Specific target sequence, primer pair and kit for identifying fusarium species based on temporal method and application

Abstract

The invention discloses a specific target sequence, a primer pair and a kit for identifying fusarium species based on a time-precious method, application of the specific target sequence, the primer pair and the kit and a species identification method, and accurate identification of fusarium related species can be achieved based on species specific sequences obtained through analysis and screening of all genomes of fusarium. The species identification method disclosed by the invention is strong in specificity, high in sensitivity and multiple in detection technology, can realize rapid identification of species, has important significance in medicinal material fungal pollution detection and agricultural disease control, and has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of Fusarium species identification, in particular to a specific target sequence for identifying Fusarium species based on the Analysis of whole-GEnome (AGE, also known as whole-genome analysis method or AGE method), a primer pair, a kit, applications thereof and a species identification method. BACKGROUND

[0002] Fusarium fungi are widely distributed in nature and are common pathogens in clinical practice, which can produce toxins that pose a serious threat to human and animal health. Fusarium fungi infect various economic crops and often result in severe yield loss. Among them, Fusarium oxysporum is listed as one of the world's top ten plant pathogenic fungi, infecting more than 100 economic crops, including cotton and soybeans, resulting in at least 30% reduction in yield, and even up to 90% in severe cases. Fusarium graminearum infects more than 5.3 million hectares of farmland in China each year, while Fusarium culmorum is the main pathogen of European wheat. Both Fusarium graminearum and Fusarium culmorum can produce mycotoxins classified as Group 3 carcinogens, have highly similar morphological characteristics, and are difficult to distinguish using conventional DNA barcode sequences (e.g., ITS, EF-1α, mtSSU, and β-tubulin). Accurate identification of Fusarium oxysporum, Fusarium graminearum, and Fusarium culmorum is of great significance for effective disease management, toxin monitoring, and crop safety. SUMMARY

[0003] The present application is based on the Analysis of whole-GEnome (AGE) method to screen all genomes of Fusarium species, and develops specific target sequences and specific primer pairs that can effectively identify Fusarium species, thereby achieving accurate identification of closely related species of Fusarium. The identification process is convenient and fast, the identification result is accurate, and the sensitivity is high.

[0004] 1. The present application designs a Fusarium species identification method based on the Analysis of whole-GEnome (AGE) method, comprising:

[0005] (1) Obtain all published species genomes of Fusarium on the NCBI website, decompose them into 25-base-length fragment sequences, extract all fragment sequences containing PAM (starting with TTTV, where V represents G, C or A) structure, and construct a sequence alignment library; extract fragment sequences containing PAM structure, containing four bases, with GC content of 30% to 70%, not containing hexanucleotides, and not containing simple repeat sequences, to construct a candidate target sequence library.

[0006] (2) Each candidate target sequence library of Fusarium species is aligned with all sequences in the sequence alignment library of other Fusarium species, and sequences with 3 or more nucleotide differences are retained to form a specific target sequence library, and the frequency of each specific target sequence in all genomes of the same species is counted.

[0007] (3) From the above specific target sequence library, according to the frequency, randomly select specific target sequences from the highest frequency sequences for alignment in NCBI, and select sequences with 3 or more nucleotide differences with other species sequences for subsequent detection, which can be used to identify the specific sequence corresponding to the Fusarium species and any other species.

[0008] 2. As described in paragraph 1, the specific target sequences of Fusarium species provided by the present disclosure are as follows:

[0009]

[0010] Among them, SEQ ID NO: 1 is the specific target sequence of Fusarium oxysporum, SEQ ID NO: 2 is the specific target sequence of Fusarium graminearum, and SEQ ID NO: 3 is the specific target sequence of Fusarium culmorum. In some embodiments, the specific target sequence for identifying Fusarium species is not limited to this, and should include all specific target sequences that meet the conditions screened by the Shi Zhen method.

[0011] 3. The specific target sequence as described in paragraph 2, a specific primer pair is designed for amplifying the DNA sample to be detected for subsequent detection, and the primer pair for specific amplification of the specific target sequence of Fusarium species provided by the present disclosure is as follows:

[0012]

[0013] SEQ ID NO: 4 and SEQ ID NO: 5 are used to amplify the specific target sequence with nucleotide sequence of SEQ ID NO: 1; SEQ ID NO: 6 and SEQ ID NO: 7 are used to amplify the specific target sequence with nucleotide sequence of SEQ ID NO: 2; and SEQ ID NO: 8 and SEQ ID NO: 9 are used to amplify the specific target sequence with nucleotide sequence of SEQ ID NO: 3.

[0014] 4. The primers of paragraph 3, suitable for any type of DNA amplification method, including but not limited to polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), real-time quantitative PCR (qPCR), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), recombinase polymerase amplification (RPA), enzyme-mediated isothermal amplification (ERA).

[0015] 5. The method of paragraphs 2-4, obtaining the genomic DNA of the Fusarium sample to be detected, the specific primer pair of SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 can be used to amplify SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, respectively, and the detection of the obtained amplification product can determine whether the specific target sequence exists. The detection system of the specific target sequence includes agarose gel detection system, Sanger sequencing system and CRISPR-Cas12a system, but is not limited to the above three methods. For the agarose gel detection system, if the amplification product has a single band, it indicates that the sample to be tested has identity with the specified Fusarium species; otherwise, it indicates that the two do not have identity. For the Sanger sequencing system, if the sequencing result is the same as the standard specific target sequence, the sample to be detected has identity with the specified Fusarium species, otherwise it does not. For the CRISPR-Cas12a system, detection is carried out in the following way: if a band appears on the detection band of the test strip, it indicates that the sample to be tested has identity with the specified Fusarium species; otherwise, it indicates that the two do not have identity.

[0016] 6. The method of paragraph 5, the specific crRNA for the identification of Fusarium species is designed as follows:

[0017]

[0018] SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 are used to amplify the specific crRNA with the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

[0019] 7. The method of paragraphs 2-6, the kit provided by the present application includes reagents for nucleic acid amplification, related reagents for agarose gel electrophoresis technology and related reagents for gene editing technology:

[0020] In some preferred embodiments, the nucleic acid amplification reagent comprises: PCR amplification buffer, dNTPs, Taq DNA polymerase, MgCl2, and sterile ultrapure water. In some preferred embodiments, the agarose gel electrophoresis reagent comprises: PCR amplification buffer, dNTPs, Taq DNA polymerase, MgCl2, and sterile ultrapure water, electrophoresis buffer, agarose powder, Marker, nucleic acid dye, loading buffer. In some preferred embodiments, the CRISPR-Cas12a system reaction reagent comprises: gene editing buffer, Cas protein, crRNA, nuclease-free water, and fluorescent signal molecules (such as ssDNA fluorescent reporter).

[0021] When the method described herein is used for species identification, the species to be identified can be distinguished from its close relatives, thereby accurately achieving accurate identification of the sample to be detected involving Fusarium at the species level. The method can accurately identify plant pathogenic fungi, and can be widely used in disease monitoring and control in the fields of agriculture, horticulture, medicinal plants and other fields, providing strong technical support for the management of plants, especially economic crops and medicinal plants, and playing a positive role in food safety, drug and health product safety. The method has strong specificity, high sensitivity, good repeatability, and can realize rapid identification of the species of biological samples, and therefore can have a broad application prospect.

[0022] The embodiments of the present application are only preferred schemes, and are intended to better illustrate the technical principles and application modes of the present application. It should be particularly pointed out that, without deviating from the technical principles of the present application, the implementation of the present application can be appropriately adjusted according to actual needs to achieve the best technical effect. Therefore, the protection scope of the present application is not only limited to the specific embodiments shown herein, but also covers all equivalent changes and improvements made on the basis of the principles and innovations of the present application.

[0023] The exemplary schemes of the present application will be further described below in conjunction with the accompanying drawings to illustrate the purposes, technical features and technical effects of the schemes of the present application, but the schemes of the present application can also have other undiscussed features, advantages, etc., and for ordinary skilled persons in the art, other drawings can also be obtained without creative labor on the basis of these drawings. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 The alignment results of specific target sequences of Fusarium oxysporum, F. graminearum and F. culmorum species in NCBI are shown.

[0025] Figure 2 The agarose gel electrophoresis results of Fusarium oxysporum, F. graminearum and F. culmorum species are shown.

[0026] Figure 3 Sanger sequencing results of F. oxysporum, F. graminearum and F. culmorum species are shown.

[0027] Figure 4 Test strip results of F. oxysporum, F. graminearum and F. culmorum species are shown: 1 - F. graminearum, 2 - F. oxysporum, 3 - F. culmorum, 4 - CK. DETAILED DESCRIPTION

[0028] The present application is described in detail below with reference to Examples, but it is not meant to present any disadvantageous limitations to the present application. The present application has been described in detail herein, and specific embodiments thereof have been disclosed with particularity, but it is to be understood that various changes and modifications can be suggested to one skilled in the art, and it is intended that the present application encompass such changes and modifications as fall within the scope of the appended claims.

[0029] In this document, the terms“or” and“and” are used to mean, and are intended to mean both“and” and“or,” unless context clearly indicates otherwise. In this document, the terms“comprise,”“comprises,” and“comprising” or any variation thereof, are used to mean“include,”“includes,” and“including,” and are intended to be inclusive and not exclusive, unless context clearly indicates otherwise.

[0030] In this document, the terms“comprise,”“comprises,” and“comprising” or any variation thereof, are used to mean“include,”“includes,” and“including,” and are intended to be inclusive and not exclusive, unless context clearly indicates otherwise.

[0031] In this document, the term“whole genome” encompasses not only the entire genomic sequence of an organism, but also organellar genomes (e.g., mitochondrial genomes), unless otherwise indicated.

[0032] The experimental methods in the following examples, unless otherwise specified, were carried out according to the conventional conditions. Unless otherwise specified, the reagents, materials or instruments used in the following examples, if not noted the manufacturer, are conventional products that can be purchased on the market.

[0033] Example 1: Screening of F. oxysporum, F. graminearum and F. culmorum specific target sequences

[0034] 1.1 Acquisition of whole genome sequences of Fusarium genus.

[0035] Fusarium 185 species 1347 genomes were downloaded from NCBI database, among which there were 741 genomes of Fusarium oxysporum, 128 genomes of Fusarium graminearum and 5 genomes of Fusarium culmorum.

[0036] 1.2 Based on all genomes of Fusarium, specific target sequence library of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum was constructed.

[0037] All genomes of Fusarium were decomposed into 25 bp fragments, and the sequences of all fragments containing PAM structure were extracted to form sequence alignment library; the sequences of fragments containing PAM structure, containing 4 kinds of bases, with GC content of 30% to 70%, not containing hexanucleotide, and not containing simple repeat sequence were extracted to form candidate target sequence library. All sequences in the candidate target sequence library of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum were aligned with the genomes of other species of Fusarium, and the sequences with 3 or more nucleotide differences were retained to form specific target sequence library, and the frequency of each specific target sequence appearing in all genomes of the same species was counted.

[0038] 1.3 Screening of reference target sequences of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum.

[0039] From the above specific target sequence library, according to the frequency, the specific target sequence with the highest frequency was randomly selected and aligned in NCBI, and the sequence with 3 or more nucleotide differences with other species sequences was selected. One target sequence specific to the species in a wide range of biological kingdom was selected for each of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum, i.e. SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

[0040] Example 2: Verification of specific target sequences of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum by agarose gel electrophoresis

[0041] In order to determine whether the specific target sequences of the species to be identified selected in Example 1 can specifically and accurately reflect the identity of the sample to be detected and the species to be identified (target species), the following based on the genomic DNA of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum respectively to identify the species of sample.

[0042] 2.1 Extraction of genomic DNA of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum samples to be detected

[0043] Three fungal samples were collected in this example, one each of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum, and the relevant information is shown in Table 1.

[0044] Table 1 Sample information table

[0045]

[0046] The strain activation culture and DNA extraction were entrusted to a biotechnology company (with quality management system certification certificate; certificate number: 16422Q30560ROS) to operate.

[0047] Based on the specific target sequences of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum obtained in Example 1, specific primers were designed, and the sequence information is as follows:

[0048] Fo_F: 5'-GGATGGAAGGGTGACTTGAGAA-3'(SEQ ID NO: 4);

[0049] Fo_R: 5'-TGTTGGCCAGCGTTTAGCTT-3'(SEQ ID NO: 5);

[0050] Fg_F: 5'-TACCACCAAGACAGTTTGGATCAT-3'(SEQ ID NO: 6);

[0051] Fg_R: 5'-GGATGTAGGACAGTAGACTACGC-3'(SEQ ID NO: 7);

[0052] Fcu_F: 5'-CAGTTGAACCTACTGGGGTCTT-3'(SEQ ID NO: 8);

[0053] Fcu_R: 5'-TGTACTACGAGATGAAGCTGCAGG-3'(SEQ ID NO: 9);

[0054] Among them, SEQ ID NO: 4 and SEQ ID NO: 5 are specific primer pairs of Fusarium oxysporum, SEQ ID NO: 6 and SEQ ID NO: 7 are specific primer pairs of Fusarium graminearum, and SEQ ID NO: 8 and SEQ ID NO: 9 are specific primer pairs of Fusarium culmorum.

[0055] 2.2 Detection of samples based on specific target sequences using agarose gel electrophoresis technology

[0056] The genomic DNA of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum obtained was amplified using the specific primers designed above, and the PCR reaction system was 25 μL, and the PCR amplification program was: 95 ℃ for 5 min; 94 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 30 s, 30 cycles; 72 ℃ for 7 min.

[0057] PCR system

[0058]

[0059] After the PCR reaction is completed, 1.5% agarose electrophoresis is used to detect the PCR product, the voltage is 120V, and the electrophoresis time is set to 1 hour. If the PCR product amplified by the Fo_F and Fo_R primer pair appears a band after electrophoresis detection, it is Fusarium oxysporum, if the PCR product amplified by the Fg_F and Fg_R primer pair appears a band after electrophoresis detection, it is Fusarium graminearum, and if the PCR product amplified by the Fcu_F and Fcu_R primer pair appears a band after electrophoresis detection, it is Fusarium culmorum, Figure 2 is an electrophoresis result diagram.

[0060] Example 3: Verification of specific target sequences of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum by Sanger sequencing

[0061] In order to determine whether the specific target sequence of the identified species screened in Example 1 can specifically and accurately reflect the identity of the sample to be detected and the identified species (target species), the species identification of the sample is carried out based on the genomic DNA of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum respectively.

[0062] 3.1 Extraction of genomic DNA of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum samples to be detected and PCR amplification

[0063] The specific steps are the same as 2.1 and 2.2 in Example 2. The PCR product is sent for testing.

[0064] If the same sequence as SEQ ID NO: 1 exists in the sequencing result, it is Fusarium oxysporum. If the same sequence as SEQ ID NO: 2 exists in the sequencing result, it is Fusarium graminearum. If the same sequence as SEQ ID NO: 3 exists in the sequencing result, it is Fusarium culmorum. Figure 3 is a sequencing result diagram, and the primers of the other species cannot be amplified.

[0065] Example 4: Verification of specific target sequences of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum by genome editing system

[0066] 4.1 Design of crRNA matching the specific target sequence

[0067] According to the genome editing system (CRISPR / Cas12a system) and the crRNA design principle used in subsequent experiments, the crRNA matching the specific target sequence was designed, named Fo_crRNA (UAAUUUCUACUAAGUGUAGAUGAUAAGCGCCUUUCGCAUCUA; SEQ ID NO: 10), Fg_crRNA (UAAUUUCUACUAAGUGUAGAUGAUCAUCCCAGGUGGACCGUU; SEQ ID NO: 11) and Fcu_crRNA (UAAUUUCUACUAAGUGUAGAUAUACUUGGACCACUCCUCUGU; SEQ ID NO: 12).

[0068] 4.2 Genome DNA extraction of Fusarium oxysporum, Fusarium graminearum and Fusarium culmorum samples to be detected, PCR amplification

[0069] The specific steps are the same as 2.1 and 2.2 in Example 2.

[0070] The experiment was performed using EnGen Lba Cas12a (Cpf1) of NEB company, and the total volume of the reaction system was 50 μL: 5 μL 10x NEBuffer 2.1, 1 μL Lba Cas12a (20 nM), 1.7 μL crRNA (300 nM), 10 μL PCR product, 30.3 μL sterile ultrapure water, 2 μL Poly_C_FB (5’6-FAM / TTATTATT / 3’Bio, 400 nM) and 30.3 μL sterile ultrapure water. The PCR product and NEBuffer 2.1, Lba Cas12a, crRNA and sterile ultrapure water were added in the PCR tube, and then incubated at 37°C for 10 minutes; then Poly_C_FB was added, mixed, inserted into the test strip, and the result was read after 10 minutes. If a band appears at the T band position of the test strip, it is the corresponding species in the reaction system.

[0071] Figure 2 The agarose electrophoresis map is shown, and only the target species appears a band; Figure 3 The Sanger sequencing result map is shown, and only the specific target sequence exists in the amplified sequence of the target species; Figure 4 The test strip detection result is shown, and only the target species appears a band at the test line position (T) of the test strip, while the negative control group (CK) and other species only appear a band at the control line (C).

[0072] According to the results of the above-mentioned embodiments 2, 3 and 4, it can be known that the method described in the present application can accurately identify the species of the Fusarium oxysporum, F. graminearum and F. culmorum samples, and can be used to clearly distinguish the closely related species F. graminearum and F. culmorum.

[0073] It should be understood by those of ordinary skill in the art that the above discussion of any of the embodiments is merely exemplary and is not intended to be limiting of the scope of the disclosure; the above embodiments or technical features among different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes of different aspects of the embodiments of the disclosure as described above, which are not provided in details for the sake of brevity. The embodiments of the disclosure are intended to cover all such alternatives, modifications, and variations as fall within the broad scope of the appended claims. Therefore, any omission, modification, equivalent replacement, improvement, etc. made in the spirit and principle of the embodiments of the disclosure shall be included in the protection scope of the disclosure.

[0074] For the purpose of description and disclosure, all patents, patent applications, and other publications are expressly incorporated herein by reference. These publications are provided solely for their disclosure prior to the filing date of the application. All statements as to the date or contents of these publications are based on the information available to the applicant and do not constitute any admission as to the correctness of the dates or contents of these publications. Moreover, nothing in this portion shall be construed as an admission that these publications are part of the common general knowledge of the art.

Claims

1. A specific target sequence for identifying Fusarium species, comprising a specific target sequence SEQ ID NO: 1 for identifying Fusarium oxysporum, a specific target sequence SEQ ID NO: 2 for identifying Fusarium graminearum, and a specific target sequence SEQ ID NO: 3 for identifying Fusarium chrysogenum.

2. The application of the target nucleotide of claim 1 in species identification or differentiation of Fusarium species or materials derived from Fusarium species; Preferably, the Fusarium species are selected from Fusarium oxysporum, Fusarium graminearum, and Fusarium chrysogenum.

3. A primer pair for species identification of Fusarium species or materials derived from Fusarium species, comprising: (1) Fo_F: 5'-GGATGGAAGGGTGACTTGAGAA-3' (SEQ ID NO: 4), and Fo_R: 5'-TGTTGGCCAGCGTTTAGCTT-3' (SEQ ID NO: 5); or (2) Fg_F: 5'-TACCACCAAGACAGTTTGGATCAT-3' (SEQ ID NO: 6), and Fg_R: 5'-GGATGTAGGACAGTAGACTACGC-3' (SEQ ID NO: 7); or (3) Fcu_F: 5'-CAGTTGAACCTACTGGGGTCTT-3' (SEQ ID NO: 8), and Fcu_R: 5'-TGTACTACGAGATGAAGCTGCAGG-3' (SEQ ID NO: 9).

4. The primer pair as described in claim 3, wherein, The Fusarium species were selected from Fusarium oxysporum, Fusarium graminearum, and Fusarium chrysogenum.

5. A kit for species identification of Fusarium species or materials derived from Fusarium species, wherein, The kit contains the primer pair as described in claim 3 or 4.

6. The kit according to claim 5, wherein, The kit also includes: PCR reaction reagents and CRISPR-Cas12a system reaction reagents; Preferably, the PCR reaction reagent comprises: PCR amplification buffer, dNTPs, Taq DNA polymerase, MgCl2, and sterile ultrapure water; Alternatively, preferably, the CRISPR-Cas12a system reaction reagent comprises: gene editing buffer, Cas protein, crRNA, nuclease-free water, and fluorescent signal molecule; more preferably, the crRNA is any of the crRNAs shown in SEQ ID NOs: 10-12.

7. The primer pair of claim 3 or 4 or the kit of claim 5 or 6 may be used for the following purposes: identifying Fusarium species components in a sample to be tested, identifying Fusarium species or materials derived from Fusarium species, distinguishing closely related species derived from Fusarium, or for the identification of crop or plant pathogens and the safety testing of traditional Chinese medicine.

8. The application as described in claim 7, wherein, The sample to be tested is a sample from a single species or a mixture of samples from multiple species, which can accurately detect the presence of Fusarium species in the sample.

Images