation degeneration, and is composed of oocytes, granulosa cells, and membrane cells. Follicle selection is a key step in determining avian egg-laying performance, and is related to ovary granulosa cell proliferation and steroid hormone synthesis and secretion, and is regulated by multiple genes. Currently, although a large number of genes related to chicken follicle growth and development have been excavated, gene function verification and molecular mechanism research are lacking. For a long time, the molecular mechanism of poultry follicle development has mainly focused on the regulation pathway of the hypothalamic-pituitary-ovary axis (HPO axis). In recent years, with the continuous development of omics technology, research in related fields has been continuously deepened, and people have been surprised to find that the liver, as an important lipid metabolism organ in birds, secretes endocrine factors that act on other tissues and organs through body fluid circulation, remotely mediate signal exchange between tissues, and then regulate the physiological function of target tissues. The applicant's previous research found that in the liver-thigh endocrine circuit of Gushi chickens, the liver-specific endocrine factor IGFBP1 has signal exchange with the ovary tissue, potentially mediating the regulation of follicle growth and development.

[0004] Insulin-like growth factor binding protein 1 (IGFBP1) belongs to the IGFBPs family, mainly expressed and secreted in the liver, and also expressed in the decidualized endometrium during pregnancy. IGFBP1 can regulate the circulation and transport of IGFs in the body to prolong the half-life by binding with IGFs, and the interaction between the two will also affect the biological function of IGFs, including the effects on cell proliferation, differentiation and metabolism, and ultimately achieve the regulation of animal growth. IGFBP1 also plays an important role in human female reproductive physiology, which can regulate menstrual cycle, puberty development, ovulation, decidualization and fetal growth. IGFBP1 mRNA is expressed in the endometrium and ovarian granulosa-luteal cells of the female reproductive tract, and the protein is secreted at a specific stage of differentiation, and during pregnancy, it is the main secretory product of the decidualized endometrium. In primate ovaries, IGFBP1 mRNA is lowly expressed in atretic follicle granulosa cells and highly expressed in stromal cells, and its uniform expression in obviously atretic follicle granulosa cells may be involved in apoptosis. Studies have found that IGFBP1 is involved in follicular development and granulosa cell differentiation in human ovaries, and gonadotropins may affect the effect of IGF1 by regulating the level of IGFBP1 in the ovary.

[0005] Although existing studies have confirmed that the IGFBP1 gene plays a key regulatory role in the female reproductive system of mammals, its functional mechanism in the follicular development of poultry (chicken) ovaries still needs to be further analyzed. Based on the important position of the gene in the female reproductive system of mammals, combined with the liver transcriptome data of high-yield and low-yield local chickens, the gene function of IGFBP1 is studied by using gene function acquisition means, combined with genetics, molecular biology and other methods, and the important role of IGFBP1 in chicken follicular granulosa cell proliferation and steroid hormone synthesis is revealed, which provides a new gene resource for high-yield new variety breeding. SUMMARY

[0006] The purpose of the present application is to provide a gene for regulating chicken follicular granulosa cell proliferation and hormone synthesis and application thereof.

[0007] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0008] The present application provides the application of IGFBP1 gene in regulating chicken follicular granulosa cell proliferation and hormone synthesis, and the amino acid sequence of the IGFBP1 gene is shown as SEQ ID NO. 2.

[0009] Preferably, the CDS region base sequence of the IGFBP1 gene is shown as SEQ ID NO. 1.

[0010] SEQ ID NO. 1

[0011] ATGCGGACCCTGCTGAGCCGCTGCTGGCTGCCGCCCCTGCTGCTGCCGGCGCTGCTGGGACCTCTCCTCGTAGCCGCCGCGTCCCTGCAGCCCCTGCACTGTGCGCCGTGCACACAAGAGAAGCTGGCCCTCTGCCCGCCCGTCGAGCCCGGCTGCCCGGAGACGGCTCGGCAGCCCGGCTGCGGCTGCTGCCAGACCTGCGCTCTTGGGCCGGGCCAGCCGTGCGGGGTCTACACGACCCGCTGTCGCCACGGTCTCCGCTGCCACGTCCCTTCGGGGGAGACCCGGCCCCTCTCTGCCCTCATCCAGGGCCAAGGAAAGTGCCTGCCCGCCAGTGAAGCTGGAGGGACGCGCTCAGCTGAGCCGGCAGAATCTACCGAGCCTGAGGACTTACCTTTAGAAAGCTCTGAAATTACACAGGACCAGATGCTGAACTATCAATTGATGTTTCCCATAAGCCAGGACAAATCCATCCCTTGGAATTTCTTCACTGTATATGAAAACATGAAAGCAAAGAGAATATCTGAACACAAGAAATGGAAAGAACAGGGACCTTGTCAGAAGGAGCTCTATAGAGCTCTGTATAAATTGGCAAAGGCTCAGCAGAGAAGTGGAGGGGACATTTACAAATTCTATTTGCCCAACTGTAACAAGAATGGATTTTACCACAGCAAACAGTGTGAAACTTCACTGGATGGAGATTCCGCTGGGTGCTGGTGTGTCTATCCAAAAAATGGAATAAAAATTCCTGGATCCCCAGAAGTGAAAGGAGACTCTGATTGCCAACAGTATCTCAGATCAGAAGAATAA.

[0012] SEQ ID NO. 2

[0013] MRTLLSRCWLPPLLLPALLGPLLVAAASLQPLHCAPCTQEKLALCPPVEPGCPETARQPGCGCCQTCALGPGQPCGVYTTRCRHGLRCHVPSGETRPLSALIQGQGKCLPASEAGGTRSAEPAESTEPEDLPLESSEITQDQMLNYQLMFPISQDKSIPWNFFTVYENMKAKRISEHKKWKEQGPCQKELYRALYKLAKAQQRSGGDIYKFYLPNCNKNGFYHSKQCETSLDGDSAGCWCVYPKNGIKIPGSPEVKGDSDCQQYLRSEE.

[0014] Preferably, the IGFBP1 gene is a positive regulator of steroid hormone synthesis in follicular granulosa cells, and can promote the synthesis of estrogen and progesterone in the follicle.

[0015] Preferably, the IGFBP1 gene is a positive regulator of follicular granulosa cell proliferation, and can promote follicular development.

[0016] Preferably, the 3 ′ end of the amino acid sequence of the IGFBP1 gene comprises a His tag HHHHHH*; SEQ ID NO. 3.

[0017] The application also provides the use of the protein encoded by the IGFBP1 gene in the preparation of a reagent for promoting the development of chicken granulosa cells or promoting the development of chicken follicles.

[0018] The application also provides the use of the IGFBP1 gene in molecular marker assisted breeding of chicken egg laying traits.

[0019] Compared with the prior art, the application has the following beneficial effects:

[0020] The application provides a strategy for affecting proliferation and hormone synthesis of chicken primary follicular granulosa cells by expressing IGFBP1 recombinant protein in vitro. Cell tests prove that the recombinant protein can make the proliferation activity of chicken primary follicular granulosa cells increase by 20% to 81%, the number of S phase increase by 2%, the proliferation number increase by 2.3 times, the secretion amount of estrogen increase by 61%, and the secretion amount of progesterone increase by 7%, and it is proved that the recombinant protein can regulate the key link of follicular development. The application provides a key test basis for molecular marker assisted breeding of egg laying traits of chickens, and provides a new idea of cutting into protein function for poultry breeding; through detection and selection of the IGFBP1 gene, the selection and breeding efficiency of high-quality laying hens can be improved. In addition, the IGFBP1 gene and the application technology thereof can provide a new type of molecular marker resource for selection and breeding of egg laying traits, and can provide a reference for improvement of other related traits of poultry. With the increasing demand for breeding of high-quality poultry varieties, the technology can shorten the breeding cycle of new varieties (matching lines) of high-quality laying hens, has a wide application prospect, can help cope with related breeding challenges, improve economic benefits of breeding, and provide support for genetic breeding technology innovation of poultry. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of the provided drawings.

[0022] Figure 1 It is a PCR schematic diagram for enzyme cutting of the IGFBP1 gene CDS and the vector plasmid in Example 1 of the present application.

[0023] Figure 2 It is IGFBP1 recombinant protein expression and bacteria breaking SDS-PAGE detection in Example 2 of the present application.

[0024] Figure 3 It is a SDS-PAGE electrophoresis diagram of purified inclusion body IGFBP1 recombinant protein in Example 2 of the present application.

[0025] Figure 4 It is a SDS-PAGE electrophoresis diagram of eluted and concentrated IGFBP1 recombinant protein in Example 2 of the present application.

[0026] Figure 5 It is primary follicular granulosa cell morphology (A) and immunofluorescence identification (B) in Example 3 of the present application; note: the elliptical blue fluorescence is the cell nucleus, and the red fluorescence is the combination of FSHR protein antibody and FSHR fluorescent secondary antibody (scale 100 mu m).

[0027] Figure 6Example 3 of this invention demonstrates how recombinant protein IGFBP1 promotes the proliferation of follicular granulosa cells. Note: A: CCK-8 assay was used to determine the optimal cell concentration of recombinant protein IGFBP1; B: qRT-PCR was used to detect changes in the mRNA of proliferation marker genes; C: Flow cytometry was used to detect changes in the cell cycle; D: EdU staining was used to detect cell proliferation capacity (scale bar 100 μm); E: Western blotting was used to detect changes in the protein of proliferation marker genes.

[0028] Figure 7 In Example 3 of this invention, the recombinant protein IGFBP1 promotes the synthesis of estrogen (E2) and progesterone (PROG); Note: A: qRT-PCR detection of changes in the mRNA of marker genes for estrogen and progesterone synthesis; ELISA detection of the levels of progesterone (B) and estrogen (C) in the cell supernatant; D: Western Blot detection of changes in the protein of marker genes for hormone synthesis. Detailed Implementation

[0029] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1

[0031] (1) A gene IGFBP1CDS that regulates the proliferation and hormone synthesis of chicken follicular granulosa cells was obtained.

[0032] ① Cloning of the IGFBP1 gene coding sequence (CDS)

[0033] The CDS sequence information of the IGFBP1 gene (NM_001001294.1) was obtained from the NCBI online website (https: / / www.ncbi.nlm.nih.gov / ). Amplification primers were designed according to the online website (https: / / crm.vazyme.com / cetool / singlefragment.html) as shown in Table 1 (lowercase sequences are recombinant sequences added at the 5' end). The CDS sequence was obtained by PCR cloning. Figure 1 The CDS sequence SEQ ID NO.1 was determined by Sanger sequencing (Qingke Biotechnology, Zhengzhou). The PCR amplification system and reaction procedure are shown in Tables 2 and 3. The 50 μL amplification system was gently mixed and placed in a PCR instrument for reaction.

[0034] Table 1. Primer sequences for PCR amplification

[0035] As shown in SEQ ID NO.4 and 5.

[0036] Table 2 PCR amplification system

[0037]

[0038] Table 3 PCR reaction procedure

[0039]

[0040] The target band was successfully amplified by PCR, and sequencing comparison showed that it was consistent with the IGFBP1 CDS sequence published by NCBI (810 bp). Figure 1 ).

[0041] Example 2

[0042] (1) IGFBP1 recombinant protein was prepared based on a prokaryotic expression system.

[0043] ① Recombinant plasmid ligation: Electrophoretic detection and recovery of the amplified fragment, the procedure is as follows. GelExtraction Kit (D2500-1, Omega) instructions. One-step cloning ligation system: Prepare the following reaction mixture in an ice-water bath. After reacting the ligation reaction solution at 50°C for 30 min, place it on ice for 5 min, then immediately transform. To facilitate the purification or detection of the IGFBP1 protein, the IGFBP1 gene CDS is ligated to a linearized vector with a His tag. The protein consisting of the amino acid sequence shown in SEQ ID NO.2 is terminated with the tag protein HHHHHH*.

[0044] Table 3 HB infusion™ One-Step Cloning Ligation System

[0045]

[0046] ②Induced expression and purification of recombinant IGFBP1 protein

[0047] 1) Competent transformation: Rosetta (DE3) cells were thawed on ice, 5 μg of plasmid was added, and the cells were incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, and then incubated on ice for 2 min. 800 μL of preheated LB medium was added, and the cells were cultured at 37℃ for 1 h. After centrifugation and discarding of supernatant, the cells were resuspended and plated on kanamycin plates and cultured at 37℃ for 16 h.

[0048] 2) Cloning identification: Pick a single colony into 5 mL of kanamycin medium and incubate overnight at 37°C to preserve the culture; pick another single colony and incubate until OD600≈0.6, take 800 μL as control, add 0.1 mM IPTG to the remaining colony for induction for 4 h, take 0.15 mL of each colony and centrifuge, resuspend the precipitate in 40 μL of loading buffer, and take 10 μL for SDS-PAGE detection.

[0049] 3) Protein induction: 100 μL bacteria solution was inoculated into 100 mL kanamycin medium at -20 °C, and after 16 h, 2 L medium was inoculated, and cultured at 37 °C until OD600≈0.6, and then cooled to 30 °C, and 0.1 mM IPTG was added to induce for 8 h, and then centrifuged to collect bacteria, resuspended with NTA-0 buffer, and then added with 0.1 mg / mL lysozyme, and then ice-bathed for 30 min, and then ultrasonically broken, and then centrifuged to take supernatant and sediment for detection, and then the rest was stored at 4 °C.

[0050] 4) Inclusion body purification: after resuspension of the sediment with STET buffer + 1 mM DTT, ultrasonic treatment (200 W, 3 s / 3 s, 10 min) was performed, and then centrifuged to discard supernatant, and then repeated until transparent, and then resuspended with PBS, and then ultrasonic treatment was performed, and then centrifuged to discard supernatant, and then resuspended with 3 mL 6M guanidine hydrochloride + 5 mM DTT, and then after 4 h of shaking at 37 °C, centrifuged to take supernatant for detection.

[0051] 5) Protein renaturation: at 4 °C, the protein solution was diluted with 3M guanidine hydrochloride, and then renaturation liquid (pH 8.0) was added dropwise, and then high-speed stirring was performed for 24 h, and then low-speed stirring was performed for 24 h, and then PEG20000 was concentrated to 50-100 mL, and then 4 °C NTA-0 buffer was dialyzed for 48 h, and then concentrated to 10-20 mL, and then repeated dialysis for 48 h.

[0052] 6) Affinity purification: the dialysis liquid was filtered through 0.22 μm, and then loaded onto a Ni-NTA column at 1 mL / min, and then the column was washed with NTA-0 buffer until G250 was negative, and then eluted with 20, 60, 200, 500 mM imidazole gradient and collected, and then the column was washed with water, and then stored with 20% ethanol, and then the collected liquid was dialyzed and concentrated, and then 10 μL SDS-PAGE was performed for detection.

[0053] The recombinant positive clone was screened for kanamycin resistance, and sequencing showed that it was consistent with the target sequence; after small-scale expression, a difference band was observed on SDS-PAGE, which confirmed that the recombinant protein could be expressed in E. coli after IPTG induction Figure 2 ). After scale-up culture and ultrasonic bacterial disruption, a recombinant protein containing a His tag was obtained, and SDS-PAGE showed that the molecular weight was about 32 kDa, which was consistent with the expectation Figure 3 . After inclusion body purification, SDS-PAGE detection showed that the size was normal and the purity was high, and the protein could be renatured and purified. After renaturation and Ni-NTA purification and concentration of large-scale expression inclusion bodies, 1 mg of recombinant protein was obtained, with a purity of 90% Figure 4 .

[0054] Example 3

[0055] (1) Application of IGFBP1 gene in regulating proliferation and hormone synthesis of chicken follicular granulosa cells

[0056] ① Isolation and culture of chicken primary granulosa cells

[0057] The follicular granulosa cell extraction and culture process is as follows: 30 weeks (high yield period) of healthy hens, after the neck bone dislocation, soak in 0.1% new jieer disinfectant solution for about 2 min, sterile absorbent cotton dry, high pressure gauze into the cell; sterile scissors open abdominal cavity to take follicle, sub-packaged in PBS solution containing 5% penicillin; label the pre-grade and post-grade follicle in the biological safety cabinet; sterile forceps, scissors open follicle, squeeze out the yolk into PBS solution containing 3% penicillin, and shake off the granulosa layer with forceps. Collect the pre-grade and grade granulosa layer into 1.5 mL EP tubes, cut into 15 mL EP tubes, add no EDTA trypsin, digest at 37℃, 5% CO2 incubator for 10 min; add 10% FBS M199 medium, centrifuge at 1500 rpm for 5 min, discard the supernatant; PBS blow and wash, centrifuge at the same speed, discard the supernatant, resuspend the cells with M199 medium containing 10% FBS, and culture, when the cells adhere about 75%, carry out the follow-up experiment.

[0058] ②Chicken primary granulosa cell identification

[0059] The adherent cells were fixed with 4% paraformaldehyde, washed with PBS for 3 times, 5 min each time; 3% H2O2 deionized water was incubated for 30 min to block endogenous peroxidase; PBS was washed for 3 times, 5 min each time; dropwise addition of primary antibody FSHR Polyclonal antibody (22665-1-AP, Proteintech, 1:250), 4℃ overnight; PBS was washed for 3 times, 10 min each time; room temperature equilibration for 30 min, dropwise addition of fluorescent secondary antibody ProteinFind goat anti-mouse IgG (H+L) FITC conjugate (HS221, Transgen, 1:200), 37℃ incubation for 2 h, PBS was washed for 3 times, 10 min each time; add DAPI fluorescent staining for 15 min, PBS was washed for 3 times, 10 min each time, and take pictures under fluorescence microscope.

[0060] To further explore the effect of IGFBP1 gene on the function of primary follicular granulosa cells, the cells were successfully isolated and cultured Figure 5 ). The primary follicular granulosa cells were not uniform in shape and had more branches, and a small amount of cells were long and spindle-shaped Figure 5 A). The red fluorescence under fluorescence microscope was mainly located in the cytoplasm, which confirmed that it was follicular granulosa cells; the FSHR positive rate was >98%, indicating that the purity of primary follicular granulosa cells was more than 95%, which could be used for subsequent experiments Figure 5 B).

[0061] ③RNA extraction, reverse transcription and gene detection

[0062] 50nM IGFBP1 recombinant protein and primary granulosa cells (1×105 Co-culture for 24 h, total RNA was extracted by RNA Isolation Kit (NORWEGIAN, Nanjing) and reverse transcribed into cDNA by HiScript III RT SuperMix (NORWEGIAN, Nanjing) for subsequent qRT-PCR. qRT-PCR was performed by SYBR Green qPCR Master Mix (NORWEGIAN, Nanjing) and 96 Real-Time PCR System (Roche Applied Science) with 3 replicates for each group. GAPDH was used as an internal reference gene to normalize the mRNA expression level, and the relative expression was calculated by 2-ΔΔCt method. All primers were synthesized by GenScript (Zhengzhou), and the detailed information is shown in Table 4.

[0063] Table 4 Primer information

[0064]

[0065]

[0066] As shown in SEQ ID NO. 6-27.

[0067] ④ Detection of steroid hormones in cell supernatant

[0068] According to the chicken estrogen (MM-0787O1, Jiangsu Enzyme Immune), progesterone (MM-1143O1, Jiangsu Enzyme Immune), testosterone (MM-207001, Jiangsu Enzyme Immune) ELISA kit instructions, the enzyme-labeled analyzer Infinite F50 was used to determine the OD value of each sample at 450 nm wavelength. In the Excel worksheet, the standard concentration was taken as the abscissa, and the OD value was taken as the ordinate, and the standard linear regression curve was drawn, and the corresponding hormone concentration in each group of cell supernatant was calculated according to the curve equation.

[0069] ⑤ Cell proliferation and cycle determination

[0070] According to the kit instructions, the Cell Counting Kit-8 (CCK-8) method (Dojindo, Japan) and 5-ethynyl-2'-deoxyuridine (EdU) method (RiboBio, Guangzhou) were used to evaluate the cell proliferation. The BD AccuriC6 flow cytometer (BD Biosciences, USA) combined with the cell cycle detection kit (KeyGEN Biotech, Nanjing) was used to analyze the cell cycle, and the FlowJo 10.6.1 software (BD Biosciences, USA) was used for data analysis.

[0071] ⑥Western Blot test

[0072] The specific steps of the Western Blot test are as follows: 200 μL of the lysis solution is added to each well of a 6-well plate, and after lysis on ice for 15 min, it is transferred to a 1.5 mL EP tube, centrifuged at 12,000 rpm for 5 min, and the supernatant is collected as the total protein solution. The protein concentration of the sample is determined by the BCA method. The total protein of the cells is denatured by adding 5 μL of 5x SDS to each 20 μL of total protein solution and heating at 95°C in a metal bath for 5 min. Then, according to the instructions of the 12.5% PAGE gel rapid preparation kit (Yazyme, Shanghai), the concentrated gel and the separation gel are prepared and placed in the SDS electrophoresis solution, and 20 μg of protein is loaded for electrophoresis at 80V for 0.5 h and at 120V for 1.5 h. Then, using the "sandwich method", the PVDF membrane is transferred in the transfer solution at a constant current of 200 mA for 1.5 h. The PVDF membrane is blocked with protein-free blocking solution for 15 min, and after the blocking solution is discarded, the primary antibody diluted with antibody diluent is added and incubated at 4°C overnight. The next day, the primary antibody is discarded, and the membrane is washed with TBST for 3 times (5 min each time), and the secondary antibody is added. Then, the secondary antibody is discarded, and the membrane is washed with TBST for 3 times (5 min each time), and the Omin-ECLTM is added for development on the PVDF membrane. Finally, the Odyssey FC near-infrared protein instrument system is used to take pictures, and the protein data is quantified by Image J. The primary antibodies used in the Western Blot test include CDK1 Polyclonal antibody (19532-1-AP, Proteintech, 1:5000), PCNA Polyclonal antibody (PCNA Polyclonal antibody, Proteintech, 1:2500), CYP11A1 Polyclonal antibody (13363-1-AP, Proteintech, 1:2500), StAR Rabbit pAb (A16432, ABclonal, 1:1000), Aromatase (CYP19A1) Rabbit pAb (A16432, ABclonal, 1:2000), and Rabbit polyclonal Anti-beta-actin antibody (bs-0061R) (BS-0061R, BIOSS, 1:5000). The secondary antibodies include HRP-Goat anti Rabbit (5220-0336, Seracare, 1:50000) and HRP-Goat anti Mouse (5220-0341, Seracare, 1:50000).

[0073] CCK-8 detection showed that 50nM IGFBP1 recombinant protein was the optimal and economic concentration for the treatment of primary follicular granulosa cells Figure 6 A) Compared with the control group (BSA), the addition of IGFBP1 recombinant protein can significantly up-regulate the mRNA expression of proliferation-promoting marker genes (PCNA, CCNB2, CCND1, CDK1) and significantly down-regulate the mRNA expression of proliferation-inhibiting marker genes (CDKN2B) (P<0.05) Figure 6 B) Cell cycle analysis showed that recombinant protein treatment can significantly promote the transformation of cells from G1 / G0 phase to S phase and G2 / M phase (P<0.01) Figure 6 C) EdU staining and quantification results further confirmed that recombinant protein can significantly promote granulosa cell proliferation Figure 6 D) Western Blot results showed that IGFBP1 recombinant protein can significantly increase the protein expression levels of PCNA and CDK1 (P<0.01) Figure 6 E) In summary, IGFBP1 gene is a positive regulator of follicular granulosa cell proliferation and can promote follicular development.

[0074] qRT-PCR results showed that compared with the control group, after adding recombinant protein to the cells, the mRNA expression of progesterone synthesis marker genes (StAR, CYP11A1) and estrogen synthesis marker gene CYP19A1 was significantly up-regulated (P<0.05) Figure 7 A) Cell supernatant ELISA detection showed that IGFBP1 recombinant protein can significantly promote the synthesis of progesterone and estrogen by granulosa cells (P<0.05) Figure 7 B, C) Western Blot results further confirmed that IGFBP1 recombinant protein can significantly increase the protein expression levels of StAR, CYP11A1 and CYP19A1 Figure 7 D) In summary, IGFBP1 gene is a positive regulator of follicular granulosa cell steroid hormone synthesis and can promote the synthesis of estrogen and progesterone in follicles.

[0075] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. The application of the IGFBP1 gene in regulating the proliferation and hormone synthesis of chicken follicular granulosa cells, characterized in that, The amino acid sequence of the IGFBP1 gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The CDS region base sequence of the IGFBP1 gene is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The IGFBP1 gene is a positive regulator of steroid hormone synthesis in follicular granulosa cells, promoting the synthesis of estrogen and progesterone in follicles.

4. The application according to claim 1, characterized in that, The IGFBP1 gene is a positive regulator of follicular granulosa cell proliferation and can promote follicular development.

5. The application according to claim 1, characterized in that, The amino acid sequence of the IGFBP1 gene is 3 ˊ The end contains the His tag.

6. Application of the protein encoded by the IGFBP1 gene in the preparation of reagents that promote the development of chicken granulosa cells or chicken follicles.

7. Application of IGFBP1 gene in marker-assisted breeding of chicken egg production trait.