Application of TRAF7 in screening of anti-lung injury drugs

Abstract

The invention discloses an application of TRAF7 in screening of anti-lung injury drugs. In an LPS-induced A549 cell acute lung injury model, TRAF7 gene knock-down significantly aggravates cell apoptosis and inflammatory response, which shows that inflammatory factor release is increased, and cell injury is aggravated; and TRAF7 overexpression can obviously inhibit the pathological change. The result shows that the TRAF7 has a protection effect on alveolar epithelial cells, the expression level of the TRAF7 is in negative correlation with the in-vitro lung injury degree, and it is proved that the TRAF7 has a negative regulation effect in acute lung injury. In a mouse ALI model, TRAF7 overexpression can significantly reduce the total number of cells, the total protein content and the wet / dry weight ratio of lung tissue in bronchoalveolar lavage fluid (BALF), relieve the pathological injury score of the lung and inhibit LY6Gneutrophil and CD68 macrophage infiltration. The TRAF7 can effectively relieve LPS-induced pulmonary edema, vascular permeability increase and tissue inflammation, and the anti-inflammatory and tissue protection functions of the TRAF7 in an in-vivo model are verified.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular medicine and drug screening technology, and relates to an application based on TRAF7-AKT protein interaction regulation of K6-linked ubiquitination pathway, specifically including a method for screening anti-lung injury candidate drugs, individualized treatment strategy and gene therapy composition. BACKGROUND

[0002] Acute lung injury (ALI) is an acute respiratory failure syndrome caused by infection, trauma and other factors, and its pathological features include alveolar epithelial and endothelial barrier destruction, pulmonary edema and diffuse inflammatory infiltration. In severe cases, it can develop into acute respiratory distress syndrome (ARDS) with a mortality rate of 30-40%. Currently, there is no specific treatment drug in clinical practice, and mechanical ventilation and supportive treatment are mainly relied on.

[0003] In recent years, studies have shown that tumor necrosis factor receptor-associated factor 7 (TRAF7) as an E3 ubiquitin ligase plays an important role in regulating inflammation and cell survival. Studies have reported that TRAF7 can participate in immune regulation process by ubiquitination modification of key signaling proteins. For example, researchers in the field have found that TRAF7 is up-regulated in LPS-induced lung injury model and can alleviate inflammatory response by K6-linked ubiquitination modification of AKT protein.

[0004] However, although the biological function of TRAF7 in ALI has been gradually revealed, there is still a lack of systematic drug screening strategy based on this target. In particular, there is no research on how to use the interaction interface between TRAF7 and downstream proteins (such as AKT) to design small molecule agonists, nor has an in vitro biochemical system for high-throughput screening been established. In addition, there is no related technical solution on how to implement individualized treatment according to the expression state of TRAF7 in patients.

[0005] Therefore, it is urgent to provide a new drug screening and treatment strategy based on the function of TRAF7 to promote the precise intervention and drug development of ALI. SUMMARY

[0006] To solve the defects and deficiencies of the prior art in the clinical prevention and treatment of acute lung injury and related inflammatory diseases, the purpose of the present application is to clarify the mutual relationship between the expression of TRAF7 gene and acute lung injury and related inflammatory diseases. On this basis, an application of TRAF7 as a drug target for screening drugs for preventing and treating acute lung injury and related inflammatory diseases is provided, and further a technical solution for preparing related treatment products by targeting regulation of TRAF7 gene expression or function is proposed.

[0007] To achieve the above object, the present application is realized by the following technical solutions: The object of the present application is realized by the following technical solutions: In the in vitro cultured A549 alveolar epithelial cells and mouse acute lung injury (ALI) model, lipopolysaccharide (LPS) is used to stimulate and induce the disease phenotype, and the effects of TRAF7 gene overexpression or knockout on inflammatory response, cell apoptosis and tissue damage are systematically evaluated.

[0008] In the in vitro experiment, A549 cells are infected with lentivirus carrying TRAF7 overexpression or shRNA knockdown sequence to establish a stable expression model. After LPS stimulation, related indicators are detected by Western Blot, RT-qPCR and immunofluorescence methods. The results show that TRAF7 gene knockdown significantly aggravates LPS-induced cell apoptosis and release of inflammatory factors (such as IL-6, TNF-α); while TRAF7 overexpression significantly inhibits the above pathological changes. It shows that TRAF7 has the effect of protecting alveolar epithelial cells and reducing inflammatory response.

[0009] In the in vivo experiment, wild type (WT), TRAF7 gene knockout (TRAF7 KO) and AAV6 mediated TRAF7 overexpression mouse models are used, and ALI model is constructed by tracheal instillation of LPS. The results show that TRAF7 overexpression can significantly reduce the total number of cells, total protein concentration in bronchoalveolar lavage fluid (BALF) and lung tissue wet / dry weight ratio, reduce lung pathological damage score, and inhibit LY6G⁺ neutrophil and CD68⁺ macrophage infiltration. These results confirm that TRAF7 has the effect of relieving pulmonary edema, inhibiting inflammatory cell infiltration and improving lung function in vivo.

[0010] Based on the above findings, the present application further proposes the following scheme: In a first aspect, the application of TRAF7 in screening anti-lung injury drugs, characterized in that: by screening small molecule compounds capable of binding the interaction interface between the WD40 domain of TRAF7 protein and the PH domain of AKT protein, candidate drugs that can promote K6-linked ubiquitination modification of AKT by TRAF7 are obtained, and the candidate drugs make the K6 ubiquitination level of AKT increase by ≥ 35% in in vitro experiments.

[0011] In some embodiments, the application further includes designing a peptide molecule simulating the amino acid sequence of TRAF7 at positions 352-368, which is used to enhance the binding ability of TRAF7 and AKT, thereby promoting K6-linked ubiquitination of AKT, and screening candidate drugs with anti-alveolar epithelial cell inflammation and apoptosis effect.

[0012] In some other embodiments, the application further comprises detecting the expression level of TRAF7 protein in the patient's bronchoalveolar lavage fluid (BALF), and when the concentration is lower than 0.8 ng / mL, a candidate drug that can up-regulate the expression of TRAF7 or enhance the E3 ubiquitin ligase activity of TRAF7 is preferentially selected for intervention.

[0013] The application has the following beneficial effects: The present application breaks through the limitation of the existing research that only reveals the interaction between TRAF7 and AKT, proposes to use the protein interaction interface as a drug intervention target, and enhances the K6-linked ubiquitination modification ability of TRAF7 on AKT by designing small molecule compounds or peptide mimics, realizes the conversion from mechanism discovery to functional drug development. In the in vitro screening system, the candidate compound can increase the K6-linked ubiquitination level of AKT by more than 38%, and has less effect on K48 / K63 ubiquitination (<15%), with high chain selectivity. In the A549 cell model, this kind of compound significantly inhibits the expression of IL-6 and TNF-α induced by LPS (decreased by 61% and 54% respectively), which is better than dexamethasone. In addition, by detecting the concentration of TRAF7 protein in the patient's BALF, when it is lower than 0.8 ng / mL, the TRAF7 agonist treatment is started, which can significantly improve the response rate of efficacy and realize individualized precise intervention.

[0014] In the second aspect, the present application provides a pharmaceutical composition for preventing or treating acute lung injury, characterized in that: it comprises an effective amount of a nucleic acid expression vector encoding TRAF7, the vector is an AAV6 vector, the expression is driven by a SPC (surfactant protein C) promoter, and the TRAF7 coding sequence is fused with a nuclear localization signal (NLS) to enhance its subcellular distribution regulation ability; the composition is administered intratracheally, and the single dose is 1×10 11 -5×10 11 vg / kg.

[0015] The pharmaceutical composition of the present application has the following beneficial effects: The present application uses AAV6 serotype combined with SPC promoter to realize efficient targeted delivery to alveolar type II epithelial cells; after TRAF7 is fused with NLS sequence, its nuclear-cytoplasmic shuttling ability is enhanced, and it responds more quickly and plays the function of E3 ubiquitin ligase under LPS stimulation; in a mouse model, a single intratracheal administration can significantly reduce the lung tissue wet / dry weight ratio by 42%, reduce BALF protein leakage, and the effect lasts for more than 7 days; the administration dose is optimized, and when it is lower than 1×10 11 vg / kg, the effect is not good, and when it is higher than 5×10 11Vg / kg induced a mild immune response, and this range is the optimal therapeutic window.

[0016] In a third aspect, the present application provides an in vitro screening method of TRAF7 agonists, characterized in comprising the following steps: S1. providing recombinant TRAF7 protein, AKT protein, E1, E2 (UbcH5c), Myc-labeled K6-only mutant ubiquitin (Myc-Ub^K6O) and proteasome inhibitor MG132; S2. co-incubating the test compound with the above components in a reaction buffer at 37°C for 2 hours; S3. performing immunoprecipitation using anti-AKT antibody, and then detecting the modification level of AKT using anti-K6-linked ubiquitination antibody; S4. screening the compound that increases the K6-linked ubiquitination level by ≥30% and does not significantly affect K48 / K63 ubiquitination as a candidate TRAF7 agonist.

[0017] The method of the present application has the following beneficial effects: The method of the present application has the following beneficial effects:

[0018] The method of the present application has the following beneficial effects:

[0019] The method of the present application has the following beneficial effects:

[0020] The method described in the application is suitable for 96-well or 384-well plate high-throughput screening mode, has been successfully applied to the screening of ChemDiv small molecule compound library, and a plurality of lead compounds with TRAF7 agonistic activity are identified, wherein SMA-01 can make the K6 ubiquitination level increase by 42% at a concentration of 10 μM, and the molecular docking score thereof reaches-10.2 kcal / mol, showing good binding affinity. BRIEF DESCRIPTION OF DRAWINGS

[0021] The accompanying drawings are used to provide an understanding of the technical scheme of the application, and constitute a part of the specification, and together with the embodiments of the application are used to explain the technical scheme of the application, and do not constitute a limitation on the technical scheme of the application Figure 1 Fig. 1: A549 cell and mouse detection result graph before and after LPS stimulation in vivo / outside. GAPDH is used as an internal reference, and the column chart is normalized to 1 for the PBS group and the Sham group, **P<0.01.

[0022] Figure 1 A: Protein expression level detection result graph of TRAF7, inflammatory cytokines (TNFA, IL6) and apoptosis genes (Cleaved-caspase3, BAX, p-BAD, BCL2) in A549 cells; Figure 1 B: A549 cell TRAF7 mRNA expression level statistical column chart; Figure 1 C: Protein expression level detection result graph of TRAF7, inflammatory cytokines (TNFA, IL6) and apoptosis genes (Cleaved-caspase3, BAX, p-BAD, BCL2) in mouse lung tissues; Figure 1 D: Mouse lung tissue TRAF7 mRNA expression level statistical column chart.

[0023] Fig. 2: TRAF7 knockdown A549 cell LPS stimulation detection result graph. GAPDH is used as an internal reference, and the column chart is normalized to 1 for shRNA, *P<0.05, **P<0.01.

[0024] Figure 2-1 A: TRAF7 protein expression level detection graph of two A549 cell lines of shTRAF71 and control shRNA; Figure 2-1 B: mRNA statistical column chart of inflammatory factors (IL-1β, IL-6) and chemotactic factors (CXCL2, CXCL3, CCL2, CXCL5) of two A549 cells of shTRAF71 and control shRNA; Figure 2-2 A: Fluorescence images of apoptosis of A549 cells with shTRAF7 and control shRNA; Figure 2-2 B: Protein expression level detection results of apoptosis genes (Cleaved-caspase3, BAX, p-BAD, BCL2) of A549 cells with shTRAF7 and control shRNA.

[0025] Figure 3: Detection results of A549 cells with TRAF7 overexpression after LPS stimulation. GAPDH was used as an internal reference, and the column chart was normalized to GFP as 1, *P < 0.05, **P < 0.01.

[0026] Figure 3-1 A: TRAF7 protein expression level detection chart of A549 cell lines with TRAF7 OE and control GFP; Figure 3-1 B: mRNA statistical column chart of inflammatory factors (IL-1β, IL-6) and chemotactic factors (CXCL2, CXCL3, CCL2, CXCL5) of A549 cells with TRAF7 OE and control GFP; Figure 3-2 A: Fluorescence images of apoptosis of A549 cells with TRAF7 OE and control GFP; Figure 3-2 B: Protein expression level detection results of apoptosis genes (Cleaved-caspase3, BAX, p-BAD, BCL2) of A549 cells with TRAF7 OE and control GFP.

[0027] Figure 4: Pathological and molecular detection results of WT and TRAF7 KO mice after Sham and LPS treatment.

[0028] Figure 4-1 A: TRAF7 protein expression level detection chart of WT and TRAF7 KO mice; Figure 4-1 B: Statistical column chart of lung wet-to-dry weight ratio of WT and TRAF7 KO mice after Sham and LPS treatment; Figure 4-1 C: Statistical column chart of total cell count in the bronchoalveolar lavage fluid of WT and TRAF7 KO mice after Sham and LPS treatment; Figure 4-1 D: Statistical column chart of total protein quantification in the bronchoalveolar lavage fluid of WT and TRAF7 KO mice after Sham and LPS treatment; Figure 4-1E: Representative HE staining of WT and TRAF7 KO mice after Sham and LPS treatment; Figure 4-1 F: Representative immunofluorescence of CD68, LY6G, CD11b of WT and TRAF7 KO mice after Sham and LPS treatment; Figure 4-1 G: mRNA statistical column chart of inflammatory chemokines (IL-1β, IL-6, CXCL2, CXCL3, CCL2, CXCL5) of WT and TRAF7 KO mice after Sham and LPS treatment; Figure 4-2 A: TUNEL immunofluorescence statistical column chart of mouse lung tissue of WT and TRAF7 KO mice after LPS treatment; Figure 4-2 B: Protein expression level detection result chart of apoptosis genes (Cleaved-caspase3, BAX, p-BAD, BCL2) of mouse lung tissue of WT and TRAF7 KO mice after LPS treatment.

[0029] Figure 5 AAV6-GFP and AAV6-GFP-TRAF7 mice after Sham and LPS treatment.

[0030] Figure 5 A: TRAF7 protein expression level detection chart of AAV6-GFP and AAV6-GFP-TRAF7 mice; Figure 5 B: Statistical column chart of lung wet-to-dry weight ratio of AAV6-GFP and AAV6-GFP-TRAF7 mice after Sham and LPS treatment; Figure 5 C: Statistical column chart of total cell count in bronchoalveolar lavage fluid of AAV6-GFP and AAV6-GFP-TRAF7 mice after Sham and LPS treatment; Figure 5 D: Statistical column chart of total protein quantification in bronchoalveolar lavage fluid of AAV6-GFP and AAV6-GFP-TRAF7 mice after Sham and LPS treatment; Figure 5 E: Representative HE staining of AAV6-GFP and AAV6-GFP-TRAF7 mice after Sham and LPS treatment; Figure 5 F: Representative TUNEL immunofluorescence of mouse lung tissue of AAV6-GFP and AAV6-GFP-TRAF7 mice after LPS treatment and corresponding statistical column chart of positive cell proportion; Figure 5 G: Representative figures of CD68, LY6G, CD11b immunofluorescence and corresponding positive cell proportion statistical column chart of AAV6-GFP and AAV6-GFP-TRAF7 mice after Sham and LPS treatment; Figure 5 H: mRNA statistical column chart of inflammatory chemokines (IL-1β, IL-6, CXCL2, CXCL3, CCL2, CXCL5) of AAV6-GFP and AAV6-GFP-TRAF7 mice after Sham and LPS treatment; Figure 5 I: Detection result figure of protein expression level of mouse lung tissue apoptosis genes (Cleaved-caspase3, BAX, p-BAD, BCL2) of AAV6-GFP and AAV6-GFP-TRAF7 mice after LPS treatment; Figure 6 Flowchart of the in vitro screening method of the TRAF7 agonist according to the application. DETAILED DESCRIPTION

[0032] The technical solutions in the embodiments of the application will be clearly and completely described below with reference to the drawings in the embodiments of the application. Obviously, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by a person of ordinary skill in the art without creative work fall within the protection scope of the application.

[0033] 1. Experimental animals and feeding Experimental animals: 8-10-week-old, 23.5-27.5 g male C57BL / 6 mice were selected as experimental objects.

[0034] Feeding environment: The animals were fed in an SPF-grade experimental animal center, and the feed was an SPF-grade mouse special feed (purchased from Beijing Some Biotechnology Co., Ltd.).

[0035] Feeding conditions: The room temperature was controlled at 22-24°C, the relative humidity was maintained at 40%-70%, 12h light / dark alternating illumination was used, and the animals were allowed to drink water and eat freely.

[0036] 2. Plasmid construction The full-length coding sequence of human TRAF7 was obtained by amplification from human cDNA, and the product was connected to a phage vector to construct a high-expression human TRAF7 plasmid.

[0037] Human TRAF7 knockdown plasmid was constructed by inserting shRNA sequence targeting TRAF7 into pLKO.1 lentivirus vector. All the constructed plasmids were verified by DNA sequencing.

[0038] Plasmids and tool vectors were transfected into A549 cells or HEK293T cells using polyethylenimine (PEI).

[0039] The primer sequences used for construction are as follows: TRAF7-F: 5'-GGAGCGAGATCCCTCCAAAAT-3' TRAF7-R: 5'-GGCTGTTGTCATACTTCTCATGG-3' Target sequence for knocking down TRAF7: 5'-CTACTCCATTGCTGTGACAAA-3'.

[0040] 3. Cell line construction Lentivirus packaging: the target gene plasmid was mixed with lentivirus packaging plasmids psPAX2 and pMD2.G at a ratio of 2:1.5:1 (µg), and co-transfected into HEK293T cells using PEI. The medium was changed after 6–8 h. The supernatant was collected after 48–72 h to obtain the lentivirus stock solution.

[0041] Lentivirus infection: the successfully packaged lentivirus was co-infected with A549 cells at a concentration of 10 µg / mL polybrene. After 48–72 h of infection, appropriate concentrations of puromycin were used for screening. The construction efficiency of the final cell line was verified by Western blot (WB).

[0042] 4. Construction of TRAF7 KO mice An online CRISPR design tool (http: / / chopchop.cbu.uib.no) was used to predict a target region in exon 3 of TRAF7 gene, and the sgRNA sequence was designed as follows: sgRNA: GGCCTGGGAACCTGCAGTGCTGG The sgRNA expression plasmid was constructed using pUC57-sgRNA (Addgene, 51132) as the backbone vector. Purified Cas9 mRNA was mixed with sgRNA, and then injected into the single-cell fertilized eggs of C57BL / 6 mice using the FemtoJet5247 microinjection system. Subsequently, the fertilized eggs were transplanted into surrogate female mice. F0 generation mice were obtained after about 19–21 days of pregnancy. The ear tissue of 2-week-old mice was removed, and genomic DNA was extracted for genotype identification.

[0043] 5. Construction of AAV6-TRAF7 mice Mouse Traf7 and GFP genes were amplified from mouse cDNA, and the PCR products were ligated into pAAV-CMV-MCS-T2A-EGFP vector. The successfully constructed plasmid was packaged into AAV6 virus driven by the CMV promoter to achieve co-expression of Traf7 and GFP.

[0044] The prepared AAV6 virus had a titer of 1.2 x 1011vg / mL, and 100 μL of virus liquid was intratracheally injected into each mouse to achieve specific expression of TRAF7 in lung tissue. After 4 weeks of adenovirus expression, the mice were randomly divided into a sham operation group (Sham group) and an ALI group. All surgical procedures and data analysis were performed in a double-blind manner.

[0045] The primer sequences of mouse Traf7 are as follows: Traf7-F: 5'-CGATCCAGCCTCCGGTACCGCCACCATGGATTACAAGGATGACGACGATAAGATGAGCTACAGCCAAGAGTGCC-3' Traf7-R: 5'-CCTCTCCACTGCCGAATTCGCATGTCCAGACCTTCACGGT-3'.

[0046] 6. Construction of ALI model An acute lung injury (ALI) model was constructed by simulating gram-negative bacterial infection with LPS stimulation. The specific method is as follows: after anesthesia of the mice, 200 μL of LPS (serotype 055:B5, 10 mg / kg) from Escherichia coli was injected into the trachea using a microsyringe. After injection, the mice were kept in a head-low position for 5 minutes to ensure uniform distribution of LPS to the lungs and prevent reflux. Subsequently, the mice were placed in a 28°C incubator to recover to a conscious state.

[0047] At 3, 6, 12, and 24 hours after LPS stimulation, the mice were anesthetized by intraperitoneal injection of sodium pentobarbital, and abdominal venous serum, bronchoalveolar lavage fluid (BALF), and lung tissue samples were collected in turn.

[0048] 7. Lung wet / dry ratio (W / D) evaluation and bronchoalveolar lavage fluid (BALF) collection Physiological saline was injected into the left main bronchus and recovered to obtain BALF. The sample was centrifuged at 5000g for 10 minutes under low temperature conditions to separate the supernatant and the precipitate. The supernatant was used for protein concentration determination (BCA protein quantification kit, item number 23225, Thermo Fisher).

[0049] After red blood cell lysis treatment, the total cell count in BALF was determined using a hemocytometer (Auto1000, Nexcelom).

[0050] The right lung was weighed (wet weight), placed in a 65°C oven for 24 hours, and then weighed (dry weight). The lung wet / dry ratio was calculated: W / D = (wet weight - dry weight) / dry weight All operations and subsequent analysis were performed under blind conditions.

[0051] 8. Hematoxylin-eosin (HE) staining of lung tissue After the lung tissue was taken, it was immediately fixed in 10% neutral formalin, dehydrated, transparent, and paraffin-embedded, and then sectioned (thickness about 5 pm). The sections were subjected to routine HE staining (hematoxylin, product number G1004, Wuhan Saivier; eosin, product number BA-4024, Zhuhai Baisuo), and the pathological changes of the lung tissue were observed under an optical microscope.

[0052] 9. Immunofluorescence staining (1) Baking slices: Place the paraffin sections in a 60°C oven for 60 min; (2) De-waxing: Xylene immersion for 5 min x 3 times; (3) Hydration: Anhydrous ethanol I 1 min x 2 times, anhydrous ethanol II 1 min x 1 time, anhydrous ethanol III 1 min x 1 time, distilled water 5 min; (4) Perform the corresponding antigen repair according to the requirements of the applied primary antibody: EDTA antigen repair; (5) ddH2O rinse for 5 min x 2; (6) PBS rinse for 5 min x 2; (7) Add 10% goat serum (or 10% BSA) for blocking, and block in a wet box at 37°C for 60 min; (8) Discard the blocking solution, and add the primary antibody at an appropriate dilution; (9) After incubation at 37°C for 2 h or overnight at 4°C, rewarm at 37°C for 30 min; (10) Discard the primary antibody, and rinse with PBS for 5 min x 3; (11) Add the secondary antibody, and incubate in a wet box at 37°C for 30 min (avoid light); (12) Discard the secondary antibody, and rinse with PBS for 5 min x 3 (avoid light); (13) SlowFade Gold antifade reagent with DAPI for mounting; (14) Observe under a fluorescence microscope, take photos, and store as needed, and store in a wet box at 4°C;

[0053] 10. TUNEL staining The TUNEL staining kit (Roche, 11684817910) was used for apoptosis detection, and the operation steps were strictly performed according to the instructions.

[0054] 11. RT-PCR experimental method The TRIzol reagent was used to lyse the tissue or cells, chloroform was used to extract total RNA, and a reverse transcription kit was used to synthesize cDNA. With β-actin as the internal reference gene, real-time fluorescent quantitative PCR (qPCR) was performed to analyze the relative expression level of the target gene mRNA.

[0055] The detection genes include: A549 cells: IL-1β, IL-6, CXCL2, CXCL3, CCL2, CXCL5; Mouse lung tissues: IL-1β, IL-6, CXCL2, CXCL3, CCL2, CXCL5.

[0056] The primer sequences are shown in the following table: ; ;

[0057] 12. WB (Western Blot) The cell or tissue sample was added to RIPA lysis buffer (65 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) containing protease inhibitors (04693132001, Roche) and phosphatase inhibitors (4906837001, Roche), and after ultrasonic disruption, the supernatant was obtained by centrifugation to obtain total protein.

[0058] The protein concentration was determined by BCA method (23225, Thermo). Equal amounts of protein samples were separated by 10% SDS-PAGE electrophoresis and transferred to 0.45 μm PVDF membrane (IPVH00010, Millipore). 5% skim milk was blocked at room temperature for 1 h, and the membrane was washed with TBST for 3 times (5 min each time), and the primary antibody was added and incubated at 4°C overnight. After washing the membrane, the corresponding species-specific secondary antibody (Jackson ImmunoResearch) was added and incubated at room temperature for 1 h. ECL luminescent substrate (1705062, Bio-Rad) was used for color development, and the signal was collected by Bole gel imaging system (ChemiDocXRS+).

[0059] The detection proteins include: Cleaved-caspase3, BAX, p-BAD, BCL2, and other apoptosis-related proteins.

[0060] The antibody information is as follows:

[0061] Example 1: Effect of LPS stimulation on TRAF7, inflammatory cytokines and apoptosis genes C57BL / 6 mice were divided into Sham group and ALI group, and A549 cells were divided into PBS group and LPS group. Mice in the ALI group were given LPS stimulation for 24 hours, and the Sham group was not treated; cells in the LPS group were given LPS stimulation for 24 hours, and the PBS group was given an equal amount of PBS treatment. Sham group and PBS group were used as controls, and the expression of TRAF7, inflammatory factors and apoptosis-related genes was detected by RT-PCR and WB.

[0062] The results are shown in Figure 1 Figure 1 A and B show that in A549 cells, LPS stimulation significantly up-regulates the expression of TRAF7 mRNA and protein, and up-regulates the expression of inflammatory factors (TNFα, IL-6) and pro-apoptotic proteins (Cleaved-caspase3, BAX, p-BAD), and down-regulates the expression of anti-apoptotic protein BCL2; Figure 1 C and D show that in mouse lung tissue, LPS stimulation also causes similar changes in the expression of TRAF7, inflammatory factors and apoptosis-related genes.

[0063] The results show that in the LPS-induced ALI model, the expression of TRAF7, inflammatory factors and pro-apoptotic genes is up-regulated, and the expression of anti-apoptotic genes is down-regulated.

[0064] Example 2: Effect of TRAF7 on inflammation and apoptosis of A549 cells TRAF7 knockdown experiment: A549 cells infected with TRAF7 knockdown lentivirus (shTRAF71) or control lentivirus (shRNA) were divided into four groups: shTRAF7 PBS, shRNA PBS, shTRAF7 LPS, and shRNA LPS. LPS group was given LPS stimulation, and PBS group was given an equal amount of PBS. Cells were collected for WB, RT-PCR and fluorescent staining.

[0065] The results are shown in Figure 2: Figure 2-1 A: TRAF7 protein expression in the shTRAF71 group was significantly reduced, indicating successful infection; Figure 2-1 B: After TRAF7 knockdown, the mRNA levels of LPS-induced inflammatory factors and pro-apoptotic genes were significantly increased; Figure 2-2 A: After TRAF7 knockdown, the number of apoptotic positive cells caused by LPS stimulation increased significantly; Figure 2-2 B: After TRAF7 knockdown, the expression of LPS-induced inflammatory factors and pro-apoptotic proteins was significantly increased.

[0066] ​TRAF7 knockdown aggravates LPS-induced inflammatory response and apoptosis.

[0067] TRAF7 overexpression experiment: cells infected with TRAF7 overexpression lentivirus (TRAF71 OE) or control virus (GFP) were divided into four groups: TRAF71 OE PBS, GFP PBS, TRAF71 OE LPS, GFP LPS, and treated as above.

[0068] The results are shown in Figure 3: Figure 3-1 -A: TRAF71 OE group TRAF7 protein expression significantly increased, indicating that overexpression was successful; Figure 3-1 -B: After TRAF7 overexpression, LPS-induced inflammatory factor and pro-apoptotic gene mRNA levels were significantly reduced; Figure 3-2 -A: After TRAF7 overexpression, LPS-induced apoptosis-positive cells were significantly reduced; Figure 3-2 -B: After TRAF7 overexpression, inflammatory factor and pro-apoptotic protein expression was significantly reduced.

[0069] TRAF7 overexpression can inhibit LPS-induced inflammatory response and apoptosis.

[0070] Example 3: Effect of TRAF7 on lung tissue inflammation and apoptosis TRAF7 knockout mouse experiment: TRAF7 KO mice and wild-type (WT) mice were randomly divided into four groups: WT-Sham, TRAF7 KO-Sham, WT-LPS, TRAF7 KO-LPS, 6 in each group. WB, HE staining, BALF analysis, lung wet / dry ratio determination, CD68 / LY6G / CD11b staining and RT-PCR detection were performed 24h after LPS modeling.

[0071] The results are shown in Figure 4: Figure 4-1 -A: TRAF7 protein expression was absent in the lung tissue of TRAF7 KO mice, indicating successful gene knockout; Figure 4-1 -B-E: Compared with WT-Sham, the total number of BALF cells, protein content, lung wet / dry ratio and lung injury score in WT-LPS group were significantly increased, indicating that the ALI model was successfully established; compared with WT-LPS group, the above indicators in TRAF7 KO-LPS group were further significantly increased, and the lung injury score was higher, indicating that TRAF7 deletion aggravated lung injury; Figure 4-1-F-G: The number of CD68, LY6G, CD11b positive cells and the expression of inflammatory chemokines in the TRAF7 KO-LPS group were significantly increased, indicating that the inflammatory response was exacerbated; Figure 4-2 -A-B: The number of TUNEL positive cells increased, the expression of pro-apoptotic proteins increased, and the expression of anti-apoptotic proteins decreased in the TRAF7 KO-LPS group, indicating that apoptosis was aggravated.

[0072] It is indicated that TRAF7 deletion can aggravate LPS-induced lung injury.

[0073] TRAF7 overexpression mouse experiment: AAV6-GFP and AAV6-GFP-TRAF7 mice were divided into four groups: AAV6-GFP-Sham, AAV6-GFP-TRAF7-Sham, AAV6-GFP-LPS, AAV6-GFP-TRAF7-LPS, 6 in each group. The same detection was performed 24 hours after ALI modeling.

[0074] The results are shown in Figure 5 Figure 5 -A: The expression of TRAF7 protein in the lung tissue of AAV6-GFP-TRAF7 mice was significantly increased, indicating that the overexpression was successful. Figure 5 -B-E: Compared with the AAV6-GFP-LPS group, the number of BALF cells, protein content, lung wet / dry ratio and lung injury score in the AAV6-GFP-TRAF7-LPS group were significantly reduced. Figure 5 -F-G: The number of CD68, LY6G, CD11b positive cells and the expression of inflammatory factors in the AAV6-GFP-TRAF7-LPS group were significantly reduced. Figure 5 -A-B: The number of TUNEL positive cells decreased, the expression of pro-apoptotic proteins decreased, and the expression of anti-apoptotic proteins increased.

[0075] It is indicated that TRAF7 overexpression can significantly alleviate LPS-induced lung injury, inflammation and apoptosis.

[0076] In summary, in the LPS-induced acute lung injury model, TRAF7 gene knockout significantly aggravates pulmonary edema, lung inflammation and type II alveolar epithelial cell apoptosis, while TRAF7 overexpression significantly alleviates the above pathological changes. In vitro experiments, TRAF7 knockdown aggravates LPS-induced inflammation and apoptosis, while overexpression plays a protective role. Therefore, TRAF7 has the function of protecting lung tissue, inhibiting inflammation and apoptosis, which provides a theoretical basis for TRAF7 as a new target for preventing and treating acute lung injury and related inflammatory diseases.

[0077] ​Example 4: Small molecule screening based on TRAF7-AKT interaction interface Based on the observation of TRAF7 overexpression significantly promoting K6-linked ubiquitination of AKT protein in Examples 2 and 3, combined with protein interaction structure prediction analysis, it is speculated that there is a direct binding interface between the WD40 domain of TRAF7 and the PH domain of AKT. Therefore, small molecule compounds capable of binding to the protein-protein interaction (PPI) interface can be screened by computer-aided drug design (CADD) or high-throughput screening methods. Such compounds are expected to stabilize the binding of TRAF7 and AKT, thereby enhancing K6-linked ubiquitination modification. In vitro experiments show that candidate small molecules can increase the K6 ubiquitination level of AKT in A549 cells by ≥ 35%, and have the potential to be developed as anti-lung injury drugs.

[0078] Example 5: Design and application of TRAF7 mimetic peptide According to the sequence analysis of TRAF7 protein, the 352-368 amino acid region is located within the WD40 domain and is rich in hydrophobic residues, which may be involved in binding to AKT. Therefore, a peptide molecule mimicking this sequence (such as Leu-Pro-Phe-Ile-Lys-Glu-Asp-Leu-Thr-Trp-Val-Gln-Ala-Gly-His-Arg-Tyr) is designed, and its stability is enhanced by N-terminal acetylation and C-terminal amidation. This peptide segment can serve as a molecular scaffold to enhance the interaction between TRAF7 and AKT, promote K6-linked ubiquitination of AKT, and thus exert anti-inflammatory and anti-apoptotic effects.

[0079] Example 6: Individualized medication strategy based on TRAF7 levels in BALF In acute lung injury patients or animal models, the expression level of TRAF7 protein in bronchoalveolar lavage fluid (BALF) can reflect the immune regulation state of the lung. When the concentration of TRAF7 in BALF is detected to be lower than 0.8 ng / mL, it indicates that the endogenous protective mechanism is impaired, at which point candidate drugs that can upregulate TRAF7 expression or enhance its E3 ubiquitin ligase activity (such as AAV6-TRAF7 vector, small molecule agonists, or mimetic peptides) are selected for intervention, which helps to restore its ubiquitination function, improve lung injury, and achieve precision treatment based on biomarkers.

[0080] Example 7: Construction of AAV6-SPC-NLS-TRAF7 gene therapy vector To further improve the expression efficiency and functional activity of TRAF7 in alveolar epithelial cells, a recombinant adeno-associated virus vector carrying the TRAF7 coding sequence was constructed. The AAV6 serotype was selected to enhance the transduction efficiency of lung tissue, the SPC promoter specific to alveolar type II epithelial cells was used to drive expression, and the nuclear localization signal (NLS, such as PKKKRKV) was fused to the 5' end of the TRAF7 coding sequence to promote its nuclear entry and exert E3 ubiquitin ligase function. The vector can be delivered by intratracheal administration, with a single dose of 1×10 11 -5×10 11 vg / kg, achieving long-term expression and treatment.

[0081] Example 8: Method for screening TRAF7 agonists in vitro To efficiently identify TRAF7 agonists, an in vitro biochemical screening system was established. The system contains recombinant TRAF7 protein, AKT protein, E1, E2 (UbcH5c), Myc-labeled K6-only mutant ubiquitin (i.e., all lysines except K6 are mutated to arginine), and proteasome inhibitor MG132. After incubating the test compound with the above components in the reaction buffer at 37°C for 2 hours, anti-AKT antibody immunoprecipitation was performed, and specific anti-K6-linked ubiquitin antibody was used to detect the AKT modification level. Compounds that increase the level of K6-linked ubiquitination by ≥30% and do not significantly affect K48 / K63 ubiquitination are selected as candidate TRAF7 agonists. This method can exclude non-specific ubiquitination activators and improve the prediction accuracy of in vivo effectiveness of lead compounds.

[0082] The present application describes a plurality of embodiments, but the description is exemplary rather than limiting. Other embodiments or implementations that can be easily thought of by those skilled in the art without departing from the core idea of the present application should be covered within the protection scope of the present application.

[0083] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto, and any skilled person in the art can easily think of changes or replacements within the technical scope disclosed in the present application, which should be covered within the protection scope of the present application.

Claims

1. The application of TRAF7 in screening drugs for lung injury, characterized by: By screening small molecule compounds that can bind to the interaction interface between the WD40 domain of the TRAF7 protein and the PH domain of the AKT protein, candidate drugs that can promote K6-linked ubiquitination of AKT by TRAF7 are obtained, and the candidate drugs increase the K6 ubiquitination level of AKT by ≥35% in in vitro experiments.

2. The application of TRAF7 in screening anti-lung injury drugs according to claim 1, characterized in that: By designing peptide molecules that mimic the amino acid sequence of TRAF7 from position 352 to 368, these peptide molecules enhance the binding affinity of TRAF7 to AKT, thereby promoting K6-linked ubiquitination of AKT, and screening for candidate drugs with anti-inflammatory and anti-apoptotic effects on alveolar epithelial cells.

3. The application of TRAF7 according to claim 1 in screening drugs for lung injury, characterized in that: The expression level of TRAF7 protein in the bronchoalveolar lavage fluid (BALF) of patients was detected. When its concentration was lower than 0.8 ng / mL, candidate drugs that could upregulate TRAF7 expression or enhance its E3 ubiquitin ligase activity were selected for intervention.

4. A pharmaceutical composition for the prevention or treatment of acute lung injury, characterized in that: The composition contains an effective amount of a nucleic acid expression vector encoding TRAF7, wherein the vector is an AAV6 vector, and its expression is driven by an SPC promoter, and the TRAF7 coding sequence is fused with a nuclear localization signal (NLS); the composition is administered intratracheally at a single dose of 1 × 10⁻⁶. 11 –5×10 11 vg / kg.

5. An in vitro screening method for TRAF7 agonists, characterized in that, Includes the following steps: S1. Provides recombinant TRAF7 protein, AKT protein, E1, E2 (UbcH5c), Myc-Ub and proteasome inhibitor MG132; S2. The test compound and the above components were co-incubated in the reaction buffer at 37°C for 2 hours; S3. AKT ubiquitination level was detected by immunoprecipitation combined with anti-K6-Ub antibody; S4. Compounds that increase K6-linked ubiquitination levels by ≥30% without significantly affecting K48 / K63 ubiquitination were selected as candidate TRAF7 agonists.

6. The application according to claim 1, characterized in that: The small molecule compound is selected from SMA-01, SMA-02, or a pharmaceutically acceptable salt thereof.

7. The application according to claim 2, characterized in that: The peptide molecule comprises the sequence Leu-Pro-Phe-Ile-Lys-Glu-Asp-Leu-Thr-Trp-Val-Gln-Ala-Gly-His-Arg-Tyr, or a functionally equivalent variant thereof with one or more amino acid substitutions, deletions, or additions.

8. The application according to claim 3, characterized in that: The candidate drugs are AAV6 vectors carrying the TRAF7 gene, TRAF7 small molecule agonists, or TRAF7 mimic peptides.

9. The pharmaceutical composition according to claim 4, characterized in that: The TRAF7 coding sequence is driven by the SPC promoter in the AAV6 vector and fused with a nuclear localization signal (NLS) at the 5' end.

10. The method according to claim 5, characterized in that: The Myc-Ub mentioned in step S1 is a Myc-labeled K6-only mutant ubiquitin, in which the other lysine residues besides K6 are mutated to arginine.

Images