Apoptosis related protein in the tgf-beta signaling pathway (ARTS) mimetic compounds, compositions, methods and uses thereof in induction of apoptosis
Patent Information
- Application Number
- EP2023759470
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-02-25
- Filing Date
- 2023-02-24
- Publication Date
- 2026-02-18
AI Technical Summary
Current cancer therapies lack effective compounds that can inhibit both XIAP and Bcl-2, key anti-apoptotic proteins, to induce apoptosis in malignant cells, as existing inhibitors do not target these proteins effectively.
Development of ARTS mimetic compounds that mimic the binding of ARTS to the XIAP BIR3 domain, specifically targeting the ARTS-binding site within XIAP and Bcl-2, leading to ubiquitin proteasome system-mediated degradation of these proteins and induction of apoptosis.
The ARTS mimetic compounds effectively induce apoptosis in malignant cells by degrading XIAP and Bcl-2, enhancing the apoptotic process and increasing sensitivity to other therapeutic agents, thereby providing a novel approach for cancer treatment.
Smart Images

Figure 1.1
Abstract
Description
[0001] APOPTOSIS RELATED PROTEIN IN THE TGF-BETA SIGNALING PATHWAY (ARTS) MIMETIC COMPOUNDS, COMPOSITIONS, METHODS AND USES THEREOF IN INDUCTION OF APOPTOSIS
[0002] FIELD OF THE INVENTION
[0003] The invention relates to the field of cancer therapy. More particularly, the invention relates to novel ARTS mimetic compounds that induce apoptosis, specifically, in malignant cells. The invention further provides compositions comprising the ARTS mimetic compounds, methods and uses thereof in treating proliferative disorders.
[0004] PRIOR ART
[0005] References considered to be relevant as background to the presently disclosed subject matter are listed below:
[0006] Fuchs, Y., and H. Steller. Cell. 147:1-17 (2011).
[0007] Gottfried, Y., A. et al., EMBO J. 23:1627-35 (2004).
[0008] Larisch, S., et al., Nat Cell Biol. 2:915-21 (2000).
[0009] Edison, N., D. et al. Cell Death Differ. 19:356-68 (2012b).
[0010] Bornstein, B., Y. et al.. Apoptosis 16:869-881 (2011).
[0011] Reingewertz, T.H., et al., PLoS One. 6:e24655 (2011).
[0012] Adams, J.M., and S. Cory. Trends Biochem Sci. 26:61-6 (2001).
[0013] Youle, R.J., and A. Strasser. Nat Rev Mol Cell Biol. 9:47-59 (2008).
[0014] Happo, L., A. et al., J Cell Sci. 125: 1081-7 (2012).
[0015] Edison, N., T.H. et al.,. Clin Cancer Res (2012a).
[0016] Bornstein, B.N., et al., Int J Biochem Cell Biol. 44:489-95 (2012).
[0017] Barkan D. et al., Cancer Research 68 (15): 6241-50 (2008).
[0018] Debnath et al., Methods 30 (3): 256-68 (2003)
[0019] Muthuswamy et al., Nature Cell Biology. 3(9): p. 785. (2001)
[0020] Edison, N. et al., Cell Reports 21, 442-454 (2017)
[0021] Acknowledgement of the above references herein is not to be inferred as meaning that these are in any way relevant to the patentability of the presently disclosed subject matter. BACKGROUND OF THE INVENTION
[0022] Apoptosis is a process of programmed cell death that plays a major role in tissue development, tissue homeostasis, and as a defense mechanism against unwanted and potentially dangerous cells.
[0023] Apoptosis is controlled by a diverse range of cell signals which can originate either from extrinsic inducers thus activating the extrinsic, apoptotic signaling pathway or from intrinsic inducers, which activate the intrinsic, mitochondrial signaling pathway.
[0024] The control of apoptosis is achieved through the activity of pro- and anti-apoptotic proteins. For example, caspases, are a family of cysteine proteases that play a central executioners of apoptosis and the action of activators and inhibitors of caspases affect apoptosis. Inhibition of the caspases activity was reported to occur through the action of the inhibitor of apoptosis (IAP) proteins. Apoptosis has been reported to have a critical role in a variety of diseases. It has been shown that deregulation of the apoptosis pathway can result in various pathologic conditions, including cancer (Fuchs and Steller, 2011). Involvement of an abnormal ratio of pro- and anti-apoptotic proteins has been also associated with neurodegenerative diseases such as schizophrenia as well as in immune- related disorders.
[0025] To potentiate apoptosis, the function of IAPS needs to be overcome. This is achieved by lAP-antagonists such as Smac / Diablo, Omi / HtrA2 and ARTS (Gottfried et al., 2004; Larisch et al., 2000).
[0026] ARTS is localized at mitochondrial outer membrane (MOM) (Edison et al., 2012b). Upon induction of apoptosis, ARTS translocates from the mitochondria to the cytosol, directly binds and antagonizes XIAP, causing activation of caspases and cell death (Bornstein et al., 2011 ; Edison et al., 2012b; Reingewertz et al., 2011). XIAP, the best studied IAP, can directly bind and inhibit caspases 3, 7 and 9 via its three Baculoviral IAP Repeats (BIR) domains.
[0027] The inventors have further shown that upon induction of apoptosis, ARTS binds directly to both XIAP and Bcl-2, acting as a scaffold to bring these proteins together. This binding leads to a UPS mediated degradation of Bcl-2. Moreover, the inventors have found that ARTS comprise a BH3-like domain. These data indicate that ARTS functions as a Bcl-2 antagonist and as such, allows degradation of Bcl-2 and inhibits the anti- apoptotic activity of Bcl-2 (WO 2013 / 121428, Edison, N. et al., Cell Reports 21, 442- 454 (2017)).
[0028] The intrinsic pathway of apoptosis is regulated by Bcl-2 family members (Adams and Cory, 2001). This family is composed of pro- and anti-apoptotic proteins that share up to four conserved Bcl-2 homology (BH) domains (Youle and Strasser, 2008). The pro- apoptotic members can be separated into the "multidomain" proteins and to "BH3 only" proteins. Bax and Bak "multidomain" proteins which share three BH regions and structurally similar to the antiapoptotic proteins. The "BH3-only" proteins, which include Bnip3, Nix / Bnip3L, Bid, Noxa, Puma, and Bad, share only the BH3 domain and are structurally diverse (Happo et al., 2012) .
[0029] The inventors have further shown that upon induction of apoptosis, ARTS binds directly to both XIAP and Bcl-2, acting as a scaffold to bring these proteins together. This binding leads to a UPS mediated degradation of Bcl-2. Moreover, the inventors have found that ARTS comprise a BH3-like domain. These data indicate that ARTS functions as a novel Bcl-2 antagonist and as such, inhibits the anti-apoptotic activity of Bcl-2 (WO 2013 / 121428).
[0030] There is need for novel compounds that target and inhibit both classes of pro-apoptotic proteins, the XIAP and Bcl-2. As ARTS functions in a distinct way, different from all known lAP-antagonists (Gottfried et al, 2004, Edison et al, 2012a, Bornstein et al, 2011, Bornstein et al, 2012) and as a novel Bcl-2 antagonist, it offers a unique approach for anti-cancer therapies targeting the two major anti-apoptotic proteins. These compounds would be better and more effective inducers of apoptosis in malignant pathologies.
[0031] SUMMARY OF THE INVENTION
[0032] In a first aspect, the present disclosure provides an apoptosis related protein in the TGF- beta signaling pathway (ARTS) mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for inducing apoptosis in a cell, wherein formula (I) is: wherein
[0033] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’- L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R1’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L11, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5. Another aspect of the present disclosure relates to an ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof, wherein formula (I) is: wherein
[0034] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4 -L2”-R4 ”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5. A further aspect of the preset disclosure relates toa method for inducing apoptosis in a cell, wherein said method comprises the step of contacting said cell with an effective amount of at least one ARTS mimetic compound, any combination thereof or any composition comprising the same, wherein said ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same. In some embodiments, Formula (I) is: wherein
[0035] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1 ’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m- SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5. A further aspect of the present disclosure relates to a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof. The disclosed method comprises administering to said subject a therapeutically effective amount of at least one ARTS mimetic compound or of a composition comprising the same, said ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same; wherein said Formula (I) is: wherein
[0036] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m- SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5. Another aspect of the preset disclosure relates to an ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, wherein formula (I) is: wherein R1, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-Li”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0037] A further aspect of the present disclosure relates to a combined composition comprising an effective amount of at least one ARTS mimetic compound and at least one and at least one B-cell lymphoma 2 (Bcl-2) Homology 3 (BH3) mimetic compound, wherein said ARTS mimetic compound is having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, and wherein formula (I) is: wherein
[0038] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’- L1’ -R3”’ and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4 -L2”-R4 ”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 each one of L1 ’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogenand m is an integer selected from 0, 1, 2, 3, 4, 5.
[0039] A further aspect of the present disclosure relates to a kit comprising: at least one ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, wherein formula (I) is: wherein
[0040] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 each one of L1 ’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogenand m is an integer selected from 0, 1, 2, 3, 4, 5; and (b) at least one BH3 mimetic compound.
[0041] A further aspect of the present disclosure relates to a method for inducing apoptosis in a cell comprising the step of contacting said cell with an effective amount of at least one ARTS mimetic compound as defined by the present disclosure, and of at least one BH3 mimetic compound, with a combined composition as defined by the present disclosure, or with any kit as defined by the present disclosure.
[0042] In some embodiments of the disclosed methods, the BH3 mimetic compound is 4-[4-[[2- (4-Chlorophenyl)-4,4-dimethyl- l -cyclohexen-1 -yl]methyl]- l -piperazinyl]- / V-[[3-nitro-4- [[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
[0043] A further aspect of the present disclosure relates to a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof, the method comprises administering to said subject a therapeutically effective amount of at least one ARTS mimetic compound as defined by the present disclosure, and of at least one BH3 mimetic compound, or of any composition or kit comprising the BH3 mimetic compound and said ARTS mimetic compound.
[0044] These and other aspect of the invention will become apparent by the hand of the following drawings.
[0045] BRIEF DESCRIPTION OF THE DRAWINGS
[0046] In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:
[0047] Figure 1. Docking site of ARTS mimetic compounds within BIR3 / XIAP
[0048] Figure illustrates an "in silica” screen for ARTS mimetic small molecules that fit into the binding site of ARTS unique C-terminus and its distinct binding sequence in the BIR3 domain of XI AP.
[0049] Figure 2. Binding ofB3 to BIR3-XIAP
[0050] Figure illustrates the molecular structure of the B3 small molecule (in bold-nude) and its interaction with the ARTS binding site within the XIAP molecule. Favorable interactions of said candidate molecule with BI R3 -XIAP are shown in green, where negative interaction is shown in red. Figure 3. The ARTS mimetic B3 small molecule
[0051] Figure shows the B3 chemical structure indicating residues Thr271, Thr274, Tyr277 and Gly293 of the BIR3 / XIAP that interact with the B3 molecule.
[0052] Figure 4. XIAP and Bcl-2 levels in A375 human melanoma cells treated with different ARTS mimetic small molecules
[0053] A375 cells were treated with 20uM of each of the indicated molecules for 24hrs. SDS PAGE and Western blot analysis were performed with the indicated Abs.
[0054] Figure 5. The ARTS mimetic small molecule B3 induces apoptosis of MCF10AT1K (M2) cells
[0055] MCF10A (Ml) and M2 cells were cultured using the 3D BME system. M2 organoids at day 4 were either untreated or treated for additional 7 days with increasing concentrations of the B3 small molecule. B3 molecule was re-supplemented every 4 days. The figure shows representative light images, magnification x20.
[0056] Figure 6. The ARTS mimetic small molecule B3 enhances apoptosis in premalignant cells
[0057] The extent of apoptosis is shown by representative bright field images (upper panel magnification x10) and digital zooming of confocal images (lower panel, magnification x4). M2 cells were cultured in the 3D BME system for 4 days followed by treatment with B3 for 24h. The cells were stained for apoptosis using TUNEL assay. TUNEL positive cells are in red and nuclei (stained with Dapi) are in blue. Bar= 20pm.
[0058] Figure 7. IC50 of ARTS mimetic B3 small molecule on different cancer cell lines vs. normal control
[0059] Viability assay results examining the effect of B3 on 94 different cancer cell lines. A-375 cells are considered relatively resistant to Bx as they displayed a high GI50 score of 14.78uM. Figure 8(I)-8(II). IC50 of ARTS mimetic B3 small molecule on different cancer cell lines vs. normal control
[0060] IC50 of ARTS mimetic B3 small molecule (was calculated for several cancer cell lines indicated therein. PBMC were used as normal cell control. Fig.8-1 shows cell lines resistant to B3 and Fig. 8-1 shows sensitive cell lines
[0061] Figure 9A-9C. ABT-199 upregulates the endogenous ARTS levels in Melanoma
[0062] Fig. 9A. Western Blot analysis of A-375 Melanoma cell line treated for 24hrs with different concentrations of ABT- 199 with and without the small molecule B3. Combined treatment of ABT- 199 and B3 increased cleavage of apoptotic markers PARP and Caspase3. Actin is used as a reference for overall protein level in the sample.
[0063] Fig 9B. Histogram presenting the cleaved PARP / Actin ratio.
[0064] Fig 9C. Histogram presenting the cleaved Caspase3 / Actin ratio.
[0065] Figure 10A-10B. ABT-199 upregulates Bcl-2 levels in Melanoma
[0066] Fig. 10A. Western Blot analysis of A-375 Melanoma cell line treated for 24hrs with different concentrations of ABT- 199 with and without the small molecule B3, showing Bcl-2 levels in the cells. Actin is used as a reference. Treatment of ABT199 alone upregulated Bcl-2 expression while combined treatment ABT199+B3 significantly decrease Bcl-2 levels.
[0067] Fig. 10B. Histogram presenting the Bcl-2 / Actin ratio.
[0068] Figure 11A-11B. Combined treatment of B3 with ABT-199 increases sensitivity of resistant CCRF-CEM to ABT-199
[0069] Fig. 11 A. Western Blot analysis of CCRF-CEM (acute lymphoblastic leukemia) cell line treated for 24hrs with ABT- 199 with and without the small molecule B3 and another small molecule A4, showing cCaspase3 levels in the cells. Actin is used as a reference for overall protein level in the sample.
[0070] Fig. 11B. Histogram presenting the cleaved Caspase3 / Actin ratio.
[0071] Figure 12A-12F. Endogenous ARTS restricts the killing effect of ABT-199 Fig. 12A. Western Blot analysis of A375 melanoma cell line. Cells expressing low endogenous ARTS protein, were treated for 24hrs with ABT- 199 with and without the small molecules B3 and A4, showing cP ARP and cCaspase3 levels. Actin is used as a reference for overall protein level in the sample. A374 cells with low levels of endogenous ARTS show a significant apoptotic response to simultaneous treatment of ABT199+B3.
[0072] Fig. 12B. Western Blot analysis of WT HeLa and shARTS HeLa (that were KD for ARTS). Cells with different amounts of endogenous ARTS protein treated for 24hrs with ABT-199 with and without the small molecules B3 and A4, showing cP ARP and cCaspase3 levels. Actin is used as a reference for overall protein level in the sample. Actin is used as a reference for overall protein level in the sample. HeLa cells with Knockdown of ARTS show high apoptotic response to combined treatment of ABT199+B3 than WT HeLa cells.
[0073] Fig. 12C. Western Blot analysis of WT Mefs and Sept4 / ARTS KO MEFs. Cells with different amounts of endogenous ARTS protein treated for 24hrs with ABT- 199 with and without the small molecules B3 and A4, showed different cP ARP and cCaspase3 levels. Actin is used as a reference for overall protein level in the sample. Sept4 / ARTS KO MEFs cells showed high apoptotic response to combined treatment of ABT199+B3 than WT Mefs cells.
[0074] Fig. 12D. Histogram presenting the cleaved PARP / Actin ratio in A-375 cells.
[0075] Fig. 12E. Histogram presenting the cleaved PARP / Actin ratio in WT HeLa and shARTS HeLa cells.
[0076] Fig. 12F. Histogram presenting the cleaved PARP / Actin ratio, in Sept4 / ARTS KO MEFs and WT MEFs cells.
[0077] Figure 13A-13D. Combined treatment of B3 with ABT-199 decreases expression of Bcl2 after 6 hrs in A-375 cell line
[0078] Fig. 13A. Western Blot analysis of A-375 Melanoma cell line treated for 2,6 and 24hrs with ABT- 199 with and without the small molecule B3, showing cP ARP, BCL-2 and XIAP levels in the cells. BCL-2 levels were upregulated upon 2h and 6h of treatment with ABT- 199 alone. While BCL-2 levels downregulated after 6hrs treatment with B3. The combined treatment of ABT- 199 with B3 decreased XIAP levels..
[0079] Fig. 13B. shows one-way ANOVA data presentation of the cPARP / Actin ratio.
[0080] Fig. 13C. shows one-way ANOVA data presentation of the XIAP / Actin ratio.
[0081] Fig. 13D. shows one-way ANOVA data presentation of the BCL-2 / Actin ratio.
[0082] Figure 14. Combined treatment of B3 with ABT-199 increase cell death
[0083] Fig. 14. Histogram presenting cell death as defined by XTT viability assay in A-375 (melanoma), MALME (melanoma) and DU145 (prostate cancer) cell lines treated with increasing concentrations of ABT-199 with and without 20 μM small molecule B3 for 24hrs.
[0084] Figure 15. Dose dependent effect of B3 on cell death of MG-63 osteosarcoma cell line
[0085] Dose response of cell death with B3 treatment relative to DMSO treatment.
[0086] Figure 16A(I-II)-16C. 20uM B3 combined with ABT-199 showed the maximal apoptotic effect in A-375 cells
[0087] Fig. 16A(I). Western Blot analysis of A-375 cells treated with different concentrations of ABT-199 and B3. Rising concentrations of ABT-199 increased cCaspase 3 expression, while the combination of IpM ABT 199 with 20pM B3 showed synergistic effect on Apoptosis in A-375 cells .
[0088] Fig. 16A(D). Histogram presenting cCasp3 / Actin ratio.
[0089] Fig. 16B. Cell death measured using XTT assay in A-375 and MALME cell lines. Different concentrations of ABT 199 treatment together with 20uM B3 showed the strongest apoptotic effect.
[0090] Fig. 16C. Cell Titer-Gio® Viability Assay with of rising concentrations of treatment of A-375 cells, the strongest apoptotic effect was recorded with 5 and 10uM ABT- 199 with 20uM B3. Figure 17A-17B. Combined treatment of B3 with ABT-199 enhances the apoptotic effect of ABT-199
[0091] Fig. 17A. Western Blot analysis of A-375 cells treated with ABT-199 and B3. Combined treatment of ABT- 199+ 20uM B3 increased cCaspase3 levels relative to treatment with ABT- 199 alone.
[0092] Fig 17B. Shows one-way ANOVA data presentation of cCasp3. Statistical One way ANOVA statistical analysis of two-three biological independent experiments with Dunnetfs multiple comparisons test, p<0.05 (*), p<0.01 (**), p<0.001 (***).
[0093] Figure 18A(I-II)-18D. Both B3 and ABT-199 promote the binding of XIAP to Bcl-2
[0094] Fig. 18A(I) Nano-DSF method (Crelux) binding assay of B3 binding to XIAP in a dose response manner.
[0095] Fig. 18A(II). MST binding assay of B3 binding to Bcl-2. in a dose response manner.
[0096] Fig. 18B. Immunoprecipitation (IP) assay of HCT 116 XIAP KO cells transfected with GFP-XIAP and Flag-Bcl-2, and treated with 20uM B3. B3 treatment promotes the binding of Bcl-2 to GFP-XIAP.
[0097] Fig.l8C(I). Histogram presenting the BiFC assay in A375 melanoma cells treated with ABT-199 and B3. Cells were transfected with Bel -2 -VC and XIAP-VN for 24 hours. Just 20pM B3 slightly increased binding of XIAP to Bcl-2 after 24 hours. Statistical Oneway ANOVA statistical analysis of three-four biological independent experiments, p<0.05 (*).
[0098] Fig. 18C(II). B3 increase binding between XIAP and Bcl2 in a dose dependent manner. A-375 Cells were transfected with Bcl-2 and XIAP fused to parts of Venus fluorescent protein (VN 1-173 and VC 1-155, respectively) for 24 hours and treated with 10pM and 20pM of ABT199 or B3. pdsRED plasmid was used as a transfection efficiency marker. The experiment was done in duplicates. FACS results were normalized to the readings of transfection efficiency reporter (pdsRED) relative to Untreated cells. Just 20pM B3 slightly increased binding of XIAP to Bcl-2 after 24 hours Shows one-way ANOVA data presentation of BiFC assay p<0.001 (***)
[0099] Fig.l8D. Administering ABT-199 and B3 results in a increase in cell death that is higher than what each of them achieves alone. Figure 19. B3 and ABT199 increase interaction between ARTS and Bell during early Apoptosis
[0100] Histogram presenting BiFC assay in A-375 cells treated with ABT- 199 and B3.
[0101] Hela wt cells were transfected with the following pairs of plasmids Bcl2 and ARTS fused to parts of Venus fluorescent protein (VN 1-173 and VC 1-155, respectively). 36h posttransfection cells were exposed to the following components 20pM ABT199, 20pM B3, B3+ABT199 20pM each or DMSO for 3 and 24 hours. pdsRED plasmid was used as a transfection efficiency marker. The experiment was done in duplicates. FACS results were normalized to the readings of transfection efficiency reporter (pdsRED) relative to Untreated cells. B3 and ABT199 increase interaction between ARTS and Bcl2 at early stages of apoptosis and had no effect on the interaction at later stages of apoptosis (N=2).
[0102] Figure 20. Proposed model of ABT- 199 and B3 mechanism of action through the regulation of Bcl-2
[0103] Treatment with ABT-199 and with B3 induces upregulation of ARTS which promotes the formation of protein complex between Bcl-2- ARTS and XIAP. This results in high levels of Bcl-2. Treatment with B3 or the combined treatment leads to elevated levels of endogenous ARTS and prominent auto-ubiquitylation and degradation of XIAP and Bcl- 2. In the combined treatments of ABT- 199 and B3, the binding of B3 to XIAP leads to the activation of the E3 -ligase function of XIAP. This results in enhanced degradation of Bcl-2 and substantial increase in the apoptotic effect.
[0104] Figure 21A-21B. B3 induces cell death Jurkat cells as efficient as the strong pro- apoptotic chemotherapeutic agent Etoposide
[0105] Fig 21A. PrestoBlue viability assay of different small molecules in A-375 and lurkat cell lines. Cells were incubated with molecules and apoptotic agents for 24h. Blue line indicates the threshold of Etoposide treated cells alone.
[0106] Fig 21B. The effect of 20pM B3 and 12.5pM Etoposide on cell death of lurkat cell lines. Average of three independent experiments. Figure 22. The effect of small-molecule B3 in A375 and HCT wt cells
[0107] A375 (melanoma) cell line was treated with 20uM of each of the indicated molecules for 24hrs. SDS PAGE and Western blot analysis were performed with the indicated Abs. Both cell lines showed increase in cleavage of early apoptotic marker Caspase 9 and decrease in XIAP levels upon treatment with B3 small molecule. A-375 cell line also showed decrease in Bcl2 level and significant increase in cCaspase3.
[0108] Figure 23A-23F. The effect of small-molecule B3 in resistant and sensitive to ABT199 Leukemia cell lines
[0109] CCRF CEM - resistant to ABT- 199 (Fig. 23B, 23E, 23F) and HL-60 sensitive to ABT199 leukemia (Fig. 23A, 23C, 23D) cell lines were treated with 10pM or IpM ABT199 respectively with or without 20uM of each of the indicated molecules for 24hrs. SDS PAGE and Western blot analysis were performed with the indicated Abs. Apoptotic marker proteins cleaved PARP (Fig. 23D, 23F) and cleaved Caspase 3 (Fig. 23C, 23E) Apoptotic marker proteins cleaved PARP and cleaved Caspase 3 are upregulated upon treatment with 10pM ABT- 199 in CCRF-CEM and IpM ABT 199 in HL-60 cell line. B3 promoted apoptosis alone. A combination treatment of ABT- 199 with B3 increased significantly expression of cP ARP and cCasp3 in ABT199 resistant CCRF-CEM cell line. While in ABT 199 sensitive HL-60 cell line no synergistic effect was observed. Experiment repeated twice.
[0110] Figure 24A-24B(I)-B(IV). Combined treatment of 20pM B3 with 10pm ABT-199 significantly increase Apoptosis in A-375 cell line
[0111] A-375 cells were treated with various concentrations of ABT 199 and B3 for 24h. Western blot analysis was conducted with the indicated antibodies (Fig. 24A). Cells treated with 10pM or 20pM ABT199 together with 20pM B3 showed a synergistic effect on apoptosis. Significant increase in cCaspase 3 and cP ARP levels, and decrease in Bcl2 and XIAP levels in comparison to untreated cells or cells treated with each compound separately (Fig. 24B(I) cCaspase; 24B(II)cPARP; 24B(HI) Bcl-2; and 24B(IV) XIAP) (N=3). Figure 25A-25H. B3 apoptotic effect on different cell lines
[0112] Fig 25 A-25E. Three melanoma cell lines: SKMEL-5, A-375, UACC257, Hela wt (cervical cancer), Mefs (mouse embryonic fibroblasts) were treated with 20pM from each molecule, 20pM ABT199 or both for 24h. Cells were lysed and Western blot analysis was conducted with the indicated antibodies. B3 molecules induced cleavage of apoptotic markers Caspase3 and PARP. All Cells when exposed to combined treatment of ABT- 199 with B3 showed synergistic effect on Apoptosis.
[0113] Fig. 25F. One-way ANOVA data presentation of the cPARP / Actin ratio in wt HeLa cells. Fig. 25G. One-way ANOVA data presentation of the XIAP / Actin ratio in wt MEF cells. Fig. 25H. One-way ANOVA data presentation of the BCL-2 / Actin ratio in A-375cells.
[0114] DETAILED DESCRIPTION OF THE INVENTION
[0115] The apoptotic pathway is an ordered process of programmed cell death that is often altered in various pathologic conditions associated with either increased or decreased apoptosis.
[0116] Modulating apoptosis by external means provides an important and promising approach that paves the way for a variety of therapeutically opportunities. For example, cancer is a condition associated with deregulated apoptosis, resulting in cells displaying increased survival. Thus, inducing apoptosis is valuable as a defense mechanism against hyper proliferating cells. It was shown that Bcl-2 proteins that are anti-apoptotic proteins govern the pro-survival pathway and are over expressed in a variety of tumor types such small cell lung cancer, melanoma, prostate and breast cancer.
[0117] Cancer treatment is among others aimed in restoring the apoptotic capabilities of cancer cells. Further, inhibitors of Bcl-2 and XIAP anti-apoptotic proteins are needed in order to revert to normal apoptotic processes and thus trigger tumor cell death.
[0118] As indicated above, the inventors have previously found that upon induction of apoptosis, ARTS binds directly to both XIAP and Bcl-2, acting as a scaffold to bring these proteins together, leading to a UPS mediated degradation of Bcl-2.
[0119] The inventors have now developed novel ARTS mimetic compounds that target the ARTS-binding site within the XIAP BIR3 domain. These compounds act as ARTS mimetic compound mimicking ARTS unique C-terminal domain and binding thereof to distinct binding sequences in XIAP BIR3 domain. Functional assays revealed that the ARTS mimetic compounds of the invention induce apoptosis.
[0120] The inventors found that compounds having at least one amine group and at least one carbonyl group act as ARTS mimetics compounds. Specifically, the inventors found that 1,2 and 1,5 di-carbonyl compounds act as ARTS mimetics. In a first aspect, the present disclosure provides an apoptosis related protein in the TGF- beta signaling pathway (ARTS) mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for inducing apoptosis in a cell, wherein formula (I) is: wherein
[0121] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1’ - R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1’ -R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0122] In some embodiments, of the disclosed compound or composition, the L1 ’, L1 ”, L2’ and L2” are independently from each other selected from -(CH2)n-, C(=O), optionally -(CH2)n- substituted with -(CH2)m-OH and wherein n is an integer selected from 1, 2, or 3 and m is an integer selected from 1, 2 or 3.
[0123] In yet some further embodiments of the compound or composition for use of the present disclosure, each one of R3’, R3”, R4’, R4” is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
[0124] Still further in some embodiments of the compound or composition for use in accordance with the present disclosure, having the general formula (II) wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0125] In some further embodiments of the disclosed compound or composition for use according to the present disclosure, wherein L2’ is (CH2)n-, or C(=O), optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m- SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0126] In yet some further embodiments of the disclosed compound or composition for use, the compounds having the general formula (lib):
[0127] In certain embodiments of the compound or composition for use in accordance with the present disclosure, wherein R1 is Ll’-R3’L1 ’R3”.
[0128] In some further embodiments of the compound or composition for use of of the present disclosure, wherein R1 is at least one of
[0129] (i) L1’, L1 ’ ’and R3” are each absent and R3’ is an optionally substituted
[0130] (ii) L1’L,1’ and R3” are each absent and R3’ is:
[0131] (iii) L1’ is absent R3’ is an optionally substituted phenyl, R3” is an optionally substituted:
[0132] In some further embodiments of the compound or composition for use of the present disclosure, the compound is having the general formula (Illa) or (nib):
[0133] wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0134] In yet some further embodiments of the compound or composition for use of the present disclosure, the compound having the general formula (IIIc), (IIId) or (Ille):
[0135] wherein L1” and R3” are each as defined above, wherein R is one or more of H, OH,
[0136] CF3, halogen, C(=O), -COOH, -NIL, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0137] In some embodiments, the compound or composition for use according to the present disclosure, wherein the compound is having the general formula (IIIc), or (Ille): wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1” is C(=O), wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0138] In some further embodiments of the compound or composition for use of the present disclosure, the compound is having the formula (3.1), (3.2), (3.3);
[0139] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;
[0140]
[0141] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);
[0142] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
[0143] In some further embodiments of the compound or composition for use in accordance with the present disclosure, wherein the ARTS mimetic compound leads to ubiquitin proteasome system (UPS) mediated degradation of at least one of B-cell lymphoma 2 (Bcl-2) and X-linked-Inhibitor of Apoptosis (XIAP) in a cell.
[0144] Still further, in some further embodiments of the compound or composition for use of the present disclosure, wherein said ARTS mimetic compound leads to elevation in at least one of c-caspase and c-PARP levels in a cell. In some further embodiments of the compound or composition for use of the present disclosure, wherein the ARTS mimetic compound induces apoptosis in a premalignant and / or a malignant cell.
[0145] In some further embodiments of the compound or composition for use in accordance with the present disclosure, the cell is at least one of an epithelial carcinoma cell, a melanoma cell, a sarcoma cell, and hematological cancer cell.
[0146] Still further, in some further embodiments of the compound or composition for use of the present disclosure, wherein the cell is of a subject suffering from at least one proliferative disorder.
[0147] In some further embodiments of the compound or composition for use according to the present disclosure, the method is for inducing apoptosis in at least one cell in a subject suffering from at least one pathologic disorder, and wherein the method comprising administering to said subject a therapeutically effective amount of said compound.
[0148] In yet some further embodiments of the compound or composition for use of the present disclosure, is for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathologic disorder in a subject in need thereof.
[0149] Another aspect of the present disclosure relates to an ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof, wherein formula (I) is: wherein
[0150] R1, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1’ -R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1’ -R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0151] In some embodiments of the compound or composition for use of the present disclosure, the compound is having the general formula (II) wherein RI and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0152] In some embodiments of the compound or composition for use of the present disclosure, the compound is having the general formula (IIIc), or (IIIe):
[0153] wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1” is C(=O), wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0154] In yet some further embodiments of the compound or composition for use in accordance with the present disclosure, the compound is having the formula (3.1), (3.2), (3.3);
[0155]
[0156] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;
[0157] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”); (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide.
[0158] In some embodiments of the compound or composition for use of the present disclosure, wherein the pathologic disorder is characterized by at least one of:
[0159] (a) over expression of Bcl-2;
[0160] (b) over expression of XIAP; and
[0161] (c) low or no expression of ARTS.
[0162] Still further, in some embodiments of the compound or composition for use of the present disclosure, the subject is a subject suffering from at least one proliferative disorder, optionally, said proliferative disorder is at least one of carcinoma, melanoma, sarcoma and / or at least one hematological disorder.
[0163] A further aspect of the preset disclosure relates toa method for inducing apoptosis in a cell, wherein said method comprises the step of contacting said cell with an effective amount of at least one ARTS mimetic compound, any combination thereof or any composition comprising the same, wherein said ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same. In some embodiments, Formula (I) is: wherein
[0164] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m- OH, -(CH2)m- SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0165] In some embodiments of the disclosed methods, the ARTS mimetic compound is having the general formula (II) wherein RI and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0166] In some embodiments of the methods of the present disclosure, the ARTS mimetic compound is having the general formula (IIIc), or (Ille):
[0167] wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1 ” is C(=O), wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0168] In some embodiments of the methods of the present disclosure, the ARTS mimetic compound is having the formula (3.1), (3.2), (3.3);
[0169]
[0170] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;
[0171] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);
[0172]
[0173] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
[0174] In some embodiments of the methods of the present disclosure, the ARTS mimetic compound leads to at least one of UPS mediated degradation of at least one of Bcl-2 and XIAP and elevation in at least one of c-caspase and c-PARP levels.
[0175] In some embodiments, the methods of the present disclosure are for inducing apoptosis in at least one of pre-malignant and malignant cell / s.
[0176] In some embodiments of the methods of the present disclosure, the cell is at least one of an epithelial carcinoma cell, a sarcoma cell, a melanoma cell and hematological malignant cell.
[0177] In some embodiments of the methods of the present disclosure, the cell is characterized by at least one of: (a) over expression of Bcl-2; (b) over expression of XIAP; and (c) low or no expression of ARTS.
[0178] In some embodiments, the methods of the present disclosure are for inducing apoptosis of at least one cell in a subject in need thereof, wherein contacting said cell with an effective amount of at least one ARTS mimetic compound comprises administering to said subject an effective amount of said compound or of any composition thereof.
[0179] A further aspect of the present disclosure relates to a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof. The disclosed method comprises administering to said subject a therapeutically effective amount of at least one ARTS mimetic compound or of a composition comprising the same, said ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same; wherein said Formula (I) is: wherein
[0180] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4 -L2”-R4 ”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m- SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0181] In some embodiments of the methods of the present disclosure, the L1 ’, L1 ”, L2’ and L2” are independently from each other selected from -(CH2)n-, C(=O) optionally -(CH2)n- substituted with -(CH2)m-OH and wherein n is an integer selected from 1, 2, or 3 and m is an integer selected from 1, 2 or 3.
[0182] In some embodiments of the methods of the present disclosure, each one of R3’, R3”, R4’, R4’ ’ is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
[0183] In some embodiments of the methods of the present disclosure, the compound used is having the general formula (II) wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0184] In some embodiments of the methods of the present disclosure, the L2’ is (CH2)n-, or C(=O), optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0185] In some embodiments of the methods of the present disclosure, the compound used is having the general formula (lib): In some embodiments of the methods of the present disclosure, the R1 is L1’-R3’-L1”-
[0186] R3”
[0187] In some embodiments of the methods of the present disclosure, the R1 is at least one of (iii) L1’, L1 ’ ’and R3” are each absent and R3’ is an optionally substituted
[0188] (iv) Ll’, Ll ”and R3” are each absent and R3’ is:
[0189] (iii) L1’ is absent R3’ is an optionally substituted phenyl, R3” is an optionally substituted:
[0190] In some embodiments of the methods of the present disclosure, the compound is having the general formula (Illa) or (Illb):
[0191] wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0192] In some embodiments of the methods of the present disclosure, the compound is having the general formula (IIIc), (IHd) or (IHe): or (Ille). wherein L1 ” and R3” are each as defined above, wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0193] In some embodiments of the methods of the present disclosure, the compound is having the general formula (IIIc), or (Ille): wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1” is C(=O), wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0194] In some embodiments of the methods of the present disclosure, the compound is having the formula (3.1), (3.2), (3.3);
[0195] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;
[0196] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);
[0197]
[0198] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
[0199] In some embodiments of the methods of the present disclosure, the subject is suffering from a pathologic disorder characterized by at least one of: (a) over expression of Bcl-2; (b) over expression of XIAP; and (c) low or no expression of ARTS.
[0200] In some embodiments of the methods of the present disclosure, the subject is a subject suffering from at least one proliferative disorder.
[0201] In some embodiments of the methods of the present disclosure, the subject is a subject suffering from at least one of carcinoma, melanoma, sarcoma and / or at least one hematological disorder.
[0202] Another aspect of the preset disclosure relates to an ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, wherein formula (I) is: wherein
[0203] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1’ -R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1’ -R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0204] In some embodiments of the disclosed compound or composition, the L1 ’, L1 ”, L2’ and L2” are independently from each other selected from -(CH2)n-, C(=O) optionally-(CH2)n- substituted with -(CH2)m-OH and wherein n is an integer selected from 1, 2, or 3 and m is an integer selected from 1, 2 or 3.
[0205] In some embodiments of the disclosed compound or composition, each one of R3’ Rs ”, R4’, R4” is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
[0206] In some embodiments of the disclosed compound or composition, the compound is having the general formula (II) wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
[0207] The compound or composition claim 53, L2’ is (CH2)n-, or C(=O), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m- SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0208] In some embodiments of the disclosed compound or composition, the compound is having the general formula (nb):
[0209] In some embodiments of the disclosed compound or composition, the R1 is Ll’-R3’-Ll”- R3”
[0210] In some embodiments of the disclosed compound or composition, wherein R1 is at least one of
[0211] (v) L1’, L1 ’ ’and R3” are each absent and R3’ is an optionally substituted (vi) Lr, Ll ”and R3” are each absent and R3’ is:
[0212] (iii) L1’ is absent R3’ is an optionally substituted phenyl, R3” is an optionally substituted:
[0213] In some embodiments of the disclosed compound or composition, the compound is having the general formula (Illa) or (Illb): wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5. In some embodiments of the disclosed compound or composition, the compound is having the general formula (IIIc), (IIId) or (Ille): wherein L1” and R3” are each as defined above, wherein R is one or more of H, OH,
[0214] CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5. In some embodiments of the disclosed compound or composition, the compound is having the general formula (IIIc), or (Ille): or an optionally substituted heteroaryl, and L1 ” is C(=O), wherein R is one or more substituents as defined above, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other.
[0215] In some embodiments of the disclosed compound or composition, the compound having the formula (3.1), (3.2), (3.3);
[0216]
[0217] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;
[0218] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);
[0219]
[0220] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
[0221] In some embodiments of the disclosed compound or composition, the ARTS mimetic compound leads to at least one of UPS mediated degradation of at least one of Bcl-2, XIAP, and / or elevation in at least one of c-caspase 3 and c-PARP levels in a cell.
[0222] It should be appreciated that in some embodiments, the present disclosure provides and encompasses any of the compounds disclosed herein.
[0223] In some specific and non-limiting embodiments compound is any of the disclosed compounds with the proviso that the compound is not the compound of formula (3.1), specifically;
[0224] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide; In some specific and non-limiting embodiments compound is any of the disclosed compounds with the proviso that the compound is not the compound of formula (3.2), specifically;
[0225] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”).
[0226] In some specific and non-limiting embodiments compound is any of the disclosed compounds with the proviso that the compound is not the compound of formula (3.3), specifically:
[0227] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
[0228] A further aspect of the present disclosure relates to a combined composition comprising an effective amount of at least one ARTS mimetic compound and at least one and at least one B-cell lymphoma 2 (Bcl-2) Homology 3 (BH3) mimetic compound, wherein said ARTS mimetic compound is having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, and wherein formula (I) is: wherein
[0229] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 each one of L1 ’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogenand m is an integer selected from 0, 1, 2, 3, 4, 5. In some embodiments of the combined composition of the present disclosure, the wherein said at least one ARTS mimetic compound is any of the compounds defined and disclosed by the present disclosure.
[0230] In some embodiments of the combined composition of the present disclosure, the BH3 mimetic compound is 4-[4-[[2-(4-Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l- yl] methyl] - 1 -piperazinyl] -N- [ [3 -nitro-4-[ [(tetrahydro-2H-pyran-4- yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3-b ]pyridin-5-yloxy)benzamide (ABT- 199), and any derivatives thereof.
[0231] A further aspect of the present disclosure relates to a kit comprising: at least one ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, wherein formula (I) is: wherein
[0232] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1’ -R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1’ -R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-,-S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 each one of L1 ’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogenand m is an integer selected from 0, 1, 2, 3, 4, 5; and (b) at least one BH3 mimetic compound.
[0233] In some embodiments of the kits of the preset disclosure, the ARTS mimetic compound is as defined and disclosed by the present disclosure.
[0234] Still further, in some embodiments of the kits of the present disclosure, the ARTS mimetic compound ishaving the formula (3.1), (3.2), (3.3);
[0235] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide; (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);
[0236] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide.
[0237] In yet some further embodiments of the disclosed kits, the BH3 mimetic compound is 4-
[0238] [4- [ [2-(4-Chlorophenyl)-4,4-dimethyl- 1 -cyclohexen- 1 -y 1] methyl] - 1 -piperazinyl] - / V-[ [3 - nitro-4-[[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
[0239] A further aspect of the present disclosure relates to a method for inducing apoptosis in a cell comprising the step of contacting said cell with an effective amount of at least one ARTS mimetic compound as defined by the present disclosure, and of at least one BH3 mimetic compound, with a combined composition as defined by the present disclosure, or with any kit as defined by the present disclosure.
[0240] In some embodiments of the disclosed methods, the BH3 mimetic compound is 4-[4-[[2- (4-Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l-yl]methyl]-l-piperazinyl]-A-[[3-nitro-4- [[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
[0241] A further aspect of the present disclosure relates to a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof, the method comprises administering to said subject a therapeutically effective amount of at least one ARTS mimetic compound as defined by the present disclosure, and of at least one BH3 mimetic compound, or of any composition or kit comprising the BH3 mimetic compound and said ARTS mimetic compound.
[0242] In some embodiments of the disclosed methods, the BH3 mimetic compound is 4-[4-[[2- (4-Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l-yl]methyl]-l-piperazinyl]-A-[[3-nitro-4- [[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
[0243] In accordance with one aspect, the present disclosure provides 1,2-di-carbonyl compounds. In accordance with this aspect, the present disclosure provides a compound comprising at least one oxalamide moiety. The present disclosure also encompasses pharmaceutically acceptable salt, solvate, hydrate or any stereoisomer of the compounds described herein.
[0244] In accordance with this aspect, the present disclosure provides a compound having the general formula (I): or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof; wherein
[0245] Ri, R2 are each, independently from each other, absent or H, alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’- L1’ -R3” and R2 isL2’-R4 -L2”-R4 wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-, -S-, -S-S-, or -S-(CH2)n-, each optionally substituted; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 each may be independently from each other, optionally substituted by one or more of C1-C5alkoxy, C1- C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m-halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0246] In the following text, when referring to a compound (such as ARTS mimetic compound) it is to be understood as also referring to the composition, uses (compound for use, composition for use), methods, combined therapies and kits disclosed herein. Thus, whenever providing a feature with reference to the compound, it is to be understood as defining the same feature with respect to the composition, uses (compound for use, composition for use), methods, combined therapies and kits, mutatis mutandis.
[0247] In some embodiments, each one of L1’, L1”, L2’ and L2” is each independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m-halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0248] In some examples, Ri, R2 are each, independently from each other, a ring system containing five to twelve atoms.
[0249] In some embodiments, a ring system containing five to twelve atoms may be substituted with one or more substituents, in certain embodiments one, two, three or four substituents as further described herein. In some examples, Ri, R2 are each, independently from each other, a monocyclic or polycyclic ring system containing five to twelve atoms, optionally substituted with one or more substitutes.
[0250] In some embodiments, each one of R3’, R3”, R4’ and R4” may be independently from each other a ring system containing five to twelve atoms, each optionally substituted.
[0251] In some examples, each one of R3’, R3”, R4’, R4” is independently from each other, a monocyclic or polycyclic ring system containing five to twelve atoms, optionally substituted with one or more substitutes.
[0252] In some other embodiments, the ring system of each one of R3’, R3”, R4’, R4”’ may be independently from each other an aryl, heteroaryl or aliphatic ring (non-aromatic ring).
[0253] In some further embodiments, each one of R3’ R3’ . -R4, R4” may be independently from each other C5-C12 saturated cycloalkyl, C5-C12 saturated cycloalkylene, C5-C12 aryl, C5- C12 heteroaryl or C5-C12 arylene.
[0254] In some further embodiments, the ring system of each one of R3’, R3”, R4’, R4” may independently from each other contain at least two carbon atoms and may include at least one heteroatom ring.
[0255] In some further embodiments, each one of R3’, R3”, R4’, R4” may be independently from each other heteroaryl, heteroarylene, heterocycloalkylene or heterocycloalkyl.
[0256] In some further embodiments, each one of R3’ R3’ . -R4, R4” may be independently from each other C2-C12 heterocycloalkyl ring, C2-C12 heteroaryl or C2-C12 heteroarylene.
[0257] In some embodiments, the heteroatom in a heteroaryl ring may be N, O, S.
[0258] In yet some further embodiments, the heteroatom in a heteroaryl ring may be N, O. In some other embodiments, the heteroatom in a heteroaryl ring may be N.
[0259] In some embodiments, each one of R3’, R3”, R4’, -R4hs absent, H, an optionally substituted aryl or an optionally substituted heteroaryl.
[0260] In some embodiments, each one of R3’, R3”, R4’, R4’ is absent, an optionally substituted aryl or an optionally substituted heteroaryl.
[0261] In some further embodiments, each one of R3’, R3”, R4’, -R4hs absent or may be independently from each other H, an optionally substituted aromatic ring or an optionally substituted heteroaromatic ring.
[0262] In some further embodiments, each one of R3’, R3”, R4’, -R4hs absent or may be independently from each other an aromatic or heteroaromatic five to eleven membered ring.
[0263] In some other embodiments, each one of R3’, R3”, R4’, R4” is absent or may be independently from each other H, phenyl, 1 -naphthyl, 2-naphthyl, and 4-biphenyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, furyl (furanyl), quinolyl, isoquinolyl, thienyl, imidazolyl, thiazolyl, indolyl, pyrryl, oxazolyl, benzofuryl, benzothienyl, benzthiazolyl, isoxazolyl, pyrazolyl, triazo lyl, tetrazolyl, indazolyl, 1,2,4- thiadiazolyl, isothiazolyl, benzothienyl, purinyl, carbazolyl, benzimidazolyl, indolinyl, 1,2, 3, -oxadiazoyl, 1,2, 4, -oxadiazoyl, 1,2, 5, -oxadiazoyl, 1,3, 4, -oxadiazoyl, dioxolanyl, thienyl[l,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2 oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1 oxo thiomorpholinyl, and 1,1-dioxo thiomorpholinyl, l-methyl-1H-benzo[d]imidazole, benzo imidazole, pyridine, pyrrole, 1 -methyl- 1H- imidazole or IH-imidazole, each optionally substituted.
[0264] In some other embodiments, each one of R3’, R3”, R4’, R4” is absent or may be independently from each other H, phenyl, l-methyl-1H-benzo[d] imidazole, benzo imidazole, pyridine, pyrrole, 1 -methyl- IH-imidazole or IH-imidazole.
[0265] In some embodiments, each one of R3’ R3’ . -R4, R4” is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with one or more of OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1- C5 carboxyl, halogen.
[0266] In some embodiments, each one of R3’ R3’ . -R4, R4” is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
[0267] In some embodiments, each one L1 ’, L1 ”, L2’ and L2” may be substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen;
[0268] In some embodiments, each one of L1 ’, L1 ”, L2’ and L2” may be absent or independently from each other selected from -(CH2)n-, C(=O).
[0269] In some further embodiments, each one of L2’, L2” is absent or may be -(CH2)n-.
[0270] In some further embodiments, each one of L2’, L2” may be optionally substituted with -(CH2)m-OH.
[0271] In some embodiments, n may be 0 to 3, at times n may be 1 to 3, at times n may be 2 to 3 and m may be 1 to 3. In some other embodiments, each one of Ll’or LI” is absent or may be C(=O).
[0272] In some examples in which R1 is L1’-R3’-L1”-R3”,L1’ and L1’ are each absent, R3’ is an optionally substituted aromatic or heteroaromatic five to eleven membered ring and R3” is absent.
[0273] In some examples in which R1 is L1’-R3’-L1”-R3”.L1’ and Li”are each absent, R3’ is an optionally substituted aryl or optionally substituted heteroaryl and R3” is absent.
[0274] In some examples, in which R1 is L1’-R3’-L1”-R3”.L1’ and Li” are each absent, R3’ is an optionally substituted phenyl, benzoimidazole, l-methyl-1H-benzo[d]imidazole, pyridine, pyrrole, 1 -methyl- IH-imidazole or 1H-imidazole and R3” is absent.
[0275] In some embodiments, in which R1 is L1’-R3’-L1”-R3”,L1’ and Li” are each absent, R3’ is phenyl, benzoimidazole, l-methyl-1H-benzo[d] imidazole, pyridine, pyrrole, 1-methyl- IH-imidazole or 1H-imidazole optionally substituted with one or more of OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen and R3” is absent.
[0276] In some embodiments, in which R1 is L1’-R3’-L1”-R3”,L1’ and Li” are each absent, R3’ is phenyl, benzoimidazole, l-methyl-1H-benzo[d] imidazole, pyridine, pyrrole, 1-methyl- IH-imidazole or 1H-imidazole optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O) and R3” is absent.
[0277] In some embodiments, in which RI is Ll’-R3’ L1 ’R3”, L1 ’ and L1 ” are each absent, R3’ is phenyl, benzoimidazole, l-methyl-1H-benzo[d] imidazole, optionally substituted with OH, alkyl, halogen, CF3, NO2, or C(=O) and R3” is absent
[0278] In some embodiments, in which RI is Ll’-R3’L1 ’R3”, L1 ’ and Ll”are each absent, R3’ is l-methyl-1H-benzo[d]imidazole, optionally substituted with OH, alkyl, halogen, CF3, NO2, or C(=O) and R3” is absent In some embodiments, in which R1 is Ll’-R3’-Ll ’’-R3 ”, L1 ’ andL1’ are each absent, R3’ is l-methyl-1H-benzo[d]imidazole, optionally substituted with halogen, or CF3, and R3” is absent.
[0279] In some embodiments, in which R1 is Ll’-R3’L1 ’R3”, L1 ’ andL1’ are each absent, R3’ is l-methyl-1H-benzo[d] imidazole, optionally substituted with, CF3, and R3” is absent.
[0280] In some examples, in which R1 is Ll’-R3’-Ll ’’-R3 ”, L1’ is absent, R3’ and R3”are each independently from the other, an optionally substituted aromatic or heteroaromatic five to eleven membered ring and Li” is -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, - SO2-,-S-, -S-S-, or -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0281] In some examples in which Rl is Ll’-R3’L1 ’R3”, L1’ is absent, R3’ and R3”are each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl and L1” is -(CH2)n-, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-, -S-, - S-S-, or -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0282] In some examples in which Rl is Ll’-R3’-Ll ’’-R3 ”, L1’ is absent, R3’ and R3”are each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl and L1 ” is -(CH2)n-, or C(=O), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or - (CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5. In some examples in which R1 is Ll’-R3’L1 ’-R3”, L1’ is absent, R3’ and R3”are each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl and L1 ” is C(=O).
[0283] In some examples in which R1 is Ll’-R3’L1 ’R3”, L1’ is absent, R3’ and R3”are each independently from the other, an optionally substituted phenyl, benzoimidazole, 1- methyl-1H-benzo[d]imidazole, pyridine, pyrrole, 1 -methyl- IH-imidazole or 1H- imidazole and L1 ” is -(CH2)n-, or C(=O), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or - (CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0284] In some examples in which R1 is Ll’-R3’L1 ’R3”, L1’ is absent, R3’ and R3”are each independently from the other, an optionally substituted phenyl, benzoimidazole, 1- methyl-1H-benzo[d]imidazole, pyridine, pyrrole, 1 -methyl- IH-imidazole or 1H- imidazole and L1 ” is C(=O).
[0285] In some examples in which R1 is Ll’-R3’L1 ’R3”, L1’ is absent, R3’ and R3”are each independently from the other, an optionally substituted phenyl or 1 -methyl- IH-imidazole or IH-imidazole and L1 ” is -(CH2)n-,C(=O), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or - (CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0286] In some examples in which R1 is L1’-R3’-L1”-R3”,L1’ is absent, R3’ is phenyl, R3”is 1- methyl- IH-imidazole and L1 ”is C(=O).
[0287] In some embodiments, the compound of the present disclosure having general formula (I) have the general formula (la), (lb), (Ic), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II):
[0288] wherein L1”, R3” are as defined above and wherein R is one or more substituents, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other; t represents the number of substituents and may vary within the same compound being one or more identical substituents (for example one or more H) or different substituents.
[0289] In some examples, in compounds of Formula (I), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), L1” is -(CH2)n-, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-, -S-, -S-S-, or -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0290] In some examples, in compounds of Formula (I), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), L1” is -(CH2)n-, or C(=O), each optionally substituted by one or more ofC1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0291] In some examples, in compounds of Formula (I), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), L1 ” is C(=O).
[0292] In some examples, in compounds of Formula (I), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), R3” is an optionally substituted aryl or an optionally substituted heteroaryl.
[0293] In some examples, in compounds of Formula (I), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), R3” is an optionally substituted 1 -methyl- IH-imidazole.
[0294] In some examples, in compounds of Formula (I), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), R3” is 1 -methyl- IH-imidazole.
[0295] In some examples, in compounds of Formula (I), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), L1 ” is C(=O) and R3” is 1 -methyl- IH-imidazole.
[0296] In some examples, in compounds of Formula (I), (la), (lb), (Ic), (Id), (le), (If), (Ig), (Ih), (li), (Ij) (Ik) or (II), R2is L2’-R4’-L2”-R4”. In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is (CH2)n-, or C(=O), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m- OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5, R4’ is an optionally substituted aromatic or heteroaromatic five to eleven membered ring and L2” and R4” are each absent.
[0297] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is an optionally substituted -(CH2)n- or C(=O), n is an integer selected from 1, 2, 3, 4, 5, R4’ is an optionally substituted aromatic or heteroaromatic five to eleven membered ring and L2” and R4” are each absent.
[0298] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is an optionally substituted -(CH2)n- or C(=O), n is an integer selected from 1, 2, 3, 4, 5, R4’ is an optionally substituted aryl or an optionally substituted heteroaryl and L2” and R4” are each absent.
[0299] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is an optionally substituted -(CH2)n, n is an integer selected from 1, 2, 3, 4, 5, R4’ is an optionally substituted aryl or an optionally substituted heteroaryl and L2” and R4” are each absent.
[0300] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is an optionally substituted -(CH2)n, n is an integer selected from 1, 2, 3, 4, 5, R4’ is an optionally substituted phenyl and L2” and R4” are each absent.
[0301] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is an optionally substituted -(CH2)2, R4’ is an optionally substituted aryl or an optionally substituted heteroaryl and L2” and R4” are each absent.
[0302] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is an optionally substituted -(012)2, R4’ is an optionally substituted phenyl and L2’ ’ and R4’ ’ are each absent. In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is -(CH2)2 substituted with OH, R4’ is an optionally substituted aryl or an optionally substituted heteroaryl and L2’ ’ and R4’ ’ are each absent.
[0303] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’ is -(CH2)2 substituted with OH, R4’ is an optionally substituted phenyl and L2” and R4” are each absent.
[0304] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’, L2” and R4” are each absent, R4’ is an aryl optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
[0305] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’, L2” and R4” are each absent, R4’ is a phenyl optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
[0306] In some examples in which R2 is L2’-R4’-L2”-R4”, L2’, L2” and R4” are each absent, R4’ is a phenyl optionally substituted with OH.
[0307] In some embodiments with this aspect, a compound of the invention has the general formula (II) wherein R1 and L2’ is as defined above and wherein R is one or more substituents as defined above, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is as defined above.
[0308] In some embodiments, a compound of the invention has the general formula (II), L2’ is (CH2)n-, or C(=O), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0309] In some embodiments, a compound of the invention has the general formula (II), L2’ is (CH2)n-, optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0310] In some embodiments, a compound of the invention has the general formula (II), L2’ is (CH2)n-, substituted by OH, n is an integer selected from any one of 0, 1, 2, 3, 4, 5.
[0311] In some embodiments, a compound of the invention has the general formula (II), L2’ is (CH2)n-, substituted by OH, n is 2.
[0312] In some embodiments with this aspect, a compound of the invention has the general formula (Ila) or (lib): In some examples in the compounds of Formula (II) (Ila), or (lib), R1 is Ll’-R3’-Ll”- R3” as defined above.
[0313] In some examples, in the compounds of the disclosure having formula (I), (II), (Ila), or (lib), R1 is Ll’-R3’L1 ’R3”, L1’, Ll”and R3” are each absent and R3’ is an optionally substituted
[0314] In some examples, in the compounds of the disclosure having formula (I), (II), (Ila), or (lib), R1 is Ll’-R3’L1 ’R3”, L1’, Ll”and R3” are each absent and R3’ is an optionally substituted: the wavy line represents that the ring linked to formula (I), (II), (Ila), or (lib).
[0315] In some examples, in the compounds of the disclosure having formula (I), (II), (Ila), or (IIb), Rl is Ll’-R3’ L1’ - R3”, L1 ’, L1’ andR3” are each absent and R3’ is:
[0316] , optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O), the wavy line indicate bond to formula (I), (II), (Ila), or (IIb). In some examples, in the compounds of the disclosure having formula (I), (II), (Ila), or (lib), R1 is Ll’-R3’L1 ’R3”, L1 ’, L1’ and R3” are each absent and R3 ’ is: , the wavy line indicate bond to formula (I), (II), (Ila), or (lib).
[0317] In some examples, in the compounds of the disclosure having formula (I), (II), (Ila), or (lib), R1 is Ll’-R3’L1 ’R3”, L1’ is absent R3’ and R3” is each independently from the other optionally substituted aryl or an optionally substituted heteroaryl, and L1” is -(CH2)n-,C(=0), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5, at times 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0318] In some examples, in the compounds of the disclosure having formula (I), (II), (Ila), or (lib), R1 is Ll’-R3’L1 ’R3”, R3’ is an optionally substituted phenyl and R3” is an optionally substituted:
[0319] In some examples, in the compounds of the disclosure having formula (I), (II), (Ila), or (lib), R1 is Ll’-R3’L1 ’R3”, Ll ’is absent R3’ is an optionally substituted phenyl, R3” is an optionally substituted:
[0320] In some examples, the compound of the present disclosure having general formula (Illa) or (Illb) : wherein R is one or more substituents as defined above, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other;t represents the number of substituents and may vary within the same compound being one or more identical substituents (for example one or more H) or different substituents. In some examples, the compound of the present disclosure having the general formula (inc): wherein L1” and R3’ are each as defined above, R is one or more substituents as defined above, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other; t represents the number of substituents and may vary within the same compound being one or more identical substituents (for example one or more H) or different substituents.
[0321] In some examples, the compound of the present disclosure having the general formula (IIId):
[0322] wherein L1 ” and R3” are each as defined above, R is one or more substituents as defined above, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other; t represents the number of substituents and may vary within the same compound being one or more identical substituents (for example one or more H) or different substituents.
[0323] In some examples, the compound of the present disclosure having the general formula (IIIe) wherein L1” and R3” are each as defined above, wherein R is one or more substituents as defined above, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other; t represents the number of substituents and may vary within the same compound being one or more identical substituents (for example one or more H) or different substituents. In some embodiments, specific examples of compounds or pharmaceutically acceptable salts or hydrates of the compounds of Formula I, II, include, without limitation:
[0324] N 1 -(1 -hydroxy-3 -phenylpr opan-2-yl)-N2-( 1 -methyl-2-(trifluor omethyl)-1H- benzo[d]imidazol-5-yl)oxalamide
[0325] (R)-N 1 -( 1 -hy dr oxy-3 -phenylpropan-2-y 1) -N2-( 1 -methyl-2-(trifluoromethyl)- 1 H- benzo[d]imidazol-5-yl)oxalamide
[0326]
[0327] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(l-methyl-2-(trifluoromethyl)-1H- benzo[d]imidazol-5-yl)oxalamide
[0328] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(3-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(3-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide
[0329] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(3-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide
[0330] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
[0331]
[0332] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”).
[0333] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide
[0334] N 1 ,N2-bis(2-hydroxyphenyl)oxalamide In accordance with the second aspect, the present disclosure provides 1,5-di-carbonyl compounds. In accordance with this aspect, the compounds contain one or more nitrogen atoms. In some other embodiments, the compounds contain at least one ring structure. In some other embodiments, the ring structure containing at least one nitrogen atom. In some further embodiments, the compounds contain a heterocyclic ring structure containing five to twelve atoms, the ring structure containing at least two carbon atoms and at least one heteroatom being N, O or S.
[0335] The present disclosure provides in accordance with the second aspect, a compound having the general formula (VIII): or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof ; wherein
[0336] R9 and R10 may be the same or may be different and may be independently selected from each other from a ring system containing five to twelve atoms, each optionally substituted;
[0337] Rn may be independently selected from H, straight or branched C1-C12 alkyl, straight or branched C2-C12 alkenyl, straight or branched C2-Ci2alkynyl; L5 and L6, are each independently of each other, are absent or may be selected independently from -(CH2)P-; -NH-C(=O)-(CH2)P-, -C(=O)-NH-(CH2)P-; -S-S-(CH2)P-; - O-(CH2)P-; -NH-(CH2)P-; C(=O)-(CH2)P-; -S-(CH2)P-; -NH-S(=O)P-(CH2)P-; each p, being independently, may be 0 to 5;
[0338] In some embodiments, each one of R9 and R10 being a ring system containing five to twelve atoms may be substituted with one or more substituents, in certain embodiments one, two, three or four substituents, In some further embodiments, the substituents may be selected from OH, CF3, halogen, C(=O), -COOH, -NH2, CN, C(=O)- alkyl, alkyl, alkenyl, alkynyl, alkylene, alkenylene, alkynylene, C1-C12 alkoxy, C1-C5 carboxyl, halogen, aromatic or heteroaromatic ring.
[0339] In some embodiments, R9 and R10 may be a ring system containing five to twelve atoms. In some further embodiments, the ring system of R9 and R10 may contain at least two carbon atoms. In some other embodiments, the ring system of R9 and R10 may be an aromatic ring, non-aromatic ring, fused ring or the like. In some further embodiments, R9 and R10 may be C5-Ci2saturated cycloalkyl, C5-Ci2saturated cycloalkylene, C5-Ci2aryl or C5-C12 arylene. In some other embodiments, the ring system of Roand R10 may include at least one heteroatom ring. In some further embodiments, R9 and R10 may be heteroaryl or heterocycloalkyl. In some further embodiments, R9 and R10 may be C2-Ci2hetero cycloalkyl or C2-Ci2hetero aromatic ring (aryl or arylene). It should be noted that according with some embodiments, R9 and R10 may be independently from each other contain different carbon atoms. In some embodiments, the heteroatom may be N, O, S. In some embodiments, R9 and R10 may be independently from each other selected from C5-C 12aryl. In some embodiments, R9 and R10 may be C6 aryl, optionally substituted.
[0340] In some embodiments, L5 and L6, may be -(CH2)P-. According to these embodiments, the group -(CH2)P- wherein p=l to 5, may encompasses an alkyl, alkylene, alkenyl, alkenylene and alkynyl as defined herein having at most five carbon atoms. In some embodiments, each of p may be 0. At times, when p=0, L5 and L6 are each a bond. In some embodiments, specific examples of compounds or pharmaceutically acceptable salts or hydrates of the compounds of Formula VIII include, without limitation:
[0341] N3,N5-bis(3-acetylphenyl)-l-methyl-1H-pyrazole-3,5-dicarboxamide (5.1)
[0342] N4,N5-bis(3-acetylphenyl)-l-methyl-1H-pyrazole-4,5-dicarboxamide
[0343] In accordance with the third aspect, the present disclosure provides compounds containing one or more nitrogen atoms. In some other embodiments, the compounds contain at least one ring structure. In some other embodiments, the ring structure containing at least one nitrogen atom. In some further embodiments, the compounds contain a heterocyclic ring structure containing five to twelve atoms, the ring structure containing at least two carbon atoms and at least one heteroatom being N, O or S. in some other embodiments, the compounds contain an amide group.
[0344] In accordance with the third aspect, the present disclosure provides a compound having a general formula: or a pharmaceutically acceptable salt or hydrate thereof; wherein:
[0345] X, Y independently may be each independently selected from each other from NH, CH;
[0346] R14 and R15 may be the same or may be different and may be independently from each other selected from a ring system containing five to twelve atoms, each optionally substituted;
[0347] L8 may be selected independently from -(CH2)q-; -NH-C(=0)-(CH2)q-, -C(=O)-NH- (CH2)q-; -S-S-(CH2)q-; -O-(CH2)q-; -NH-(CH2)q-; C(=O)-(CH2)q-; -S-(CH2)q-; -NH- S(=O)q-(CH2)q-; each q, being independently, may be 0 to 5;
[0348] In some embodiments, R14 and R15 may be a ring system containing five to twelve atoms. In some further embodiments, the ring system of R14 and R15 may contain at least two carbon atoms. In some other embodiments, the ring system of R14 and R15 may be an aromatic ring or a non-aromatic ring. In some further embodiments, R14 and R15 may be C5-C12 saturated cycloalkyl, C5-C12 saturated cycloalkylene, C5-C12 aryl or C5-C12 arylene. In some other embodiments, the ring system of R14 and R15 may include at least one heteroatom ring. In some further embodiments, R14 and R15 may be C2-C12 hetero cycloalkyl or C2-C12 hetero aromatic ring. It should be noted that according with some embodiments, R14 and R15 may be independently from each other contain different carbon atoms. In some embodiments, the heteroatom may be N, O, S. In some embodiments, R14 and R15 may be independently from each other selected from C5-C12 aryl optionally substituted. In some embodiments, R14 and R15 may be independently from each other selected from isoquinoline or phyel each independently from the other optionally substituted.
[0349] In some embodiments, L8, may be -(CH2)q-. According to these embodiments, the group -(CH2)q- wherein q=0 to 5, may encompasses an alkyl, alkenyl and alkynyl as defined herein having at most five carbon atoms. In some embodiments, each of q may be 0. At times, when q=0, L8 may be a bond.
[0350] In some embodiments, a ring system containing five to twelve atoms may be substituted with one or more substituents, in certain embodiments one, two, three or four substituents. In some further embodiments, the substituents may be selected from OH, CF3, halogen, NO2, C(=O), -COOH, -NH2, CN, C(=O)-C1-Ci2 alkyl, straight or branched C1-C12 alkyl, straight or branched C2-C12 alkenyl, straight or branched C2-C12 alkynyl, straight or branched C1-C12 alkylene, straight or branched C2-C12 alkenylene, straight or branched C2-CI2 alkynylene, C1-C12 alkoxy, C1-C5 carboxyl, aromatic or heteroaromatic ring.
[0351] In some embodiments, specific examples of compounds or pharmaceutically acceptable salts or hydrates of the compounds of Formula IX include, without limitation:
[0352] 1 - [(3 ,5 -Dichloro-phenylcarbamoyl)-methyl] -piperidine-4-carboxylic acid (2-hy droxy- phenyl)-amide
[0353] 2-[4-(8-Nitro-isoquinolin-5-ylamino)-piperazin-l-yl]-N-phenyl-acetamide
[0354] For compounds of the disclosure in which a variable appears more than once, each variable can be a different moiety selected from the Markush group defining the variable. For example, where a structure is described having two R groups that are simultaneously present on the same compound; the two R groups can represent different moieties selected from the Markush group defined for R.
[0355] It is further appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment / example. Conversely, various features of the disclosure which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable subcombination. The term “alkyl” by itself or as part of another substituent, means, unless otherwise stated, as used herein refers to a linear (straight), branched saturated hydrocarbon and can have a number of carbon atoms optionally designated (z.e., C1-C6 means one to six carbons). The term “C1-C12 alkyl” or "C1-C12 alkylene" refers to a linear (straight), branched saturated hydrocarbon having from 1 to 12 carbon atoms, in some embodiments, contain from 2 to 8 carbons, in yet some embodiments from 2 to 5 carbons, in yet some further embodiments, from 1 to 3 carbon atoms. It should be noted that alkyl refers to an alkyl end chain and alkylene refers to a middle chain alkyl. Representative C1-C12 alkyl groups include, but are not limited to, methyl, ethyl, propyl, n-propyl, isopropyl, cyclopropyl, n-butyl, butyl, sec-butyl, iso-butyl, tert-butyl, cyclobutyl, n- pentyl, pentyl, iso-pentyl, neo-pentyl, tert-pentyl, cyclopentyl, hexyl, cyclohexyl, heptyl, cycloheptyl, octyl, sec-octyl (1 -methylheptyl), and cyclooctyl as well as homologs and isomers of, for example, n-pentyl, n-hexyl, and the like.
[0356] The term “haloalkyl” as used herein can include alkyl structures that are substituted with one or more halo groups or with combinations thereof, for example, “C1-C12 haloalkyl refers to a C1-C12 alkyl as defined above, with one or more hydrogens substituted by halogen atoms.
[0357] The term “alkenyl” as used herein refers to a linear (straight), branched unsaturated hydrocarbon having from 2 to 20 carbon atoms and at least one carbon-carbon double bond. The term “C2-C12 alkenyl” or "C2-C12 alkenylene" as used herein refers to a linear, branched unsaturated hydrocarbon having from 2 to 12 carbon atoms and at least one carbon-carbon double bond, in some embodiments from 3 to 8 carbons, in yet some further embodiments, from 3 to 5 carbon atoms and at least one double bond. It should be noted that alkenyl refers to an alkyl end chain and alkenylene refers to a middle chain alkyl. Examples of alkenyl groups, include, but are not limited to, groups such as ethenyl (z.e., vinyl), prop-l-enyl (z.e., allyl), but-l-enyl, pent-l-enyl, penta- 1,4-dienyl, and the like. The term “C2-C12 haloalkenyl as used herein refers to a C2-Ci2alkenyl as defined above, with one or more hydrogens substituted by halogen atoms.
[0358] The term “alkynyl as used herein refers to a linear (straight), branched unsaturated hydrocarbon having from 2 to 20 carbon atoms and at least one carbon-carbon triple bond. The term “C2-C / 2 alkynyl or "C2-C12 alkynylene" as used herein refers to a linear, branched unsaturated hydrocarbon having from 2 to 12 carbon atoms in certain embodiments, from 3 to 8 carbons, and at least one triple bond (at least one carboncarbon triple bond). It should be noted that alkynyl refers to an alkyl end chain and alkynylene refers to a middle chain alkyl. Examples of alkynyl groups, include, but are not limited to, groups such as ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like.
[0359] The term “C2-C72 haloalkynyl as used herein refers to a C2-C12 alkynyl as defined above, with one or more hydrogens substituted by halogen atoms.
[0360] As used herein "alkoxy " refers to an alkyl group bonded to an oxygen atom. Similarly, the term “C7-C72 alkoxyl as used herein refers to a C1-C12 alkyl group linked to an oxygen. At times, the alkyl group may include one to twelve carbon atoms, at times between one to eight carbon atoms, at times one to five carbon atoms and at times one to three carbon atoms. Examples of alkoxy groups, include, but are not limited to, groups such as methoxy, ethoxy, propyloxy, isopropyloxy, butyloxy, isobutyloxy, tert-butyloxy, pentyloxy, or hexyloxy, and the like.
[0361] The term “halo” or “halogen” (halide) independently or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. The term “halide” by itself or as part of another substituent, refers to a fluoride, chloride, bromide, or iodide atom. As used herein, a ring system containing five to twelve atoms refers to a mono- or multi- cyclic ring system having 5 to 12 atoms. The ring system containing five to twelve atoms may be saturated, unsaturated or aromatic rings and the like including for example cycloalkyl, heterocycloalkyl, aryl, arylene, aromatic, heteroaromatic rings. A ring system containing five to twelve atoms may contain two rings (bicyclic, etc.), for example aromatic rings and in such case the aromatic rings of the aryl group may be joined at a single point (e.g., biphenyl), or fused (e.g., naphthyl). In some embodiments, a ring system containing five to twelve atoms is a carbocyclic ring or heterocyclic ring. The term '''carbocyclic ring” refers to cyclic compounds containing only carbon atoms. The carbocyclic ring may be optionally substituted by one or more substituents, and may be saturated, unsaturated or aromatic. The term “heterocyclic ring” refers to cyclic compounds where one or more carbons are substituted by heteroatoms. Exemplary heteroatoms include, but not limited to, nitrogen, sulfur, and oxygen. The heterocyclic ring may be optionally substituted, and may be saturated, unsaturated or aromatic. The term “saturated” as used herein means that the compound does not contain double or triple bonds. The term “unsaturated” as used herein means that the compound contains at least one double or triple bond. The term “aromatic” as used herein means that the compound contains alternating double and single bonds.
[0362] As used herein, "aryl" refers to polyunsaturated, aromatic ring systems having between 5 to 12 atoms which can be a single ring or multiple rings (e.g., 1 to 2 rings) which are fused together or linked covalently. Unless otherwise specifically defined, the term “aryl” refers to cyclic, aromatic hydrocarbon groups that have 1 to 2 aromatic rings, including monocyclic or bicyclic groups having between 5 to 12 atoms. Non-limiting examples include phenyl, biphenyl or naphthyl. The aryl group may be optionally substituted by one or more substituents, e.g., 1 to 5 substituents, at any point of attachment. The substituents can themselves be optionally substituted. As used herein, "C5-C12 aromatic" refers to aromatic ring systems having 5 to 12 carbon atoms, such as phenyl, naphthalene and the like. As used herein, the term 'heteroaryl " refers to aryls as defined above where one or more carbons are substituted by heteroatoms. Exemplary heteroatoms include, but not limited to, nitrogen, sulfur, and oxygen. As used herein, "heteroaromatic" refers to refers to a monocyclic or multi-cyclic (fused) aromatic ring system, where one or more of the atoms in the ring system is a heteroatom, that is, an element other than carbon, including but not limited to, nitrogen, oxygen or sulfur. The term "heteroaromatic" used interchangeably with the term "heteroaryl" denotes a heterocyclic aromatic ring systems containing 5 to 12 atoms, with at least one, preferably two carbon atoms and one or more heteroatoms selected from nitrogen, oxygen and sulfur. Non-limiting examples include furan, thipohene, pyrrole, oxazole, thiazole, imidazole, pyrazole, isoxazole, thiazolem benzofurna, indole, benzothiophene, benzoimidazole, indazole, benzoxazole, benzoisoxazole, benzothiazole, isobenzfuran, isoidole, purine, pyridine, pyrazine, pyrimidine, pyrisazine, quinoline, quinozaline, quinazoline, isoquinoline, furyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, 1,2,3- triazolyl, 1,2,4-triazolyl, pyranyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,2,3- triazinyl, 1 ,2,4-triazinyl, 1,3,5-triazinyl, 1,2,3-oxadiazolyl, 1 ,2,4-oxadiazolyl, 1,2,5- oxadiazolyl, 1,3,4-oxadiazolyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, tetrazolyl, thiadiazinyl, indolyl, isoindolyl, benzofuryl, benzothienyl, indazolyl, benzimidazolyl, benzothiazolyl, benzoisothiazolyl, benzoxazolyl, benzisoxazolyl, purinyl, quinazolinyl, quinolizinyl, quinolinyl, isoquinolinyl, quinoxalinyl, naphthyridinyl, pteridinyl, carbazolyl, azepinyl, diazepinyl, acridinyl, 1- methyl-1H-benzo[d]imidazole, 1H-benzo[d]imidazole and the like.
[0363] As used herein, "C5-C12 saturated cycloalkyl" refers to a saturated mono- or multi- cyclic ring system having 5 to 12 carbon atoms, preferably having 5 to 7 carbon atoms. Example of "C5-C12 cycloalky I" groups include, but are not limited to cyclopentyl, cyclohexyl and cycloheptyl.
[0364] As used herein, "heterocycloalkyl" or "heterocyclyl" or the term "heterocyclic" refers to a monocyclic or multi-cyclic non-aromatic ring system having 5 to 12 members, preferably having 5 to 7 carbon atoms, where one or more, in certain embodiments, 1 to 3, of the atoms in the ring system is a heteroatom, that is, an element other than carbon, including but not limited to, nitrogen, oxygen or sulfur. Examples of "heteroalkyl" include, but are not limited to, pyran, 1,4-di oxane, 1,3 -di oxane, piperidine, pyrrolidine, morpholine, tetrahydrothiopyran, tetrahydrothiophene, and the like. The term heterocycloalkyl” also encompasses non-aromatic ring being unsaturated or having one or more degrees of unsaturation containing one or more heteroatomic substitutions selected from S, SO, SO2, O, or N. "heterocyclic” ring(s) or cycloalkyl ring(s). Examples of "heterocyclic" include, but are not limited to, tetrahydrofuran, pyran, 1,4-dioxane, 1,3-dioxane, piperidine, pyrrolidine, morpholine, tetrahydrothiopyran, tetrahydrothiophene, and the like.
[0365] The term ”N -containing group” is used herein a chemical group containing a nitrogen atom for example as amino group. The term "amino” as used herein encompass primary, secondary, tertiary or quaternary amines where the point of attachment is through the nitrogen atom which is substituted. For example, the ”N-containing group” include N, NH, NH2, tertiary amine (tertiary alkyl amine), quaternary ammonium (quaternary alkyl ammonium). The nitrogen atom may be substituted with alkyl. In case of a tertiary amine or quaternary amines, the substituent may be the same or may be different.
[0366] The term "bond” as used herein denotes a covalent bond. The bond may be between two similar atoms or between different atoms. Non-limiting examples include C-C, C-S, C-O, C-N. S-O, S-N, N-0 and the like. It should be noted that a bond as defined above, for example, C-S encompasses both C-S and S-C and this holds for the bonds as defined herein.
[0367] The term "optionally substituted” refers to substitution with the named substituent or substituents, multiple degrees of substitution being allowed unless otherwise stated. The term substituted as used herein means that the compounds may contain one or more substituents, including, but not limited to, optionally substituted OH, CF3, halogen, C(=O), -COOH, -NH2, CN, alkyl, alkenyl, alkynyl, alkylene, straight alkenylene, alkynylene, haloalkyl, haloalkenyl, haloalkynyl, alkoxy, carboxyl, halogen, ring system including five to twelve atoms, aromatic or heteroaromatic ring, C(=O)- alkyl, alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, hydroxy, halo, cyano, trifluoromethyl, trifluoromethoxy, nitro, trimethylsilanyl, -ORa, -SRa, -OC(O)-Ra, -N(Ra)2, -C(O)Ra, -C(O)ORa, -OC(O)N(Ra)2, -C(O)N(Ra)2,
[0368] -N(Ra)C(O)ORa, -N(Ra)C(O)Ra, - N(Ra)C(O)N(Ra)2, N(Ra)C(NRa)N(Ra)2, -N(Ra)S(O)wRa(where w is 1 or 2), -S(O)wORa
[0369] (where w is 1 or 2), -S(O)wN(Ra)2(where w is 1 or 2), or PO3(Ra)2, wherein each Rais independently hydrogen or alkyl.
[0370] It should be noted that the carbon number, as used herein, refers to the carbon backbone and carbon branching, but does not include carbon atoms of the substituents, such as alkoxy substitutions and the like.
[0371] The invention also embraces solvates, pharmaceutically acceptable prodrugs, pharmaceutically active metabolites, and pharmaceutically acceptable salts of compounds of the formula (I) or any variations detailed herein.
[0372] The present disclosure also includes any or all of the stereochemical forms, including any enantiomeric or diastereomeric forms, and any tautomers or other forms of the compounds described.
[0373] The term “solvate” refers to an aggregate of a molecule with one or more solvent molecules, such as hydrate, alcoholate (aggregate or adduct with alcohol), and the like.
[0374] As used herein the term "pharmaceutically acceptable salt" refers to salts derived from organic and inorganic acids of a compound described herein. Exemplary salts include, but are not limited to, sulfate, citrate, acetate, oxalate, chloride, hydrochloride, bromide, hydrobromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p- toluenesulfonate, camphorsulfonate, napthalenesulfonate, propionate, succinate, fumarate, maleate, malonate, mandelate, malate, phthalate, and pamoate. The term “pharmaceutically acceptable salt” as used herein also refers to a salt of a compound described herein having an acidic functional group, such as a carboxylic acid functional group, and a base. Exemplary bases include, but are not limited to, hydroxide of alkali metals including sodium, potassium, and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia, organic amines such as unsubstituted or hydroxyl-substituted mono-, di- or trialkylamines, dicyclohexylamine; tributyl amine; pyridine; N-methyl, N-ethylamine; diethylamine; tri ethylamine; mono-, bis-, or tris-(2-OH-(C1-C6)-alkylamine), such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D- glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids such as arginine, lysine, and the like. The term “pharmaceutically acceptable salt” also includes hydrates of a salt of a compound described herein.
[0375] The term “hydrate” refers to a compound formed by the addition of water. The hydrates may be obtained by any known method in the art by dissolving the compounds in water and recrystallizing them to incorporate water into the crystalline structure.
[0376] The compounds of the present invention, as defined above, may have the ability to crystallize in more than one form, a characteristic, which is known as polymorphism, and it is understood that such polymorphic forms ("polymorphs"} are within the scope of formulae (I). Polymorphism generally can occur as a response to changes in temperature or pressure or both and can also result from variations in the crystallization process. Polymorphs can be distinguished by various physical characteristics known in the art such as x-ray diffraction patterns, solubility, and melting point.
[0377] Certain of the compounds described herein may contain one or more chiral atoms, or may otherwise be capable of existing as two enantiomers or as two or more diastereomers. Accordingly, the compounds of this invention include mixtures of enantiomers as well as purified enantiomers or enantiomerically enriched mixtures. Furthermore, the compounds of this invention include mixtures of diastereomers, as well as purified stereoisomers or diastereomerically enriched mixtures. Also included within the scope of the invention are the individual isomers of the compounds of the invention, as defined above, as well as any wholly or partially mixtures thereof. The present invention also covers the individual isomers of the compounds represented by the formulas above as mixtures with isomers thereof in which one or more chiral centers are inverted.
[0378] The term "stereoisomer" as used herein is meant to encompass an isomer that possess identical constitution as a corresponding stereoisomer, but which differs in the arrangement of its atoms in space from the corresponding stereoisomer. For example, stereoisomers may be enantiomers, diastereomers and / or cis-trans (E / Z) isomers. It should be understood that a composition comprising a fatty acid amide of the invention may comprise single enantiomers, single diastereomers as well as mixtures thereof at any ratio (for example racemic mixtures, non racemic mixtures, mixtures of at least two diastereomers and so forth). Furthermore, the invention encompasses any stereoisomer of a fatty acid amide of the invention achieved through in vivo or in vitro metabolism, or by any type of synthetic rout.
[0379] Certain of the compounds described herein may contain one or more chiral atoms, or may otherwise be capable of existing as two enantiomers or as two or more diastereomers. Accordingly, the compounds of this invention include mixtures of enantiomers as well as purified enantiomers or enantiomerically enriched mixtures. Furthermore, the compounds of this invention include mixtures of diastereomers, as well as purified stereoisomers or diastereomerically enriched mixtures. Also included within the scope of the invention are the individual isomers of the compounds of the invention, as defined above, as well as any wholly or partially mixtures thereof. The present invention also covers the individual isomers of the compounds represented by the formulas above as mixtures with isomers thereof in which one or more chiral centers are inverted. It is also noted that the compounds of the present invention may form tautomers. It is understood that all tautomers and mixtures of tautomers of the compounds of the present invention, are included within the scope of the compounds of the present invention.
[0380] The term “solvate” refers to an aggregate of a molecule with one or more solvent molecules, such as hydrate, alcoholate (aggregate or adduct with alcohol), and the like.
[0381] The term "physiologically functional derivative" used herein relates to any physiologically acceptable derivative of a compound as described herein.
[0382] The physiologically functional derivatives also include prodrugs of the compounds of the invention. Such prodrugs may be metabolized in vivo to a compound of the invention. These prodrugs may or may not be active themselves and are also an object of the present invention.
[0383] A “pharmaceutically acceptable prodrug” is a compound that may be converted under physiological conditions to the specified compound or to a pharmaceutically acceptable salt of such compound.
[0384] A “pharmaceutically active metabolite” is a pharmacologically active product produced through metabolism in the body of a specified compound or salt thereof. Metabolites of a compound may be identified using routine techniques known in the art and their activities determined using tests such as those described herein. Prodrugs and active metabolites of a compound may be identified using routine techniques known in the art.
[0385] It should be appreciated that the present disclosure provides in some aspects thereof, any of the ARTS mimetic compound as disclosed herein above, specifically the compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for inducing apoptosis in a cell.
[0386] Still further aspects of the present disclosure relate to any of the ARTS mimetic compound as disclosed herein above, specifically the compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof.
[0387] A further aspect of the invention relates to a composition comprising an effective amount of at least one apoptosis related protein in the TGF-beta signaling pathway (ARTS) mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof; wherein
[0388] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4 -L2”-R4 ”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-,-S-, -S-S-, -S-(CH2)n-, each may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m- OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5, said composition optionally further comprises at least one pharmaceutically acceptable carrier / s, excipient / s, auxiliaries, and / or diluent / s.
[0389] In some embodiments, the ARTS mimetic compound / s comprised within the composition of the invention may be any of the compounds defined by the invention.
[0390] In more specific embodiments, the composition of the invention comprises an effective amount of the ARTS mimetic compound having the formula (3.1) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof;
[0391] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide In more specific embodiments, the composition of the invention comprises an effective amount of the ARTS mimetic compound having the formula (3.2) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof;
[0392] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide
[0393] In more specific embodiments, the composition of the invention comprises an effective amount of the ARTS mimetic compound having the formula (3.3) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof; (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide
[0394] It should be appreciated that the present disclosure provides in some aspects thereof, any of the compositions as disclosed herein above, specifically the compositions comprising the compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for inducing apoptosis in a cell.
[0395] Still further aspects of the present disclosure relate to any of the compositions as disclosed herein above, specifically the compositions comprising the compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof.
[0396] It should be noted that in some embodiments, the composition of the invention may comprise a compound having the structure of formula (3.2). In some embodiments, this compound (as well as derivatives thereof may be referred to herein as "B3" or "B3 ARTS mimetic compound".
[0397] The invention provides different ARTS mimetic compounds that specifically mimic the C domain of ARTS, specifically in binding thereof to its binding site within the BIR3 domain of XI AP.
[0398] As used herein “ARTS” (apoptosis-related protein in the TGF-β signaling pathway) is a septin-like mitochondrial protein derived from alternative splicing of the H5 / PNUTL2 / hCDCrel2a / 2b gene. ARTS acts as a tumor suppressor protein that functions as an antagonist of XIAP and thereby promotes apoptosis. It should be appreciated that in certain embodiments, as used herein in the specification and in the claim section below, ARTS protein refers to the human ARTS (as denoted by SEQ ID NO. 1). More specifically, the human ARTS protein comprises an amino acid sequence of 274 amino acid residues as denoted by GenBank Accession No. AF176379, encoded by a nucleic acid sequence of SEQ ID NO. 2.
[0399] In some specific embodiments, the ARTS mimetic compound / s of the invention and any compositions thereof may lead to ubiquitin proteasome system (UPS) mediated degradation of at least one of B-cell lymphoma 2 (Bcl-2) and X-linked-Inhibitor of Apoptosis (XIAP) in a cell.
[0400] More specifically, as shown by the Examples, the ARTS mimetic compounds of the invention act as XIAP and / or Bcl-2 antagonists, leading to UPS mediated degradation of at least one of XIAP and Bcl2. The invention thus provides a novel antagonist for Bcl-2 protein. As used herein the term Bcl-2 pro-survival protein refers to a proto-oncogenic protein known as an apoptosis inhibitor. The Bcl-2 protein forms the basis of a growing family of related proteins collectively denoted herein as Bcl-2 family of proteins. These proteins are known to control apoptotic cell death by the mitochondrial pathway.
[0401] As appreciated in the art, the members of the Bcl-2 family are either pro-survival or pro- apoptotic but regardless of their activity, they all share significant sequence and structural homology. Specifically, the Bcl-2 family of proteins is characterized by up to four regions of sequence homology, known as the Bcl-2 homology (BH) domains.
[0402] As previously described in the art, the Bcl-2 family of proteins includes three different groups of proteins: the first group is a pro-survival or anti-apoptotic group denoted herein as "Bcl-2 pro-survival proteins”, the second group is a pro-apoptotic group including BAX and BAK; and a third group denoted herein as BH3-only proteins that exhibit a pro- apoptotic activity. The ARTS mimetic compound / s of the invention antagonizes the anti-apoptotic activity of the pro-survival Bcl-2 protein leading to enhanced apoptosis of the cells. The “Bcl-2 pro-survival proteins” or “anti-apoptotic” or “Bcl-2 like” as used herein denotes a group of proteins responsible for protecting cells from apoptotic stimuli and are sequentially characterized by containing all four BH domains.
[0403] Bcl-2 (B-cell CLL / lymphoma 2) as used herein, is an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Bcl-2 suppresses apoptosis in a variety of cell systems including factor-dependent lympho-hematopoietic and neural cells. It regulates cell death by controlling the mitochondrial membrane permeability. Bcl-2 appears to function in a feedback loop system with caspases, it inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and / or by binding to the apoptosis-activating factor (APAF-1). It should be noted that in certain embodiments, the invention refers to the human Bcl-2 protein as denoted by GenBank Accession No. NP 000624 and SEQ ID NO: 3 and NP 000648 of SEQ ID NO:4), encoded by the Bcl-2 gene of GenBank Accession No. NM_000633 of SEQ ID NO: 5 and NM_000657 of SEQ ID NO:6.
[0404] As recently shown by the inventors, ARTS binds to XIAP through a domain comprising 27 residues covering the C-terminus of ARTS. This interaction induces auto degradation of XIAP. The ARTS mimetic compound / s of the invention target BIR3 domain of XIAP mimicking the ability of ARTS to enhance XIAP degradation. Thus, the ARTS mimetic compounds of the invention act as and therefore may be used as XIAP antagonists. In yet some further embodiments, the ARTS mimetic compounds of the invention may act as dual antagonists of Bcl-2and XIAP.
[0405] As used herein the term “IAPs” denotes a family of proteins that harbor between one to three copies of a baculovirus IAP repeat (BIR) domain that enable interaction with activated caspases. It was previously suggested that the BIR domains of certain IAPs, in particular XIAP, have the ability to directly inhibit caspase activity in vitro. X-linked inhibitor of apoptosis protein (XI AP), also known as inhibitor of apoptosis protein 3 (IAP3) and baculoviral IAP repeat-containing protein 4 (BIRC) denotes a protein known to stop an apoptotic process and thus inhibit cell death. In human, XIAP is produced by a gene named XIAP gene located on the X chromosome. XIAP is also called human lAP-like Protein (hILP), because it is not as well conserved as the human IAPS: hIAP-1 and hIAP-2 XIAP are the most potent human IAP proteins currently identified.
[0406] XIAP belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat (BIR domain), which is necessary for their anti-apoptotic function. XIAP acts as a direct caspase inhibitor by directly binding to the active site pocket of CASP3 and CASP7 and obstructing substrate entry. It further inactivates CASP9 by keeping it in a monomeric, inactive state.
[0407] It should be noted that in certain embodiments, the invention relates to the human XIAP protein (GenBank Accession Nos. NP 001158, NP 001191330, as denoted by SEQ ID NO. 9) encoded by the XIAP gene (GenBank Accession Nos. NM_001167, NM_001204401, as denoted by SEQ ID NO. 10).
[0408] In yet another embodiment, the ARTS mimetic compounds of the invention bind XIAP thereby leading to UPS mediated degradation of Bcl-2. As such, they may further act on other Bcl-2 family members. Thus, in some embodiments the ARTS mimetic compounds of the invention may antagonize Bcl-xL. B-cell lymphoma- extra large (Bcl-xL) as used herein, is a transmembrane molecule in the mitochondria. It is a member of the Bcl-2 family of proteins and acts as a pro-survival protein by preventing the release of mitochondrial contents such as cytochrome c, which would lead to caspase activation. In certain embodiments the invention relates to the human Bcl-xL protein (GenBank Accession No. CAA80661 SEQ ID NO: 7), encoded by the Bcl-xL gene as denoted by GenBank Accession No. Z23115 and SEQ ID NO: 8.
[0409] In yet another embodiment, the ARTS mimetic compounds of the invention may antagonize any one of the human Bcl-2 pro-survival proteins Mcl-1, Bcl-w, Al / Bfl-1 and Bcl-B / Bcl2L10 as denoted by accession number: AAF64255, AAB09055, NP_033872 and NP_065129, respectively.
[0410] As indicated above, the present invention relates to the ARTS mimetic compounds of the invention that act as antagonist / s of XIAP and Bcl-2. An antagonist is a compound that competes with a specific protein, a ligand for example, on binding to another protein, a receptor for example. Such binding usually, induces a specific biological response or action that is blocked by the competing antagonist. Antagonists have affinity but no efficacy for their cognate binding protein and binding will disrupt the interaction and inhibit the function of such cognate protein. Antagonists mediate their effects by binding to the active (orthosteric = right place) site or to allosteric (= other place) sites on any cognate protein, in this case, XIAP (or receptor, in case applicable), or they may interact at unique binding sites not normally involved in the biological regulation of the cognate protein.
[0411] As shown in the Examples, down regulation of XIAP and Bcl-2 protein levels was observed in the presence of the ARTS mimetic compounds of the invention. This suggests that the down-regulation of Bcl-2 levels observed may be mediated by the ubiquitin - proteasome machinery (UPS).
[0412] Thus, in certain embodiments, the ARTS mimetic compounds of the invention, mediate ubiquitin proteasome system (UPS) degradation of XIAP anti-apoptotic protein and Bcl-2 prosurvival protein, thereby reducing survival of the cells.
[0413] As used herein the term “ubiquitin proteasome system” denotes a multi component system that identifies and degrades unneeded, damaged or misfolded proteins by breaking peptide bonds (proteolysis) of the protein in the cytoplasm of cells. As appreciated in the art, degradation of a protein via the UPS involves two discrete and successive steps. In the first step, proteins are tagged for degradation with a small protein called ubiquitin. The tagging reaction is catalyzed by enzymes called ubiquitin ligases. Once a protein is tagged with a single ubiquitin molecule, this is a signal to other ligases to attach additional ubiquitin molecules.
[0414] More specifically, conjugation of ubiquitin, a highly evolutionarily conserved 76 amino acid residue polypeptide, to the protein substrate proceeds via a three-step cascade mechanism involving El, E2 and E3 enzymes. By successively adding activated ubiquitin moieties to internal lysine residues on the previously conjugated ubiquitin molecule, a polyubiquitin chain is synthesized that is subsequently recognized by the downstream 26S proteasome complex.
[0415] In the second step, degradation of polyubiquitinated substrates is carried out by a large, protease complex, referred to as the 26S proteasome that does not recognize nonmodified substrates. The proteasomes are multicatalytic protease protein complexes found in all cells that degrades polyubiquitinated proteins to short peptides by breaking peptide bonds (proteolysis). Following degradation of the substrate, short peptides derived from the substrate are released, along with reusable ubiquitin.
[0416] It should be noted that the ubiquitin-proteasome system (UPS) plays a central and complex role in regulating apoptosis by directly targeting key cell death proteins, including caspases.
[0417] It should be noted that by inducing XIAP and Bcl-2 degradation, the ARTS mimetic compound / s of the invention, inhibit the pro-survival or anti-apoptotic effect of Bcl-2 protein. The terms "inhibition", "moderation" or "attenuation" as referred to herein, relate to the retardation, restraining or reduction of the anti-apoptotic activity of a Bcl-2 pro-survival protein. Such inhibition may be of about 1% to 99.9%, specifically, about 1% to about 95%, about 5% to 90%, about 10% to 85%, about 15% to 80%, about 20% to 75%, about 25% to 70%, about 30% to 65%, about 35% to 60%, about 40% to 55%, about 45% to 50%. More specifically, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% ,99.9% or 100%. It should be further noted that by inhibiting the anti-apoptotic action of Bcl-2 proteins, ARTS mimetic compounds of the invention induce or enhances apoptosis. More specifically, the ARTS mimetic compounds of the invention, specifically, as well as any of the compositions and methods of the invention described herein after, may lead to an increase, enhancement, induction or elevation in apoptosis of treated cells, said increase, induction or elevation of apoptosis may be an increase by about 1% to 99.9%, specifically, about 1% to about 95%, about 5% to 90%, about 10% to 85%, about 15% to 80%, about 20% to 75%, about 25% to 70%, about 30% to 65%, about 35% to 60%, about 40% to 55%, about 45% to 50%. More specifically, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99.9%. More specifically, an increase of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% OR 100% as compared to untreated control.
[0418] With regards to the above, it is to be understood that, where provided, percentage values such as, for example, 10%, 50%, 120%, 500%, etc., are interchangeable with "fold change" values, i.e., 0.1, 0.5, 1.2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 etc., respectively.
[0419] Moreover, in certain embodiments, the ARTS mimetic compound / s of the invention may lead to elevation in at least one of c-caspase and c-PARP levels in a cell. In some specific embodiments, the ARTS mimetic compound / s of the invention may lead to elevation in cleaved caspase, specifically, cleaved caspase 3 and / or caspase 9.
[0420] In further embodiments, the ARTS mimetic compound / s of the invention and compositions thereof may induce programmed cell death, or apoptosis.
[0421] The term "apoptosis" refers to a regulated network of biochemical events which lead to a selective form of cell suicide and is characterized by readily observable morphological and biochemical phenomena. Cells undergoing apoptosis show characteristic morphological and biochemical features. These features include chromatin aggregation or condensation, DNA fragmentation, nuclear and cytoplasmic condensation, partition of cytoplasm and nucleus into membrane bound vesicles (apoptotic bodies) which contain ribosomes, morphologically intact mitochondria and nuclear material. Cytochrome C release from mitochondria is seen as an indication of mitochondrial dysfunction accompanying apoptosis.
[0422] As indicated above, apoptosis is a tightly controlled form of active cell death that is necessary for development and organismal homeostasis. Death by the apoptotic pathway is achieved among others, by the activation of a family of highly potent and specific proteases, termed caspases (for cysteine-aspartate protease).
[0423] The activity of caspases is tightly regulated, and the cell maintains several “checkpoints” to control their activity. The first level of regulation is intrinsic to caspases themselves. Caspases are initially transcribed as weakly active zymogens, which only upon proper stimulation are cleaved to form the active enzyme.
[0424] The second level of caspase regulation is achieved by inhibitors, namely the family of proteins called IAPS (Inhibitor of Apoptosis Protein).
[0425] Still further, the ARTS mimetic compound / s of the invention and compositions thereof may induce apoptosis in at least one of a premalignant and a malignant cell.
[0426] In some embodiments, such cell may be an epithelial carcinoma cell.
[0427] In more specific embodiments, such cell may be an epithelial breast carcinoma cell.
[0428] In yet some further embodiments, the cell may be a cervical carcinoma cell.
[0429] Still further, in some embodiments, the cell may be at least one melanoma cell.
[0430] In yet some further embodiments, the cell may be at least one sarcoma cell. Still further in some embodiments, the cell may be an osteosarcoma cell.
[0431] Still further in some embodiments, the cell may be a hematological malignancy cell.
[0432] In some particular embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell characterized by at least one of: (a) over expression of Bcl-2;
[0433] (b) over expression of XIAP; and (c) low or no expression of ARTS. In some particular embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell over expressing Bcl-2.
[0434] In yet some further embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell over expressing XIAP.
[0435] In yet some further embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell over expressing XIAP and Bcl-2.
[0436] In further embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell that express low levels of ARTS, or in a cell that show no expression of ARTS. As ARTS mediates the degradation of both, XIAP and Bcl-2, cells that do not express ARTS or show low levels of expression of ARTS, may in some embodiments display overexpression of at least one of XIAP and Bcl-2.
[0437] In yet some further embodiments, the ARTS mimetic compound / s of the invention as well as any composition / s thereof may be applicable in inducing programmed cell death in premalignant or malignant epithelial cells in a subject in need thereof.
[0438] The present invention therefore further provides pharmaceutical compositions.
[0439] In certain embodiments, the compositions of the present invention can be administered for prophylactic and / or therapeutic treatments. In therapeutic application, compositions are administered to a patient already affected by a proliferative disorder (e.g., carcinoma, specifically breast carcinoma) in an amount sufficient to cure or at least partially arrest the condition and its complications. An amount adequate to accomplish this is defined as a “therapeutically effective dose.” Amounts effective for this use will depend upon the severity of the condition and the general state of the patient's own immune system, but generally range from about 0.001 to about 1000 mg / Kg. Single or multiple administrations on a daily, weekly or monthly schedule can be carried out with dose levels and pattern being selected by the treating physician. Additionally, the administration of the compositions of the invention, may be periodic, for example, the periodic administration may be affected twice daily, three time daily, or at least one daily for at least about three days to three months. The advantages of lower doses are evident to those of skill in the art. These include, inter alia, a lower risk of side effects, especially in long-term use, and a lower risk of the patients becoming desensitized to the treatment. In another embodiment, treatment using the compositions of the invention, may be affected following at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 14, 30, 60, 90 days of treatment, and proceeding on to treatment for life.
[0440] In some embodiments, the effective amount of the disclosed ARTS mimetic compounds, and specifically of the B3 compound, may range from about 0. 1 pM to about 10OpM. Specifically, from 0.5 pMto about 100 pM, from 1 pMto about 100 pM, 1 pM to 90, 1 pM to 80 pM, 1 pM to 70 pM, 1 pM to 80 pM, 1 pM to 70 pM, 1 pM to 60 pM, 1 pM to 50 pM, 1 pMto 40 pM, 1 pMto 30 pM, 1 pMto 20 pM, 1 pMto 10 pM, specifically, 1 pM or less, 2, 3, 4, 5, 6, 7., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 pM or more. In some embodiments, an effective amount of the "B3" compound may be 20 pM
[0441] It should be noted that the treatment of different proliferative conditions may indicate the use of different doses or different time periods, these will be evident to the skilled medical practitioner.
[0442] For prophylactic applications, the compositions of the invention may include a prophylactic effective amount of the active ingredient. The term “prophylactically effective amount” is intended to mean that amount of a pharmaceutical composition that will prevent or reduce the risk of occurrence or recurrence of the biological or medical event that is sought to be prevented in a tissue, a system, animal or human by a researcher, veterinarian, medical doctor or other clinician. In prophylactic applications, the compositions of the invention are administered to a patient who is at risk of developing the disease state to enhance the patient's resistance. Such an amount is defined to be a “prophylactically effective dose”. In this use, the precise amounts again depend upon the patient's state of health and general level of immunity, but generally range from 0.001 to 1000 mg per dose.
[0443] It should be appreciated that the ARTS mimetic compounds of the present disclosure, specifically, the B3 compound, may be formulated in any vehicle, matrix, nano- or micro-particle, or composition. Of particular relevance are formulations of the ARTS mimetic compounds adapted for use as a nano- or micro-particles. Nanoscale drug delivery systems using micellar formulations, liposomes and nanoparticles are emerging technologies for the rational drug delivery, which offers improved pharmacokinetic properties, controlled and sustained release of drugs and, more importantly, lower systemic toxicity. A particularly desired solution allows for externally triggered release of encapsulated compounds. Externally controlled release can be accomplished if drug delivery vehicles, such as micelles, liposomes or polyelectrolyte multilayer capsules, incorporate nanoparticle (NP) actuators. More specifically, Controlled drug delivery systems (DDS) have several advantages compared to the traditional forms of drugs. It should be therefore understood that the present disclosure further encompasses the use of various nanostructures, including micellar formulations, liposomes, polymers, dendrimers, silicon or carbon materials, polymeric nanoparticles and magnetic nanoparticles, as carriers in drug delivery systems. The term "nanostructure" or "nanoparticle" is used herein to denote any microscopic particle smaller than about 100 nm in diameter. In some other embodiments, the carrier is an organized collection of lipids. When referring to the structure forming lipids, specifically, micellar formulations or liposomes, it is to be understood to mean any biocompatible lipid that can assemble into an organized collection of lipids (organized structure). In some embodiments, the lipid may be natural, semi-synthetic or fully synthetic lipid, as well as electrically neutral, negatively or positively charged lipid. In some embodiments, the lipid may be a naturally occurring phospholipid.
[0444] It should be appreciated that the at least one ARTS mimetic compounds disclosed herein may be associated with any of the nanostructures described above, specifically, any of the micellar formulations, liposomes, polymers, dendrimers, silicon or carbon materials, polymeric nanoparticles and magnetic nanoparticles disclosed herein above. The term “association” may be used interchangeably with the term “entrapped', “attachment”, “linked", “embedded", “absorbed" and the like, and contemplates any manner by which the at least one ARTS mimetic compounds of the disclosure is held.
[0445] As mentioned herein before, the compositions provided by the invention optionally further comprise at least one pharmaceutically acceptable excipient or carrier. As used herein “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic composition is contemplated.
[0446] The pharmaceutical composition of the invention can be administered and dosed by the methods of the invention, in accordance with good medical practice. More specifically, the compositions used in the methods and kits of the invention, described herein after, may be adapted for administration by systemic, parenteral, intraperitoneal, transdermal, oral (including buccal or sublingual), rectal, topical (including buccal or sublingual), vaginal, intranasal and any other appropriate routes. Such formulations may be prepared by any method known in the art of pharmacy, for example by bringing into association the active ingredient with the carrier(s) or excipient(s).
[0447] The phrases "systemic administration," "administered systemically," "peripheral administration" and "administered peripherally" as used herein mean the administration of a compound, drug or other material other than directly into the central blood system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes. The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
[0448] Regardless of the route of administration selected, the compounds of the present invention, which may be used in a suitable hydrated form, and / or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art. The pharmaceutical forms suitable for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
[0449] The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0450] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
[0451] In the case of sterile powders for the preparation of the sterile injectable solutions, the preferred method of preparation is vacuum -drying and freeze drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0452] Pharmaceutical compositions used to treat subjects in need thereof according to the invention generally comprise a buffering agent, an agent who adjusts the osmolarity thereof, and optionally, one or more pharmaceutically acceptable carriers, excipients and / or additives as known in the art. Supplementary active ingredients can also be incorporated into the compositions. The carrier can be solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
[0453] Local administration to the area in need of treatment may be achieved by, for example, local infusion during surgery, topical application, direct injection into the specific organ, etc.
[0454] Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, lozenges (including liquid-filled), chews, multi- and nano-particulates, gels, solid solution, liposome, films, ovules, sprays or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
[0455] Pharmaceutical compositions used to treat subjects in need thereof according to the invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. The compositions may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers. The pharmaceutical compositions of the present invention also include, but are not limited to, emulsions and liposome-containing formulations.
[0456] It should be understood that in addition to the ingredients particularly mentioned above, the formulations may also include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavoring agents.
[0457] In particular embodiments, the unit dosage formulations are those containing a daily dose or sub-dose, as herein above recited, or an appropriate fraction thereof, of an active ingredient.
[0458] A further aspect of the invention relates to a method for inducing apoptosis in a cell. In more specific embodiments, the method comprises the step of contacting the cell with an effective amount of at least one ARTS mimetic compound, any combination thereof or any composition comprising the same. In further embodiments, the ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof; wherein
[0459] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4 -L2”-R4 ”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-,-S-, -S-S-, -S-(CH2)n-, each may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m- OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0460] It should be noted that in certain embodiments, the method / s of the invention may use any of the ARTS mimetic compound / s as defined by the invention.
[0461] In more particular embodiments, the method / s of the invention may use an ARTS mimetic compound having the formula (3.1) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof;
[0462] Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide
[0463] In more particular embodiments, the method / s of the invention may use an ARTS mimetic compound having the formula (3.2) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof;
[0464]
[0465] (S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide
[0466] In more particular embodiments, the method / s of the invention may use an ARTS mimetic compound having the formula (3.3) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof;
[0467] (R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide Still further, in certain embodiments, the ARTS mimetic compound / s used by the methods of the invention may lead to at least one of UPS mediated degradation of at least one of Bcl-2 and XIAP and elevation in at least one of c-caspase and c-PARP levels. In yet some specific embodiments, the ARTS mimetic compound / s used by the methods of the invention may lead to at least one of elevation in at least one of c-caspase-3, c- caspase-9 and c-PARP levels.
[0468] In yet some further embodiments, the ARTS mimetic compound / s used by the methods of the invention may induce apoptosis in at least one of pre-malignant and malignant cell / s.
[0469] In more specific embodiments, the cell may be an epithelial carcinoma cell or a premalignant cell. More specifically, the cell may be an epithelial breast carcinoma cell or a pre-malignant epithelial breast cell.
[0470] In yet some further embodiments, the cell may be a cervical carcinoma cell. Still further, in some embodiments, the cell may be at least one melanoma cell. In yet some further embodiments, the cell may be at least one sarcoma cell. Still further in some embodiments, the cell may be an osteosarcoma cell. Still further in some embodiments, the cell may be a hematological malignancy cell. In some embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell characterized by at least one of: (a) over expression of Bcl-2; (b) over expression of XIAP; and (c) low or no expression of ARTS.
[0471] In certain embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell over expressing Bcl-2.
[0472] In yet some further embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell over expressing XIAP.
[0473] In yet some further embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell over expressing XIAP and Bcl-2. In further embodiments, the ARTS mimetic compound / s of the invention may induce apoptosis in a cell that express low levels of ARTS, or in a cell that show no expression of ARTS.
[0474] In yet some further embodiments, the invention provides a method for inducing apoptosis of pre-malignant or malignant epithelial cells in a subject in need thereof.
[0475] Another aspect of the invention relates to a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof. More specifically, the method comprises administering to the subject a therapeutically effective amount of at least one ARTS mimetic compound or of a composition comprising the same. More specifically, the ARTS mimetic compound used by the method of the invention may have the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof; wherein
[0476] Ri, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4 -L2”-R4 wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-. each may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m- OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
[0477] In more specific embodiments, the method of the invention may use any of the ARTS mimetic compound / s defined by the invention or any of the compositions of the invention.
[0478] As used herein, "proliferative disorder" is a disorder displaying hyper proliferation. This term means cell division and growth that is not part of normal cellular turnover, metabolism, growth, or propagation of the whole organism. Unwanted proliferation of cells is seen in tumors and other pathological proliferation of cells, does not serve normal function, and for the most part will continue unbridled at a growth rate exceeding that of cells of a normal tissue in the absence of outside intervention. A pathological state that ensues because of the unwanted proliferation of cells is referred herein as a "hyper proliferative disease" or "hyper proliferative disorder." It should be noted that the term “proliferative disorder”, “cancer”, “tumor” and “malignancy” all relate equivalently to a hyperplasia of a tissue or organ. In yet some further embodiments, the methods of the invention may be applicable for treating malignant, pre-malignant disorders and / or cancer. In general, the compositions and methods of the present invention may be used in the treatment of non-solid and solid tumors. In certain embodiments, the therapeutic method of the invention may be particularly effective for a subject suffering from any one of a pre-malignant condition and carcinoma.
[0479] Carcinoma as used herein, refers to an invasive malignant tumor consisting of transformed epithelial cells. Alternatively, it refers to a malignant tumor composed of transformed cells of unknown histogenesis, but which possess specific molecular or histological characteristics that are associated with epithelial cells, such as the production of cytokeratins or intercellular bridges. In terms of solid tumors, this group of cancers may include, among others, carcinomas of the breast, lung, bladder as well as gastric, colorectal, ovarian and uterine carcinomas. The term "carcinoma" refers herein to any tumor tissue derived from putative epithelial cells, or cells of endodermal or ectodermal germ layer during embryogenesis, that become transformed and begin to exhibit abnormal malignant properties.
[0480] In more specific embodiments, the therapeutic methods of the invention may be applicable for subjects suffering from a breast carcinoma.
[0481] Breast cancer is one of the leading causes of cancer death in women in the Western world. Though current therapies are effective, a considerable population will relapse, rendering the essential need for improved and new avenues of targeted therapies. Gene expression profiling can be used to distinguish breast cancers into distinct molecular subtypes with prognostic significance, based upon phenotypic diversity in biological factors such as histological grade, estrogen receptor (ER) status, progesterone receptor (PgR) status, and HER2 / new expression (HER2).
[0482] When presently referring to breast cancer, is meant any type of cancer originating from breast tissue, including ductal and lobular carcinomas. The present context also encompasses genetic or hereditary breast cancers (5-10% of all cases) developing from predisposing mutations in BRCA1 and BRCA2 genes and also other relevant mutations in p53 (Li- Fraumeni syndrome), PTEN (Cowden syndrome), and STK11 (Peutz-Jeghers syndrome), CHEK2, ATM, BRIP1, and PALB2 genes. The present context also encompasses all breast cancer classifications, including those using histopathology (e.g. mammary ductal carcinoma, carcinoma in situ, invasive carcinoma or inflammatory breast cancer), grade (e.g. well differentiated / low grade, moderately differentiated / intermediate grade and poorly differentiated / high grade), stage (O=pre-cancerous, l-3=regional, 4=metastatic), receptor status (relating to the expression of estrogen receptor ER, PR progesterone receptor and / or HER2 / ERBB2 receptor), DNA and protein based classification (using specific mutations or gene expression profiles), and other classification approaches.
[0483] According to another embodiment, as leading to degradation of at least one of Bcl-2 and XIAP, the ARTS mimetic compound / s, compositions and methods of the invention may be further applicable for pathological disorders characterized by at least one of: (a) over expression of Bcl-2; (b) over expression of XIAP; and (c) low or no expression of ARTS. In yet some further embodiments, such disorders are characterized by overexpression of XIAP, Bcl-2 and low or no expression of ARTS.
[0484] According to other embodiments, as leading to degradation of Bcl-2, the ARTS mimetic compound / s, compositions and methods of the invention may be further applicable for Bcl-2 over-expressing pathological disorders. More specifically, the invention thus further provides compositions for treating, inhibiting, preventing, ameliorating or delaying the onset of a Bcl-2 over-expressing pathological disorder. Such composition optionally may further comprise at least one pharmaceutically acceptable carrier, diluent or excipient.
[0485] The phrases "Bcl-2-over-expressing-disorder" and "Bcl-2-mediated disorder" refer to pathological and disease conditions in which a Bcl-2 protein is over-expressed as indicated herein above. Moreover, this term also encompasses conditions in which Bcl-2 plays a role. Such roles can be directly related to the pathological condition or can be indirectly related to the condition. The feature common to this class of conditions is that they can be ameliorated by inhibiting the expression of, activity of, function of, or association with Bcl-2 proteins. The term "over expressed" refers to an increase in the measurable expression level of Bcl-2 gene as measured by the amount of RNA and / or the amount of protein in a sample as compared with the measurable expression level of Bcl-2 gene in a second sample, specifically, a control sample. “Over expressed Bcl-2" can be measured and evaluated using the ratio of the level of expression of Bcl-2 in a sample as compared with the mean expression level of Bcl-2 of a control sample wherein the ratio is not equal and specifically, is above 1.0. When determining over expression on the basis of the ratio, an RNA or protein is over expressed if the ratio of the level of expression in a first sample as compared with a second sample is greater than 1.0. For example, a ratio of greater than 1.2, 1.5, 1.7, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more.
[0486] More specifically, disorders displaying “over or increased expression" or "up regulation" of Bcl-2 refer to disorders which demonstrate at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90%, 95%, 100% or more, or 1.1 fold, 1.2 fold, 1.4 fold, 1.6 fold, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 fold, or more increase in Bcl-2 expression (as measured by RNA expression or protein expression), relative to a control sample.
[0487] Thus, a Bcl-2 over-expressing pathological disorder is meant a disorder characterized by over-expression of Bcl-2 in said subject or in a diseased tissue of said subject as compared to a healthy subject or a healthy tissue of the same subject.
[0488] It should be noted that the Bcl-2 over-expressing disorder may be caused by chromosomal translocation, hypo-methylation and down regulation of the microRNAs that target Bcl-2.
[0489] In yet another embodiment, the pharmaceutical composition of the invention is specifically applicable for treating Bcl-2 over-expressing proliferative disorders.
[0490] According to another embodiment, as leading to degradation of XIAP, the ARTS mimetic compound / s, compositions and methods of the invention may be further applicable for XIAP over-expressing pathological disorders. More specifically, the invention thus further provides compositions for treating, inhibiting, preventing, ameliorating or delaying the onset of a XIAP over-expressing pathological disorder. Such composition optionally may further comprise at least one pharmaceutically acceptable carrier, diluent or excipient.
[0491] The phrases "XIAP -over-expressing-disorder" and " XIAP -mediated disorder" refer to pathological and disease conditions in which a XIAP protein is over-expressed as indicated herein above. Moreover, this term also encompasses conditions in which XIAP plays a role. Such roles can be directly related to the pathological condition or can be indirectly related to the condition. The feature common to this class of conditions is that they can be ameliorated by inhibiting the expression of, activity of, function of, or association with XIAP proteins.
[0492] The term "over expressed" refers to an increase in the measurable expression level of XIAP gene as measured by the amount of RNA and / or the amount of protein in a sample as compared with the measurable expression level of XIAP gene in a second sample, specifically, a control sample. “Over expressed XIAP " can be measured and evaluated using the ratio of the level of expression of XIAP in a sample as compared with the mean expression level of XIAP of a control sample wherein the ratio is not equal and specifically, is above 1.0. When determining over expression on the basis of the ratio, an RNA or protein is over expressed if the ratio of the level of expression in a first sample as compared with a second sample is greater than 1.0. For example, a ratio of greater than 1.2, 1.5, 1.7, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more.
[0493] More specifically, disorders displaying “over or increased expression" or "up regulation" of XIAP refer to disorders which demonstrate at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90%, 95%, 100% or more, or 1.1 fold, 1.2 fold, 1.4 fold, 1.6 fold, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 fold, or more increase in XIAP expression (as measured by RNA expression or protein expression), relative to a control sample. Thus, a XIAP over-expressing pathological disorder is meant a disorder characterized by over-expression of XIAP in said subject or in a diseased tissue of said subject as compared to a healthy subject or a healthy tissue of the same subject.
[0494] In yet another embodiment, the pharmaceutical composition of the invention is specifically applicable for treating XIAP over-expressing proliferative disorders.
[0495] In yet some further embodiments, said disorders are characterized by low expression or no expression of ARTS.
[0496] Still further, it must be appreciated that in some embodiments, selection or identification of a patient or population of patients that may be suitably treated by the ARTS mimetic compounds of the invention may involve a diagnostic step of measuring the expression levels of at least one of ARTS, XIAP and Bcl-2. Patients that display at least one of (a) over expression of Bcl-2; (b) over expression of XIAP; and (c) low or no expression of ARTS, are to be treated by the ARTS mimetic compounds of the invention.
[0497] Still further, malignancy, as contemplated in the present invention may be any one of lymphomas, leukemias, carcinomas, melanomas, myeloma and sarcomas. Therefore, in certain embodiments, the ARTS mimetic compound / s, compositions and methods of the invention may be further relevant for other malignancies such as lymphomas, leukemia, melanomas, myeloma and sarcomas.
[0498] Lymphoma is a cancer in the lymphatic cells of the immune system. Typically, lymphomas present as a solid tumor of lymphoid cells. These malignant cells often originate in lymph nodes, presenting as an enlargement of the node (a tumor). It can also affect other organs in which case it is referred to as extranodal lymphoma. Non limiting examples for lymphoma include Hodgkin's disease, non-Hodgkin's lymphomas and Burkitt's lymphoma. Leukemia refers to progressive, malignant diseases of the blood-forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number of abnormal cells in the blood-leukemic or aleukemic (subleukemic).
[0499] Melanoma as used herein is a malignant tumor of melanocytes. Melanocytes are cells that produce the dark pigment, melanin, which is responsible for the color of skin. They predominantly occur in skin, but are also found in other parts of the body, including the bowel and the eye. Melanoma can occur in any part of the body that contains melanocytes.
[0500] Sarcoma is a cancer that arises from transformed connective tissue cells. These cells originate from embryonic mesoderm, or middle layer, which forms the bone, cartilage, and fat tissues. This is in contrast to carcinomas, which originate in the epithelium. The epithelium lines the surface of structures throughout the body, and is the origin of cancers in the breast, colon, and pancreas.
[0501] Myeloma as mentioned herein is a cancer of plasma cells, a type of white blood cell normally responsible for the production of antibodies. Collections of abnormal cells accumulate in bones, where they cause bone lesions, and in the bone marrow where they interfere with the production of normal blood cells. Most cases of myeloma also feature the production of a paraprotein, an abnormal antibody that can cause kidney problems and interferes with the production of normal antibodies leading to immunodeficiency. Hypercalcemia (high calcium levels) is often encountered.
[0502] Further malignancies that may find utility in the present invention can comprise but are not limited to hematological malignancies (including lymphoma, leukemia and myeloproliferative disorders), hypoplastic and aplastic anemia (both virally induced and idiopathic), myelodysplastic syndromes, all types of paraneoplastic syndromes (both immune mediated and idiopathic) and solid tumors (including GI tract, colon, lung, liver, breast, prostate, pancreas and Kaposi's sarcoma. More particularly, the malignant disorder may be lymphoma. Non-limiting examples of cancers treatable according to the invention include hematopoietic malignancies such as all types of lymphomas, leukemia, e.g. acute lymphocytic leukemia (ALL), acute myelogenous leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), myelodysplastic syndrome (MDS), mast cell leukemia, hairy cell leukemia, Hodgkin's disease, non-Hodgkin's lymphomas, Burkitt's lymphoma and multiple myeloma, as well as for the treatment or inhibition of solid tumors such as tumors in lip and oral cavity, pharynx, larynx, paranasal sinuses, major salivary glands, thyroid gland, esophagus, stomach, small intestine, colon, colorectum, anal canal, liver, gallbladder, extrahepatic bile ducts, ampulla of vater, exocrine pancreas, lung, pleural mesothelioma, bone, soft tissue sarcoma, carcinoma and malignant melanoma of the skin, breast, vulva, vagina, cervix uteri, corpus uteri, ovary, fallopian tube, gestational trophoblastic tumors, penis, prostate, testis, kidney, renal pelvis, ureter, urinary bladder, urethra, carcinoma of the eyelid, carcinoma of the conjunctiva, malignant melanoma of the conjunctiva, malignant melanoma of the uvea, retinoblastoma, carcinoma of the lacrimal gland, sarcoma of the orbit, brain, spinal cord, vascular system, hemangiosarcoma and Kaposi's sarcoma. Still further the invention relates to any neurological tumor, for example, neuroblastoma, astrocytoma, CNS lymphoma, neuroma, glioma, Chordoma, medulloblastoma, Oligodendroglioma, Craniopharyngioma, and any mixed neurological tumor.
[0503] The methods provided herein involve administration of the ARTS mimetic compound / s of the invention in a therapeutically effective amount. The term "effective amount" as used herein is that determined by such considerations as are known to the man of skill in the art. The amount must be sufficient to prevent or ameliorate tissue damage caused by proliferative disorders. Dosing is dependent on the severity of the symptoms and on the responsiveness of the subject to the active drug, specifically, the antagonist of the invention. Medically trained professionals can easily determine the optimum dosage, dosing methodology and repetition rates. In any case, the attending physician, taking into consideration the age, sex, weight and state of the disease of the subject to be treated, will determine the dose. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. In general, dosage is calculated according to body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the compositions and combined composition of the invention in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the ARTS mimetic compound used by the method of the invention is administered in maintenance doses, once or more daily. As use herein "therapeutically effective amount" means an amount of the ARTS mimetic compound / s, a composition comprising the same which provides a medical benefit as noted by the clinician or other qualified observer. Regression of a tumor in a patient is typically measured with reference to the diameter of a tumor. Decrease in the diameter of a tumor indicates regression. Complete regression is also indicated by failure of tumors to reoccur after treatment has stopped.
[0504] The present invention provides methods for treating proliferative disorder. The term “treatment or prevention” refers to the complete range of therapeutically positive effects of administrating to a subject including inhibition, reduction of, alleviation of, and relief from, proliferative disorder symptoms or undesired side effects of such proliferative disorder related disorders. More specifically, treatment or prevention includes the prevention or postponement of development of the disease, prevention or postponement of development of symptoms and / or a reduction in the severity of such symptoms that will or are expected to develop. These further include ameliorating existing symptoms, preventing- additional symptoms and ameliorating or preventing the underlying metabolic causes of symptoms. As used herein, “disease”, “disorder”, “condition” and the like, as they relate to a subject's health, are used interchangeably and have meanings ascribed to each and all of such terms.
[0505] The present invention relates to the treatment of subjects, or patients, in need thereof. By “patient” or “subject in need” it is meant any organism who may be affected by the above-mentioned conditions, and to whom the treatment methods herein described are desired, including humans, domestic and non-domestic mammals such as canine and feline subjects, bovine, simian, equine and murine subjects, rodents, domestic birds, aquaculture, fish and exotic aquarium fish. It should be appreciated that the treated subject may be also any reptile or zoo animal. More specifically, the methods and compositions of the invention are intended for mammals. By “mammalian subject” is meant any mammal for which the proposed therapy is desired, including human, equine, canine, and feline subjects, most specifically humans. It should be noted that specifically in cases of non-human subjects, the method of the invention may be performed using administration via injection, drinking water, feed, spraying, oral gavage and directly into the digestive tract of subjects in need thereof. It should be further noted that particularly in case of human subject, administering of the compositions of the invention to the patient includes both self-administration and administration to the patient by another person.
[0506] The invention provides methods for treating proliferative disorders, and further relates to disorders associated or related to cancer. It is understood that the interchangeably used terms "associated" and "related", when referring to pathologies herein, mean diseases, disorders, conditions, or any pathologies which at least one of: share causalities, co-exist at a higher than coincidental frequency, or where at least one disease, disorder condition or pathology causes the second disease, disorder, condition or pathology.
[0507] The invention further provides the use of an effective amount of at least one ARTS mimetic compound and any combination thereof in the preparation of a composition for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof.
[0508] The invention further provides for the use of an effective amount of at least one ARTS mimetic compound / s as defined by the invention, and any combination thereof in the preparation of a composition for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof.
[0509] Still further, the invention provides an effective amount of at least one ARTS mimetic compound / s according to the invention, any combination thereof or any composition comprising the same for use in a method for inducing programmed cell death.
[0510] The invention further provides an effective amount of at least one ARTS mimetic compound / s as defined by the invention, any combination thereof or any composition comprising the same for use in a method for inducing apoptosis in a subject in need thereof.
[0511] Still further, the invention relates to an effective amount of at least one ARTS mimetic compound / s as defined herein, any combination thereof or any composition comprising the same for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof.
[0512] As shown by Example 4, the combined treatment of ABT- 199 with B3 significantly reduced Bcl-2 expression, and moreover, B3 synergistically restores the apoptotic effect of ABT-199. Thus, the invention further provides a combined composition comprising an effective amount of at least one ARTS mimetic compound as defined by the invention, specifically, the B3 mimetic compound, and at least one B-cell lymphoma 2 (Bcl-2) Homology 3 (BH3) mimetic compound. In some embodiments, such BH3 mimetic compound is 4- [4-[ [2-(4-Chlorophenyl)-4,4-dimethyl- 1 -cyclohexen- 1 -y 1] methyl] - 1 - piperazinyl]-A-[[3-nitro-4-[[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]- 2-(l H-pyrrolo [2, 3 -b ]pyridin-5-yloxy jbenzamide (ABT- 199), and any derivatives thereof. In yet some further aspects, the invention provides a method for inducing apoptosis in a cell comprising the step of contacting said cell with an effective amount of at least one ARTS mimetic compound as defined by the invention, specifically, the B3 compound, and of at least one BH3 mimetic compound. In more specific embodiments, the BH3 mimetic compound is 4-[4-[[2-(4-Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l- yl] methyl] - 1 -piperazinyl] -N- [ [3 -nitro-4-[ [(tetrahydro-2H-pyran-4- yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3-b ]pyridin-5-yloxy)benzamide (ABT- 199), and any derivatives thereof.
[0513] As indicated above, the Bcl-2 proteins can be broadly categorized as acting in either a pro-apoptotic or anti-apoptotic manner. Whilst these groups act directly in driving or diminishing apoptosis, a third group of proteins, which are functionally and structurally unique, and when over-expressed can sensitize cells to biochemical cues that induce apoptosis, are the BH3-only proteins (or sensitizer proteins). The Bcl-2 proteins are composed of conserved BH1-4 domains and in some instances a transmembrane domain. The key structural component of intrinsic importance, which is present in all of the pro- apoptotic Bcl-2 family protein members, is unquestionably the BH3 domain, which is a structure composed of about 15 amino acids from a-helix 2, and which interacts with the hydrophobic pocket structure formed by a-helices 2-5 of the anti-apoptosis proteins, such as Bcl-2 protein.
[0514] The principles of BH3 -mimetics are mechanistically founded on disrupting the interaction of the pro-apoptotic BH3 domain with the hydrophobic pocket of the anti- apoptotic Bcl-2 proteins (such as Bcl-2, Bcl-xL or Mell), thus permitting oligomerized BAX (or BAK) to form the MCP, thereby leading to apoptosis. To name but few, BH-3 mimetic compounds applicable in the present disclosure, specifically for the kits and combined compositions, include, but are not limited to ABT- 199, ABT-263 (Navitoclax), WEHI-539, BXI-61, BXI-72, GX15-070 (Obatoclax), si, JY-1-106, Apogossypolone (ApoG2), BI97C1 (sabutoclax), TW-37, MIMI, MSI (MCL-specific peptide), BH3I-1 and its structural derivatives, UMI-77, Marinopyrrole A (Martioclax). ABT-199 (also known as Venetoclax, RG7601, CDC-0199), was developed through rational design approaches as a high-affinity antagonist for Bcl-2 and much lower affinity binding for Bcl-xL, to help overcome thrombocytopenia side effects derived from off- target Bcl-xL inhibition, and a common feature associated with ABT-737 and Navitoclax treatments. As used herein, ABT-199, is denoted by the following formula:
[0515] The invention further provides a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof, said method comprises administering to said subject a therapeutically effective amount of at least one ARTS mimetic compound as defined by the invention, specifically, the B3 compound, and of at least one BH3 mimetic compound, or of any composition comprising said BH3 mimetic compound and said ARTS mimetic compound. In more specific embodiments, the BH3 mimetic compound is 4-[4-[[2-(4- Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l-yl]methyl]-l-piperazinyl]-A-[[3-nitro-4- [[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
[0516] A further aspect of the invention relates to a kit comprising: (a) at least one ARTS mimetic compound as defined by the invention, specifically, the B3 compound; and (b) at least one BH3 mimetic compound. More specifically, the BH3 mimetic compound used for the kit of the invention is 4-[4-[[2-(4-Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l- yl] methyl] - 1 -piperazinyl] -N- [ [3 -nitro-4-[ [(tetrahydro-2H-pyran-4- yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3-b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof. ABT-199 (venetoclax, RG7601, GDC-0199) represents the first-in-class, selective, oral BCL-2 inhibitor sparing platelets. It showed sub-nanomolar affinity to BCL-2 (K i < 0.010 nM) with antitumor activity against nonHodgkin’s lymphoma (NHL), CLL, and acute leukemias in vitro. In vivo mouse xenograft studies showed activity against aggressive (Myc+) lymphomas as well as acute leukemia.
[0517] All scientific and technical terms used herein have meanings commonly used in the art unless otherwise specified. The definitions provided herein are to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
[0518] As used herein the term "about" refers to ± 10 % The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". The term "consisting essentially of' means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure. The term "about" as used herein indicates values that may deviate up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to 20% higher or lower than the value referred to, the deviation range including integer values, and, if applicable, non-integer values as well, constituting a continuous range. As used herein the term "about" refers to ± 10 %.
[0519] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". This term encompasses the terms "consisting of' and "consisting essentially of'. The phrase "consisting essentially of' means that the composition or method may include additional ingredients and / or steps, but only if the additional ingredients and / or steps do not materially alter the basic and novel characteristics of the claimed composition or method. Throughout this specification and the Examples and claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0520] It should be noted that various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging / ranges between" a first indicate number and a second indicate number and "ranging / ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals there between.
[0521] As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0522] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub combination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0523] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
[0524] Disclosed and described, it is to be understood that this invention is not limited to the particular examples, methods steps, and compositions disclosed herein as such methods steps and compositions may vary somewhat. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only and not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof. It must be noted that, as used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.
[0525] The following examples are representative of techniques employed by the inventors in carrying out aspects of the present invention. It should be appreciated that while these techniques are exemplary of preferred embodiments for the practice of the invention, those of skill in the art, in light of the present disclosure, will recognize that numerous modifications can be made without departing from the spirit and intended scope of the invention.
[0526] EXAMPLES:
[0527] Reagents and materials
[0528] Reagents
[0529] Caspase inhibitors, ARTS mimetic molecules and apoptosis inducers
[0530] The caspase inhibitor Q-VD-OPh was purchased from Biovision and resuspended in DMSO as per the manufacturer’s instructions.
[0531] The pan caspase inhibitor Z-VAD-FMK was purchased from Sigma Aldrich.
[0532] ARTS mimetics small molecules, specifically, B3 and all small molecules used for Figure 4 were purchased from eMolecules, suspended in DMSO and resuspended in PBS as per the manufacturer’s instructions.
[0533] The apoptotic induction was performed using 1.75pM STS for the indicated times (Alexis Biochemicals).
[0534] BH3 mimetic compound ABT-199, was purchased from Selleckchem cat #8048.
[0535] Antibodies
[0536] Antibodies specific for the various proteins were purchased from the indicated companies, and used as instructed.
[0537] More specifically, the following antibodies were used:
[0538] *monoclonal anti-ARTS antibody (Sigma, St. Louis); *antibodies specific for apoptotic proteins: Bcl2 (DBB DB-132); XIAP (Cat#610716, BD); Caspase-3 (Cat #9662, Cell Signaling), Anti-cleaved PARP (Cell signaling, Cat#5625).
[0539] Actin (Cat #69100, MP Biomedicals) and C-myc (Cell Signaling cat #9402) were also used.
[0540] Experimental procedures
[0541] Cell lines and culture in 2D
[0542] Human breast cancer cell lines MCF-10A (Ml) was received from Prof. Israel Vlodavsky (Technion, Israel), MCF10AT1K (M2) and MCF10ACAlh (M3) were received from Dr. Fred Miller (Barbara Ann Karmanos Cancer Institute). Ml and M2 cells were maintained in DMEM / F12 supplemented with 5% donor horse serum (DHS), 1% sodium pyrovate, 1% L-glutamine, 0.02 pg / ml epidermal growth factor (EGF; Peprotech), 0.01 mg / ml insulin (Sigma), 0.5 pg / ml hydrocortisone (Sigma), 0.1 pg / ml cholera toxin (Sigma) and 1% penicillin-streptomycin at 37°C, 5% CO2 incubator. M3 cells were maintained in DMEM / F12 supplemented with 5% DHS and 1% penicillin-streptomycin at 37°C and incubated in 5% CO2 incubator.
[0543] Cell Lines and Transfections
[0544] A-375, HeLa, SKMEL-5 cell lines and MEFs were grown in Dulbecco's modified Eagle's medium, supplemented with 10% fetal calf serum, penicillin (100 units / ml), streptomycin (100 pg / ml), and glutamine (2 mM) at 37 °C in 5% CO2 atmosphere.
[0545] Three-dimensional cell cultures
[0546] Cells were harvested from their growth plates using 0.25% trypsin EDTA. Collected cells were cultured in Cultrex® growth factor reduced Basement Membrane Extract (BME: Trevigen, Inc) as follows: An 8 chamber glass slide system (Lab -TEK® II, Naperville, IL) was coated with 60 pl BME [Barkan D. et al., Cancer Research (2008)] (protein concentration between 15 mg / ml; thickness-1- 2 mm). 5x103cells per well were resuspended in DMEM / F12 supplemented with 2.5% DHS and 2% BME and cultured on the coated slides. Slides were incubated at 37°C, 5% CO2 incubator. Cells were re-fed every 4 days. Cell morphology was monitored by light microscopy. Immunofluorescence images were captured by Nikon Al-R confocal laser scanning microscope (Haifa University, Haifa, Israel). Semi quantitative RT-PCR
[0547] RNA was extracted from cells using Total RNA Mini Kit (Bio-Rad) according to the manufacturer's instructions. Equal amounts of total RNA (1 pg) were used as template for first-strand synthesis with oligo dT primers (IIIgh Capacity RNA-to-cDNA Kit; Applied Biosystems) in 20 pl volume and the resulting first-strand cDNA was used for qPCR reactions. qPCR reaction
[0548] A reaction mixture containing 300 ng cDNA, 10 pl PCR Dream Taq Mix and 4 pl of 5 pM primers (F+R) was assayed in a Gradient Thermal Cycler PCR system (MJ MiniTM). The 20 pl reaction mixtures were heated to 95 °C for 3 minutes, and 36 PCR cycles were carried out as follows: Denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. The reaction was heated at 72°C for 10 minutes and subsequently cooled to 4°C indefinitely. Electrophoresis of the samples was carried out on a 1.5% agarose gel.
[0549] The following PCR primers were used: For ARTS:
[0550] Forward: 5'-GAGACGAGAGTGGCCTGAACCGA-3', as denoted by SEQ ID NO. 11; Reverse, 5'-AACAGGAACCTGTGACCACCTGC-3' as denoted by SEQ ID NO. 12;
[0551] For human GAPDH:
[0552] Forward, 5'-ATGGGGAAGGTGAAGGTCG-3', as denoted by SEQ ID NO. 13;
[0553] Reverse, 5'- GGGGTCATTGATGGCAACAATA -3', as denoted by SEQ ID NO. 14;
[0554] Transient Transfections of MCF-10 A cell lines
[0555] The cells were transfected with either 6-MycTag-ARTS in pCS2 or sport-ARTS in pCMV plasmid, that was produced in Sarit Larisch lab as described previously (Larisch & Yi .2000). For the transfection the Turbofect (Fermentas) was used with concentration of 0.1 pg / pl DNA for 6-MycTag-ARTS and sport-ARTS plasmid.
[0556] Western blot analysis
[0557] The cells were lysed in WCE (whole-cell extract) buffer [25mM Hepes, pH 7.7, 0.3M NaCl,1.5mM MgC12, 0.2mM EDTA, 0.1% Triton X-100, 10Opg / ml PMSF and protease inhibitor cocktail (Roche, 1: 100 dilution)]. 100 pg of total cell protein, measured with the Bio-Rad Protein Assay kit, were separated by SDS-PAGE (12%) followed by transfer for 2h on to a nitrocellulose membrane. The membrane was blocked with 5% (w / v) non-fat dried skimmed milk powder in PBS supplemented with 0.05% Tween20 (PBS-T) for 1 hour at room temperature (R.T). Membrane was then probed with primary antibody at 4°C overnight. Next, the membrane was incubated with the appropriate HRP-conjugated secondary antibody, for 1 hour at R.T. and washed 15 min x3 with PBS-T. WesternBright ECL (Advansta ) was added to the membrane for 2 min and analyzed using ImageQuant LAS-4000 analyzer (GE Healthcare Life Sciences) & “ImageQuant LAS-4000” software (GE Healthcare Life Sciences). Densitometry analysis was performed using ImageQuant total lab 7 (GE Healthcare Life Sciences), image analysis software.
[0558] Co- Immunoprecipitation
[0559] Protein extracts were prepared with lysis buffer containing 150 mM NaCl, 50 mM Tris- HC1 (pH 8), 1% NP-40, 0.5% deoxy cholate acid with protease inhibitors (mini complete, Roche). Protein levels were determined and equal amounts were used for each sample. Lysates were pre-cleared with 1 mg mouse IgG (Sigma) coupled with protein A / G sepharose mix (Amersham Biosciences). Complexes were incubated overnight at 4°C, followed by low-speed centrifugation. Supernatants were immunoprecipitated using 5 ml of monoclonal anti-Bcl-2 antibodies (BD) overnight. Protein A / G sepharose beads were added to immunoprecipitate complex for 4 hours, collected and washed four times with PBS and then responded and heated in Sample buffer x2 for 10 minutes.
[0560] Cell Lysates
[0561] In all of the experiments cell lysates were prepared from floating dead cells and adherent cells harvested together. 40 h after the transfection, the cells were treated with different reagents according to the indicated assay. The cells were harvested by scraping the plate, washed twice with ice-cold l x PBS, and lysed using radioimmune precipitation assay buffer (150 mM NaCl, 50 mM Tns-HCl (pH 8), 1% Nomdet P-40, 0.1% SDS, 0.5% sodium deoxycholate containing protease inhibitors) (mini complete, Roche Applied Science). The cells were allowed to remain on ice for 30 min followed by four cycles of freeze and thaw. The cell extract was centrifuged for 20 min at maximum speed (13,000 rpm) 4 °C, and the supernatant was collected. Protein concentration was determined using the BCA kit (Promega).
[0562] Immunofluorescence staining in 3D culture
[0563] The following two protocols were used for cells staining: a. Laminin5 immunofluorescence staining: was performed as described by Barkan et al. (2008). Briefly, cells cultured in 8 well chamber glass slides in 3D BME, as described above. The cultured cells were fixed and permebalized for 5 minutes with 4% Paraformaldehyde (PF A) containing 5% sucrose and 0.2% Triton X-100, and re-fixed for an additional 25 minutes with 4% PFA containing 5% sucrose. The cells were washed for 10 minutes with PBS and an additional 10 minutes with PBS containing 0.05% Tween 20 (Sigma). Fixed cells were blocked with 3% BSA in PBS for 1 hour and incubated overnight at 4°C with primary antibody (Rabbit polyclonal antibody to Laminin-5 (1:200)). The cells were washed three times with PBS for 15 minutes each, and incubated for 1 hour with rabbit conjugated to Alexa Fluor®647 (Invitrogen), washed as above and mounted with VECTASHIELD mounting medium with 4', 6-diamidino-2-phenylindole (DAPI). For F-actin staining cells were incubated over night with Alexa-Fluor®488 Phalloidin (1 :40) (Molecular Probes) washed three times with PBS for 15 minutes each, and mounted with VECTASHIELD mounting medium with DAPI. The slides were imaged using Nikon Al-R confocal laser scanning microscope (Haifa University, Haifa, Israel). b. cis- Golgi protein GM130 immunofluorescence staining,' was performed as a modification of Muthuswamy et al. (2001). Briefly, Ml and M2 cells grown in 3D culture, as described above, were fixed for 25 minutes at room temperature with 4% PFA containing 5% sucrose. Fixed structures were washed three times in PBS:Glycine (130 mM NaCl, 7 mM Na2HPO4, 3.5 mM NaH2PO4, 100 mM glycine) for 15 minutes each and permeabalized with 0.5% Triton X-100 in PBS for 5 minutes at room temperature and washed three times in IF buffer (130 mM NaCl, 7 mM Na2HPO4, 3.5 mM NaH2PO4, 7.7 mM NaN3, 0.1% BSA, 0.2% Triton X-100, 0.05% Tween 20) for 10 minutes each. The washed structures were blocked in IF buffer plus 10% donkey serum for 1 hour at room temperature. Primary antibody (GM 130; Abeam) was diluted in blocking buffer (1:500) and incubated overnight at 4°C with primary antibody. Unbound primary antibody was removed by washing three times in IF buffer for 20 minutes each. Donkey anti rabbit secondary antibodies coupled with Alexa Fluor®647 (Invitrogen) was diluted in IF buffer containing 10% donkey serum and incubated for 1 hour. Unbound secondary antibody was washed as described above. Sides were mounted with VECTASHIELD mounting medium with DAPI. The slides were imaged using Nikon Al-R confocal laser scanning microscope (Haifa University, Haifa, Israel). c. Immunofluorescence (IF) of A-375 cells
[0564] Cells were seeded in 24 well plates. Following apoptotic induction (ABT-199 / Bx), cells were fixed with 4% paraformaldehyde. Nuclei were stained with DAPI (157574, MP Biomedicals), mitochondria were visualized by MitoTracker (M-7512, Thermo Fisher Scientific), and immunofluorescence staining was performed with anti-Bcl-2 or anti- XIAP antibodies, followed by fluorescent-conjugated secondary antibody (Alexa fluor 488, Rhodomin RedX). Image analysis was carried out using a fluorescence microscope (Nikon 50i). 300 cells from each sample were analyzed for cellular localization of Bel -2 or XIAP. The co-localization Pearson’s coefficient was determined using ImageJ analyzing tool.
[0565] In situ cell death detection assay for apoptosis - TUNEL
[0566] The cells were cultured as described above in 8 well chamber glass slides, fixed according to Barkan's immunofluorescence staining protocol and incubated for 1 hour with a mixture of TUNEL reaction mix according to the manufacturer's protocol (In Situ Cell death Detection Kit,TMR Red; Roche, Cat #12-156-792-910) covered with aluminum foil and placed in the 37°C, 5% CO2 incubator. Following incubation, slides were washed three times with PBS for 5 minutes each, and mounted with VECTASHIELD mounting medium with DAPI. DAPI stain was used to assess total cell number. Ratio of TUNEL-positive cells out of total cells represented the ratio of apoptotic cells. The analysis was carried out using Nikon Al-R confocal laser scanning microscope (Haifa University, Haifa, Israel).
[0567] Proliferation assay
[0568] The CellTiter 96 AqueousOne Solution of cell proliferation assay kit (Promega) was added to the wells for 2 hours to measure cell proliferation according the manufacturer’s instructions. The absorbance was recorded at 490nm.
[0569] Viability assays (IC50 calculation) performed with B3 on different cancer cell lines
[0570] The assay was performed at six tenfold serial dilutions of the B3 compounds: 10mM (stock), ImM, 10OpM, 10pM, IpM and 0.1 pM. The screen was performed on 93 cancer cell lines and PBMC as normal cell control. The B3 compound was incubated with the cells for 72 hours. The following cancer cell lines were screened:
[0571] JAR, JEG3, SKMEL5, MDAMB435, SKMEL28, A375, A431,EJ28, UMUC3, 5637, T24, CLS439, J82, MDAMB468, MT3, MCF7, SKBR3, MDAMB231, HS578T, JIMT1, MDAMB436, BT20, HEK293, 7860, CAKI1, U031, ACHN, HT1080, DU145, 22RV1, PC3, MG63, SA0S2, U20S, MHHES1, RDES, RAMOS, MINO, SU- DHL- 6, K-562, WSU-NHL, L-363, HL-60, GRANTA-519, MV4-11, KASUMI-1, THP-1, SKHEP1, HEPG2, PLCPRF5, CALU6, NCIH82, NCIH460, IMR90, A549, NCIH358M, NCIH292, A204, TE671, HS729, RD, A673, SKNSH, SKNAS, SF295, SF268, SNB75, U87MG, MIAPACA2, PANC1005, PANCI, BXPC3, ASPC1, HELA, C33A, CASKI, A2780, 0VCAR3, 0VCAR4, IGR0V1, EF021, SK0V3, SKLMS1, LOVO, HCT15, SW620, DLD1, HT29, COLO205, HCT116, CAC02 and COLO678.
[0572] The Sulforhodamine B (SRB) assay was used as a screening method. Briefly, the method relies on the property of SRB, to bind stoichiometrically to proteins under mild acidic conditions and to be extracted under basic conditions. Thus, the amount of bound dye can be used as a proxy for cell mass, which can then be extrapolated to measure cell proliferation. The protocol can be divided into four main steps: preparation of treatment, incubation of cells with treatment of choice, cell fixation and SRB staining and absorbance measurement.
[0573] XTT
[0574] XTT Cell Proliferation Kit (Biological Industries cat#20-300-1000) were used according to the manufacturer’s instructions. Cells (50000 per well) were seeded into white 96-well plates Clear Flat Bottom TC-treated Culture Microplate (#353072) overnight. The next day the treatment was added with dilutions of drugs alone or in combination. Cell viability was assessed after 24 hours treatment using the following incubation at 37 °C with XTT or reagent for 2 h. The intensity of the color was measured using BioTeK EL1SA synergyHT microplate reader (450 nm excitation and 630 nm emission). We determined the cell viability by normalizing the results in the treated cells to cells treated with DMSO (fold change to DMSO). Bimolecular fluorescence complementation (BiFC)
[0575] The split-Venus BiFC system was used to evaluate close proximity indicating possible direct binding between pairs of proteins. The proteins were fused either to the N-terminal part of the Venus-YFP (yellow fluorescence protein) (VN) or the C-terminal part (VC). All Venus fragments were fused to the C-terminal sequences of these proteins. The Jun and Fos pair was used as a positive control (P.C.), and the Jun and FosdeltaZIP pair was used as a negative control (N.C.). A vector encoding dsRed was used as a transfection efficiency marker. Cells were seeded in 12 well plates overnight. Cells were then transfected with (Bcl-2-VC, ARTS-VN, XIAP-VN and XIAP-VC) for 24-36 hours. Cells were then treated with apoptotic inducing reagents for 24hrs.
[0576] MicroScaleThermophoresis (MST)
[0577] Microscale thermophoresis (MST) binding assays were performed by CreLux, a WuXi AppTech company in Germany, using recombinant ARTS, XIAP, Bcl-2 and cIAPl proteins. Specifically, for performing experiments with untagged XIAP, a fluorescent label (NT650) was covalently attached to the protein (Mai eimide coupling). The labelling was performed in a buffer containing 50mM HEPES pH 7.0, 150mM NaCl and 0.005% Tween-20.
[0578] Statistical analysis
[0579] Densitometry analyses of the western blot results were performed using Image Studio Lite graphic software. At least 300 cells were counted for each immunofluorescence sample. For analysis of the results from all the different methods, GraphPad Prism software was used on two-six biological repeats by One-Way ANOVA with Scheffe post- hoc test, Pearson correlation coefficient or Dunnette's multiple comparison test. P-values were considered statistically significant when p-value<0.05 (*), p-value <0.01 (**), p- value <0.001 (***).
[0580] EXAMPLE 1
[0581] Screening for ARTS mimetic small molecules
[0582] The inventors have previously shown that ARTS induces apoptosis by interaction of its unique C-terminal domain with distinct binding sequence within BIR3 / XIAP. In an attempt to screen for further small molecules for cancer therapy, an "in silico " screen was done by “BioSolvit” to look for ARTS mimetic small molecules that fit into ARTS binding site within the XIAP molecule. As illustrated by Figure 1, about 100 candidate molecules were revealed. Figures 2 and Figure 3 present the structure of one of the candidate molecules, B3 located within the binding site and the interactions of said candidate compound with residues Thr271, Thr274, Tyr277 and Gly293 of the BIR3 / XIAP.
[0583] The candidate molecules were next subjected to functional assays, examining their ability to induce apoptosis, thereby increasing cell death, in melanoma (A375) and leukemia (Jurkat) cell lines Figures 21A and 21B. Further, the expression of several apoptotic markers was examined in A375 human melanoma cells exposed to 20 pM of each of the candidate compounds. As shown in Figure 4, the B3 small molecule increased the cleavage of apoptotic markers Caspase 3 and PARP, as well of Caspase 9 (as disclosed in Example 4 below). In addition, B3 treatment clearly reduced the levels of the anti- apoptotic proteins XIAP and Bcl-2 in the melanoma cell lines. Similar results were also demonstrated for different time exposure (2-24 hrs) of the effective candidate B3 demonstrating reduction in anti-apoptotic markers in HeLa cells (derived from cervical cancer cells) exposed to 30pM of ARTS mimetic small molecule B3. It is also important to note that B3 promotes a specific degradation of XIAP, but does not affect cIAPl As indicated herein below in Example 4, the same apoptotic effect was observed in different cell lines from different origins.
[0584] Taken together, these findings indicate that B3 clearly antagonize anti-apoptotic proteins (e.g., Bcl-2 and XIAP), elevates pro-apoptotic proteins and thereby has an apparent pro- apoptotic effect on malignant and pre-malignant cells.
[0585] EXAMPLE 2 The ARTs mimetic small molecule B3 promotes apoptosis in premalignant cells
[0586] The effect of ARTS mimetic B3 molecule was examined in Breast Cancer model. To further characterize the apoptotic effect of the ARTS mimetic B3 molecule on premalignant cells, the 3D system has been used. More specifically, MCF10A (Ml) (normal breast cancer cells) and MCF10AT1K (M2) (premalignant breast cancer cell line) cells were cultured in the 3D system constituted from growth factor reduced basement membrane (BME), a model to study normal and aberrant morphogenesis of the mammary gland. As shown in Figure 5, M2 organoids at day 4 in the 3D BME system were either untreated or treated with increasing concentrations of B3 molecule for additional 7 days. B3 molecule was re-supplemented every 4 days. Light microscopy images indicate that B3 molecule induced cellular death depicted by blebbing of the cells and cell shrinkage in dose a dependent manner.
[0587] To further evaluate the pro-apoptotic effect of the ARTS mimetic B3 molecule, TUNEL assay has been used. More specifically, M2 cells were cultured in the 3D BME system and at day 4 the cells were either untreated or treated with B3 (40pM) molecule for 24h. Light microscopy images indicate that B3 molecule induced cellular death depicted by blebbing of the cells and cell shrinkage (Fig. 6A). Furthermore, B3 treated cells displayed a significant increase in the number of cells positive for TUNEL staining as shown in Figure 6B.
[0588] EXAMPLE 3
[0589] Viability assay performed with ARTS mimetic small molecule B3 on different cancer cell lines
[0590] To further establish the feasibility of using the B3 small molecule of the invention as a specific anti-cancerous compound, viability of variety of cancer cell lines exposed to the B3 compound of the invention was next evaluated. As demonstrated by Figures 7 and 8(1)- 8(II), IC50 of ARTS mimetic small molecule B3 was calculated following treatment of several cancer cell lines for 72hrs with B3 concentrations ranging from 10mM to 0.1 pM. Human peripheral blood mononuclear cells (PBMC) were used as normal cell control. As shown by figure 811, a wide variety of cancer cell lines appear to be sensitive to B3 small molecule. Most sensitive cell lins are disclosed in Figure 7. Specifically, cancer cells originating from placenta, skin, bladder, breast, kidney, bone and blood. However, human PBMC5 that serve as normal cell control, appear to be resistant to B3 small molecule. The inventors specifically show the selectivity of B3 in osteosarcoma cells (MG-63) as compared to normal cells (Peripheral blood mononuclear cells (PBMC), and further demonstrate its activity by showing a dose-dependent death of these cells in response to increasing doses of B3 (Fig. 15). These results clearly demonstrate the specificity and selectivity of the B3 compound of the invention to malignant and pre-malignant cells. Moreover, the results demonstrate the feasibility of using the ARTS mimetic molecule B3 as a specific potent inducer of apoptosis in malignant cells.
[0591] EXAMPLE 4
[0592] Combined treatment of ABT-199 with B3 rescues the effect of ABT-199 on resistant cancer cells and restores their sensitivity to this drug
[0593] Bcl-2 (B-cell lymphoma 2) protein functions as a potent inhibitor of apoptosis. Bcl-2 is highly expressed in many types of cancers. Therefore, Bcl-2 is a major target for developing anti-cancer drugs. Bcl-2 contains a BH3 binding domain which enables it to interact and neutralize other pro-apoptotic Bcl-2 family members resulting in inhibition of apoptosis. ABT-199 (Venclexta®) is a BH3 mimetic drug, approved by the FDA for treatment of CLL (Chronic Lymphocytic Leukemia) patients. ABT-199 acts by binding to Bcl-2 and neutralizing its anti-apoptotic effect, leading to death of the treated cancer cells. It is reported however, that patients treated with ABT-199 develop resistance to the drug by upregulating Bcl-2 and MCL-1 levels. As shown by Figure 4, the B3 small molecule clearly reduced the levels of the anti-apoptotic proteins XIAP, c-IAPl and Bcl- 2, while clear increase in c-PARP was observed. Therefore, the inventors next examined whether the B3 compound may restore the ABT-199 activity in resistant cells.
[0594] Cancer cell lines which are relatively resistant to ABT- 199 (A375 melanoma cells and CCRF-CEM, leukemia cells) apoptotic effect, were used. Treatment of A375 cells with ABT-199 resulted in increased levels of the anti-apoptotic protein Bcl-2. More specifically, as shown by the western blot of Figure 9A, A-375 melanoma cell line treated for 24hrs with different concentrations of ABT- 199 with and without the small molecule B3. ARTS levels were upregulated upon treatment with 5pM ABT-199 in addition to apoptotic markers, cleaved PARP and cleaved Caspase 3 (Figs 9B, 9C, respectively). The combined treatment with ABT- 199 and B3 increased the apoptotic effect, as ARTS was downregulated by B3. Figure 10A-10B and Figure 22 shows that BCL-2 levels in these cells were upregulated upon treatment with 10pM ABT- 199. The combined treatment of ABT- 199 with B3 decreased BCL-2 levels in both concentrations. Similarly, Analysis of CCRF-CEM (acute lymphoblastic leukemia) cell line treated for 24hrs with ABT- 199 with and without the small molecule A4 and B3, presented in Figure 11A-11B, shows that apoptotic marker proteins cleaved Caspase 3 are increased upon treatment with ABT-199 alone. Importantly, treatment of B3 alone is sufficient to induce apoptosis in these cells. A combination treatment of ABT-199 with B3 increased cCasp3 expression indicating elevated cells death levels with the combined treatment. Interestingly the effect of B3 on ABT-199 sensitive cells is different. Similar results with a clear dose response, are also shown by Figure 18D. Figure 23 compares the effect of several molecules on HL-60 leukemia cell line and CCRF-CEM cell line. While a combination treatment of ABT- 199 with B3 had a synergistic effect on cP ARP and cCasp3 levels in CCRF-CEM cell line (Fig. 23B), a milder effect was observed in HL-60 cell line (Fig. 23A). Experiment repeated twice.
[0595] The effect of ARTS expression on the B3 effect was next examined. Figure 12A-12F shows analysis of different cell lines with different amounts of endogenous ARTS protein treated for 24hrs with ABT- 199 with and without the small molecules A4 and B3. ARTS levels were upregulated upon treatment with ABT- 199 alone. Cells with low or no ARTS expression (Sept4 / ARTS KO MEFs, shARTS HeLa and A-375) show a better killing response to ABT-199 when compared to cells with high levels of endogenous ARTS (WT MEFs, WT HeLa). Combined treatment of ABT- 199 with B3 increased the killing effect in all the presented cell lines. Still further, as shown in Figure 13A-13E, analysis of A-375 Melanoma cell line treated for 2, 6 and 24hrs with ABT- 199 with and without the small molecule B3, showed that Bcl-2 levels were upregulated upon treatment with ABT-199 alone. Six hours of B3 treatment decreased Bcl-2 levels. The combined treatment of ABT- 199 with B3 decreased Bcl-2 and XIAP levels while cP ARP levels were greatly upregulated after 24hrs. Furthermore, the combined treatment of ABT-199 with increasing levels of B3, in A-375 cells, indicates that Caspas3 cleavage is maximal at 5uM ABT- 199 + 20uM B3 (Fig. 16A), and that cell death is maximal at 5uM ABT- 199 + 20uM B3 and the killing effect depends on B3 levels (Fig. 16B, 16C). Similar results are also shown by Fig. 17A, 17B
[0596] The inventors fuether showed that A-375 cells treated with 10pM or 20 pM ABT199 together with 20 pM B3 showed even better synergistic effect on apoptosis. Significant increase in cCaspase 3 and cP ARP levels, and decrease in Bcl2 and XIAP levels in comparison to untreated cells or cells treated with each compound separately (Figure 24A-24B). The same apoptotic effect was observed in different cell lines from different origins as shown in Figure 22 and Figure 25.
[0597] Next, cell death was measured by XTT assay. As shown by Figure 14, combined treatment of ABT+B3 increased cell death relative to ABT-199 alone in both A375 and MALME in melanoma cell lines.
[0598] Significantly, though treatment of B3 alone is sufficient to induce apoptosis in these cells, the combined treatment of ABT-199 with B3 significantly reduced both Bcl-2 and XIAP expression. This culminates in a substantial increase in the ABT-199 / B3 induced cancer cell death. Thus, the combined treatment of ABT-199 with B3 rescues the effect of ABT- 199 on these resistant cancer cells and restores their sensitivity to this drug. Furthermore, we show that B3 restores the sensitivity to ABT- 199 by promoting the degradation of Bcl-2 and XIAP. These results provide an alternative and complementary approach to treatment of cancers that developed resistance to BH3 mimetics. Example 5
[0599] B3 and ABT-399 promote the binding of XIAP to Bel -2
[0600] To further investigate the molecular mechanism that is activated when cells are treated with ABT-199 and B3, the investors determine the ability of B3 to directly bind to XIAP and Bcl-2 using nano-DSF method (Crelux) and MicroScaleThermophoresis (MST) respectively. Indeed, binding curves of B3 to XIAP and Bcl-2 suggest it binds with high affinity to both proteins (Fig. 18A.I, A.II) These results suggest that B3, like ARTS, acts as a scaffold bringing XIAP in-close proximity to Bcl-2 to enable its ubiquitylation and degradation by XIAP. To test this hypothesis, the investors performed co- immunoprecipitation assays using XIAP- and Bcl-2 -transfected cells that were treated with B3. The results indicate that B3 significantly increase complex formation between XIAP and Bcl-2 (Fig. 18B). Following, the investors determine interaction between the components of this complex in response to ABT- 199 using Bimolecular Fluorescence Complementation (BiFC) assay. Results show that binding of XIAP to Bcl-2 is increased following 24h treatment with 20pM B3 (Fig. 18C(I), Fig. 18C(II)). Importantly, results of the BiFC assay performed between ARTS and Bcl-2, demonstrate that ABT- 199 significantly increased the binding of ARTS to Bcl-2 just after 3 hours of treatment, while after 24 hours of treatment was not noticed (Fig. 19). Together, these results suggest that both ABT- 199 and B3 act similarly by inducing the binding of ARTS to Bcl- 2, thereby allowing formation of a ternary complex XIAP-ARTS-Bcl-2, which promotes the killing of cancer cells.
[0601] Without being bound by any theory, the investors propose a working model that summarizes the molecular mechanism by which ABT- 199 and B3 induce apoptosis through regulation of Bcl-2 levels (Fig. 20). According to this model, treatment with ABT-199 and with B3 upregulates ARTS, which promotes the formation of protein complex between Bcl-2 -ARTS and XIAP. This results in regulation of Bcl-2 levels. ABT-199-induced upregulation of ARTS promotes the degradation of XIAP, which can lead to elevated levels of Bcl-2 (Figure 20, left column). However, treatment with B3 (Figure 20, middle column) or the combined treatment (Figure 20, right column) lead to reduced levels of Bcl-2. It is possible that the elevated levels of endogenous ARTS seen in response to ABT- 199, promote a prominent auto-ubiquitylation and degradation of XIAP. Whereas binding of B3 to XIAP, when added alone or in combination with ABT- 199, leads to better activation of the E3 -ligase function of XIAP, perhaps through allosteric effect of B3 on XIAP. This leads to an enhanced degradation of Bcl-2, which results in a substantial increase in the apoptotic effect, especially when both compounds are used together (Fig. 20, right column).
Claims
CLAIMS:
1. An apoptosis related protein in the TGF-beta signaling pathway (ARTS) mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for inducing apoptosis in a cell, wherein formula (I) is:whereinRi, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1’ -R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1’ -R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more ofC1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
2. The compound or composition for use of claim 1, wherein L1 ’, L1 ”, L2’ and L2” are independently from each other selected from -(CH2)n-, C(=O), optionally -(CH2)n- substituted with -(CH2)m-OH and wherein n is an integer selected from 1, 2, or 3 and m is an integer selected from 1, 2 or 3.
3. The compound or composition for use of claim 1, wherein each one of R3’ Rs ”, R4’, R4” is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
4. The compound or composition for use of claim 1, having the general formula (II)wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
5. The compound or composition for use of claim 4, wherein L2’ is (CH2)n-, or C(=O), optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
6. The compound or composition for use of claim 4 or 5, having the general formula (lib):
7. The compound or composition for use of any one of claims 4 to 6, wherein R1 is Lr-R3’-Ll”-R3”.
8. The compound or composition for use of claim 7, wherein R1 is at least one of nt and R3’ is an optionally substituted(ii) L1’,L1’ and R3” are each absent and R3’ is:(iii) L1’ is absent R3’ is an optionally substituted phenyl, R3” is an optionally substituted:
9. The compound or composition for use of claim 1, having the general formula (Illa) or (IIIb):wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
10. The compound or composition for use of claim 1, having the general formula (inc), (Illd) or (nie):wherein L1” and R3” are each as defined above, wherein R is one or more of H, OH,CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
11. The compound or composition for use of claim 10, having the general formula (inc), or (Ille):wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1” is C(=O), wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
12. The compound or composition for use of claim 11, having the formula (3.1), (3.2), (3.3);Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;(S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);(R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
13. The compound or composition for use of any one of claims 1 to 12, wherein said ARTS mimetic compound leads to ubiquitin proteasome system (UPS) mediated degradation of at least one of B-cell lymphoma 2 (Bcl-2) and X-linked-Inhibitor of Apoptosis (XIAP) in a cell.
14. The compound or composition for use of any one of claims 1 to 13, wherein said ARTS mimetic compound leads to elevation in at least one of c-caspase and c-PARP levels in a cell.
15. The compound or composition for use of any one of claims 1 to 14, wherein said ARTS mimetic compound induces apoptosis in a premalignant and / or a malignant cell.
16. The compound or composition for use of claim 15, wherein said cell is at least one of an epithelial carcinoma cell, a melanoma cell, a sarcoma cell, and hematological cancer cell.
17. The compound or composition for use of any one of claims 1 to 16, wherein said cell is of a subject suffering from at least one proliferative disorder.
18. The compound or composition for use of any one of claims 1 to 17, wherein the method is for inducing apoptosis in at least one cell in a subject suffering from at least one pathologic disorder, and wherein the method comprising administering to said subject a therapeutically effective amount of said compound.
19. The compound or composition for use of any one of claims 1 to 18, for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathologic disorder in a subject in need thereof.
20. An ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, for use in a method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof, wherein formula (I) is:whereinRi, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1’ -R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4 -L2”-R4 ”;wherein R3’, Rs”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-,-S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
21. The compound or composition for use of claim 20, having the general formula (II)wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NIL, alkyl, alkylene, C1-Ci2alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
22. The compound or composition for use of any one of claims 20 to 21, having the general formula (IIIc), or (Ille):wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1 ” is C(=O), wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
23. The compound or composition for use of claim 22, having the formula (3.1), (3.2), (3.3);Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;(S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);(R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
24. The compound or composition for use of any one of claims 20 to 23, wherein said pathologic disorder is characterized by at least one of:(a) over expression of Bcl-2;(b) over expression of XIAP; and(c) low or no expression of ARTS.
25. The compound or composition for use of any one of claims 20 to 24, wherein said subject is a subject suffering from at least one proliferative disorder, optionally, said proliferative disorder is at least one of carcinoma, melanoma, sarcoma and / or at least one hematological disorder.
26. A method for inducing apoptosis in a cell, wherein said method comprises the step of contacting said cell with an effective amount of at least one ARTS mimetic compound, any combination thereof or any composition comprising the same, wherein said ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or microparticle comprising the same; wherein said Formula (I) is:whereinRi, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, Rf, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m- SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
27. The method of claim 26, wherein said ARTS mimetic compound is having the general formula (II)wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
28. The method of any one of claims 26 and 27, wherein said ARTS mimetic compound is having the general formula (IIIe), or(III e):wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1” is C(=O), wherein R is one or more of H,OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
29. The method according to claim 28, wherein said ARTS mimetic compound is having the formula (3.1), (3.2), (3.3);Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;(S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);(R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
30. The method of any one of claims 26 to 29, wherein said ARTS mimetic compound leads to at least one of UPS mediated degradation of at least one of Bcl-2 and XIAP and elevation in at least one of c-caspase and c-PARP levels.
31. The method of any one of claims 26 to 30, for inducing apoptosis in at least one of pre-malignant and malignant cell / s.
32. The method of claim 31, wherein said cell is at least one of an epithelial carcinoma cell, a sarcoma cell, a melanoma cell and hematological malignant cell.
33. The method of any one of claims 26 to 32, wherein said cell is characterized by at least one of:(a) over expression of Bcl-2;(b) over expression of XIAP; and(c) low or no expression of ARTS.
34. The method of any one of claims 26 to 33, for inducing apoptosis of at least one cell in a subject in need thereof, wherein contacting said cell with an effective amount ofat least one ARTS mimetic compound comprises administering to said subject an effective amount of said compound or of any composition thereof.
35. A method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a pathological disorder in a subject in need thereof, said method comprises administering to said subject a therapeutically effective amount of at least one ARTS mimetic compound or of a composition comprising the same, said ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same; wherein said Formula (I) is:whereinRi, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1’ -R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1’ -R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted;L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2-,-S-, -S-S-, -S-(CH2)n-, each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m- SH, -(CH2)m-NH2, -(CH2)m-halogen; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
36. The method of claim 35, wherein L1 ’, L1 ”, L2’ and L2” are independently from each other selected from -(CH2)n-, C(=O) optionally -(CH2)n- substituted with -(CH2)m- OH and wherein n is an integer selected from 1, 2, or 3 and m is an integer selected from 1, 2 or 3.
37. The method of claim 35, wherein each one of R3’ R4’ R4’, R4” is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
38. The method of claim 35, having the general formula (II)wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
39. The method of claim 38, wherein L2’ is (CH2)n-, or C(=O), optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH,-(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
40. The method of claim 38 or 39, having the general formula (lib):
41. The method of any one of claims 38 to 40, wherein R1 is L1’ -R3 ’ -L1’ ’ -R3 ’ ’ .
42. The method of claim 41, wherein R1 is at least one of nt and R3’ is an optionally substituted(ii) L1’,L1’ and R3” are each absent and R3’ is:(iii) L1’ is absent R3’ is an optionally substituted phenyl, R3” is an optionally substituted:
43. The method of claim 35, having the general formula (Illa) or(III b):wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene,C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
44. The method of claim 35, having the general formula (IIIc), (IIId) or (Ille):wherein L1” and R3” are each as defined above, wherein R is one or more of H, OH,CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
45. The method of claim 44, having the general formula (III c), or(III e):wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1” is C(=O), wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
46. The method of claim 45, having the formula (3.1), (3.2), (3.3);Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;(S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);(R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
47. The method of any one of claims 35 to 46, wherein said subject is suffering from a pathologic disorder characterized by at least one of:(a) over expression of Bcl-2;(b) over expression of XIAP; and(c) low or no expression of ARTS.
48. The method according to claim 47, wherein said subject is a subject suffering from at least one proliferative disorder.
49. The method of claim 48, wherein said subject is a subject suffering from at least one of carcinoma, melanoma, sarcoma and / or at least one hematological disorder.
50. An ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, or any composition thereof or any vehicle, matrix, nano- or micro-particle comprising the same, wherein formula (I) is:whereinRi, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, Rf, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5, each one of L1’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogen and m is an integer selected from 0, 1, 2, 3, 4, 5.
51. The compound or composition claim 50, wherein L1 ’, L1”, L2’ and L2” are independently from each other selected from -(CH2)n-, C(=O) optionally-(CH2)n- substituted with -(CH2)m-OH and wherein n is an integer selected from 1, 2, or 3 and m is an integer selected from 1, 2 or 3.
52. The compound or composition claim 50, wherein each one of RT RT’ Ri^ Ri’’ is absent or may be independently from each other an aromatic or a heteroaromatic ring, each is independently from each other optionally substituted with OH, alkyl, halogen, CF3, NO2, C(=O).
53. The compound or composition of claim 50, having the general formula (II)wherein R1 and L2’ is as defined above and wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
54. The compound or composition claim 53, L2’ is (CH2)n-, or C(=O), each optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m- OH, -(CH2)m-SH, -(CH2)m-NH2, or -(CH2)m-halogen, n is an integer selected from any one of 0, 1, 2, 3, 4, 5 and m is an integer selected from 0, 1, 2, 3, 4, 5.
55. The compound or composition of claim 53 or 54, having the general formula(lib):
56. The compound or composition of any one of claims 53 to 55, wherein R1 is Ll’- R3’-L1”-R3”.
57. The compound or composition of claim 56, wherein R1 is at least one of nt and FL,’ is an optionally substituted(ii) L1’, Ll ”and R3” are each absent and FL’ is:(iii) L1 ’is absent FL’ is an optionally substituted phenyl, FL” is an optionally substituted:
58. The compound or composition of claim 50, having the general formula (Illa) or (III b):wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
59. The compound or composition of claim 50, having the general formula (file), (IIId) or (IIIe):wherein L1” and R3” are each as defined above, wherein R is one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other and t is an integer selected from 1 to 5.
60. The compound or composition of claim 59, having the general formula (IIIe), or (life):wherein R3’ and R3” is each independently from the other, an optionally substituted aryl or an optionally substituted heteroaryl, and L1 ” is C(=O), wherein R is one or more substituents as defined above, being one or more of H, OH, CF3, halogen, C(=O), -COOH, -NH2, alkyl, alkylene, C1-C12 alkoxy, a ring system containing five to twelve atoms, C1-C5 carboxyl, halogen, independently selected from each other.
61. The compound or composition of claim 60, having the formula (3.1), (3.2), (3.3);Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;(S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);(R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide.
62. The compound or composition of any one of claims 50 to 61, wherein said ARTS mimetic compound leads to at least one of UPS mediated degradation of at least one of Bcl-2, XIAP, and / or elevation in at least one of c-caspase and c-PARP levels in a cell.
63. A combined composition comprising an effective amount of at least one ARTS mimetic compound and at least one and at least one B-cell lymphoma 2 (Bcl-2) Homology 3 (BH3) mimetic compound, wherein said ARTS mimetic compound is having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, and wherein formula (I) is:whereinRi, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of anyof these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, R4’, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 each one of L1 ’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogenand m is an integer selected from 0, 1, 2, 3, 4, 5.
64. The combined composition according to claim 63, wherein said at least one ARTS mimetic compound is as defined by any one of claims 50 to 62.
65. The combined composition according to any one of claims 63 to 64, wherein said BH3 mimetic compound is 4-[4-[[2-(4-Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l- yl] methyl] - 1 -piperazinyl] -N- [ [3 -nitro-4-[ [(tetrahydro-2H-pyran-4- yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3-b ]pyridin-5-yloxy)benzamide (ABT- 199), and any derivatives thereof.
66. A kit comprising:(a) at least one ARTS mimetic compound having the general formula (I) or a pharmaceutically acceptable salt, solvate, hydrate, any stereoisomer thereof or physiologically functional derivative thereof, and wherein formula (I) is:whereinRi, R2 are each, independently from each other, absent or alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is L1’-R3’-L1”-R3” and R2 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups; or R1 is alkyl, alkenyl, alkynyl, alkenylene, a ring system containing five to twelve atoms, or a substituted version of any of these groups and R2 is L2’-R4’-L2”-R4”; or R1 is L1’-R3’-L1”-R3” and R2 isL2’-R4’-L2”-R4”; wherein R3’, R3”, Rf, R4” is each independently from each other, absent or H, alkyl, alkylene, alkenyl, alkenylene, alkynyl, alkynylene, aryl, arylalkyl, heteroaryl, heterocycloalkyl, a ring system containing five to twelve atoms, each optionally substituted; L1’, L1 ”, L2’ and L2” is each independently from each other, absent or -(CH2)n, -NH-(CH2)n- ,C(=O), C(=O)-(CH2)n-, -O-, -SO2- -S-, -S-S-, -S-(CH2)n-; n is an integer selected from any one of 0, 1, 2, 3, 4, 5 each one of L1 ’, L1 ”, L2’ and L2” independently from each other, may be optionally substituted by one or more of C1-C5alkoxy, C1-C5 carboxylic acid, -(CH2)m-OH, -(CH2)m-SH, -(CH2)m-NH2, -(CH2)m- halogenand m is an integer selected from 0, 1, 2, 3, 4, 5; and (b) at least one BH3 mimetic compound.
67. The kit of claim 66, wherein said ARTS mimetic compound is as defined in any one of claims 50 to 62.
68. The kit of any one of claims 66 and 67, wherein said ARTS mimetic compound ishaving the formula (3.1), (3.2), (3.3);Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide;(S)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbonyl)phenyl)oxalamide (denoted herein as “B3”);(R)-Nl-(l-hydroxy-3-phenylpropan-2-yl)-N2-(4-(l-methyl-1H-imidazole-2- carbony l)pheny 1) oxalamide.
69. The kit of any one of claims 66 to 68, wherein said BH3 mimetic compound is 4- [4- [ [2-(4-Chlorophenyl)-4,4-dimethyl- 1 -cyclohexen- 1 -y 1] methyl] - 1 -piperaziny 1] -A-[ [3 - nitro-4-[[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
70. A method for inducing apoptosis in a cell comprising the step of contacting said cell with an effective amount of at least one ARTS mimetic compound as defined by any one of claims 50 to 62, and of at least one BH3 mimetic compound, with a combined composition as defined in any one of claims 63 to 64, or with a kit as defined in any one of claims 66 to 69.
71. The method of claim 70, wherein said BH3 mimetic compound is 4-[4-[[2-(4- Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l-yl]methyl]-l-piperazinyl]-A-[[3-nitro-4- [[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
72. A method for treating, preventing, inhibiting, reducing, eliminating, protecting or delaying the onset of a proliferative disorder in a subject in need thereof, said method comprises administering to said subject a therapeutically effective amount of at least oneARTS mimetic compound as defined by any one of claims 50 to 62, and of at least one BH3 mimetic compound, or of any composition or kit comprising said BH3 mimetic compound and said ARTS mimetic compound.
73. The method according to claim 72, wherein said BH3 mimetic compound is 4-[4- [[2-(4-Chlorophenyl)-4,4-dimethyl-l-cyclohexen-l-yl]methyl]-l-piperazinyl]-A-[[3- nitro-4-[[(tetrahydro-2H-pyran-4-yl)methyl]amino]phenyl]sulfonyl]-2-(1H-pyrrolo[2,3- b ]pyridin-5-yloxy)benzamide (ABT-199), and any derivatives thereof.
Citation Information
Patent Citations
C-TERMINAL MODIFIED OXAMYL DIPEPTIDES AS INHIBITORS OF THE ICE / ced-3 FAMILY OF CYSTEINE PROTEASES
WO2000001666A1
Diagnostic and treatment methods in subjects having or at risk of developing resistance to cancer therapy
WO2013192274A2
Apoptosis related protein in the TGF-beta signaling pathway (ARTS) and arts mimetic small molecule compounds for upregulating p53 level
WO2023166507A1
Arts mimetic componds and combinations thereof for treating high-risk neuroblastoma
WO2023175615A1