Chimeric antigen receptor T cell targeting human CDH3 and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a human CDH3-targeted chimeric antigen receptor T cell and application thereof. Aiming at the problem that the curative effect of an existing human CDH3-targeted chimeric antigen receptor T cell on treating CDH3 positive tumors needs to be improved, the method comprises the following steps: firstly, obtaining two specific antibodies capable of specifically recognizing and combining cell surface CDH3 antigens by utilizing a hybridoma screening technology, and preparing CAR-T cells by utilizing the antibodies; researches show that the CAR-T cell has good killing activity on CDH3 positive tumors and can be applied to immunotherapy of the CDH3 positive tumors. The invention develops a new CDH3 antibody, provides a new choice for CDH3 positive tumor immunotherapy, and has important significance.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a chimeric antigen receptor T cell that targets human CDH3 and its application. Background Technology

[0002] P-cadherin (Cadherin 3, CDH3) is a classic glycoprotein cadherin with a size of 118 kDa. It was first discovered in developing mouse embryos in 1986. It communicates with Ca2+. 2+ Cell adhesion is mediated by isomorphic interactions. The CDH3 protein contains 829 amino acids, including a signal peptide (1-24 AA), a propeptide (25-107 AA), and a mature CDH3 protein (108-829 AA). The mature CDH3 protein contains three different domains (extracellular domain, transmembrane domain, and intracellular domain), of which: (1) the extracellular domain (108-654 AA) consists of five repeating structures, EC1-EC5 from the apical end outwards, mediating Ca2+ adhesion between adjacent cells. 2+ (1) CDH3 protein-dependent cell-cell adhesion; (2) single transmembrane domain (655-677AA); (3) intracellular domain (678-829AA) mainly interact with catechol to mediate cell adhesion, and the amount of cadherin-catenin complexes formed affects the strength of CDH3 protein-mediated cell adhesion. Multiple studies have shown that CDH3 protein is abnormally overexpressed in various malignant tumors (lung cancer, breast cancer, gastric cancer, endometrial cancer, ovarian cancer, prostate cancer, pancreatic cancer, bladder cancer, head and neck squamous cell carcinoma, and colorectal cancer, etc.) and mediates the invasion and migration of tumor cells. Overexpression of CDH3 protein has a significant promoting effect on the occurrence and development of tumors, including but not limited to cell invasion, metastatic lesion formation, and activation of tumor stem cells. In addition, CDH3 protein expression is limited in normal tissues, and is only expressed in small amounts in squamous epithelial tissues such as placenta, ovary, bronchus, and esophagus. Therefore, the development of novel immunotherapies targeting CDH3 protein is of great significance for the treatment of CDH3-positive tumors.

[0003] Chimeric antigen receptor-T cells (CAR-T) are an emerging technology in tumor immunotherapy, achieving groundbreaking progress in anti-tumor research, particularly demonstrating excellent efficacy in the treatment of various hematologic malignancies. This has revolutionized the treatment of hematologic malignancies and effectively promoted the development of other immunotherapies. CAR-T utilizes genetic engineering technology to co-express a tumor antigen-binding domain and a co-stimulatory molecular domain on the surface of T cells. The antigen-binding domain on the T cell surface specifically recognizes tumor antigens and initiates downstream signaling pathways, leading to T cell activation, proliferation, and the release of cytokines such as perforin, granzyme, IL-2, IFN-γ, and TNF-α to kill tumor cells, thereby achieving the goal of eliminating tumor cells.

[0004] Currently, investigational drugs targeting CDH3 for cancer treatment include monoclonal antibodies, ADCs, bispecific antibodies, CAR-T therapy, and cancer vaccines, but their efficacy still needs improvement.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The technical problem to be solved by this invention is that the efficacy of existing chimeric antigen receptor T-cell therapy targeting human CDH3 still needs to be improved.

[0007] The technical solution of this invention to solve the above-mentioned technical problems is as follows: An antibody against human CDH3 is provided. The antibody comprises a light chain variable region containing LCDR1, LCDR2, and LCDR3, and a heavy chain variable region containing HCDR1, HCDR2, and HCDR3; the amino acid sequence of CDR1 in the light chain variable region is shown in SEQ ID NO:5, the amino acid sequence of CDR2 is shown in SEQ ID NO:6, and the amino acid sequence of CDR3 is shown in SEQ ID NO:7; the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO:1 or SEQ ID NO:9, the amino acid sequence of CDR2 is shown in SEQ ID NO:2 or SEQ ID NO:10, and the amino acid sequence of CDR3 is shown in SEQ ID NO:3 or SEQ ID NO:11.

[0008] Furthermore, in the aforementioned anti-human CDH3 antibody, the amino acid sequence of CDR1 in the light chain variable region is shown in SEQ ID NO:5, the amino acid sequence of CDR2 is shown in SEQ ID NO:6, and the amino acid sequence of CDR3 is shown in SEQ ID NO:7; the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO:1, the amino acid sequence of CDR2 is shown in SEQ ID NO:2, and the amino acid sequence of CDR3 is shown in SEQ ID NO:3; or the amino acid sequence of CDR1 in the light chain variable region is shown in SEQ ID NO:5, the amino acid sequence of CDR2 is shown in SEQ ID NO:6, and the amino acid sequence of CDR3 is shown in SEQ ID NO:7; the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO:9, the amino acid sequence of CDR2 is shown in SEQ ID NO:10, and the amino acid sequence of CDR3 is shown in SEQ ID NO:11.

[0009] Furthermore, in the above-mentioned anti-human CDH3 antibody, the amino acid sequence of the light chain variable region is shown in SEQ ID NO:8, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:4 or SEQ ID NO:12.

[0010] Among them, the anti-human CDH3 antibodies mentioned above are single-chain scFv antibodies, humanized antibodies, chimeric antibodies, or fully human antibodies.

[0011] The single-chain scFv antibody includes a light chain variable region as shown in SEQ ID NO:8, a heavy chain variable region as shown in SEQ ID NO:4, and a linker region; or a light chain variable region as shown in SEQ ID NO:8, a heavy chain variable region as shown in SEQ ID NO:12, and a linker region.

[0012] Furthermore, the amino acid sequence of the single-chain scFv antibody is shown in SEQ ID NO:13.

[0013] Furthermore, the humanized antibody includes a light chain variable region as shown in SEQ ID NO:16 and a heavy chain variable region as shown in SEQ ID NO:15; or a light chain variable region as shown in SEQ ID NO:16 and a heavy chain variable region as shown in SEQ ID NO:17.

[0014] Furthermore, the amino acid sequence of the humanized antibody is shown in SEQ ID NO:14.

[0015] Furthermore, the extracellular domain of the chimeric antigen receptor contains the aforementioned anti-CDH3 single-chain scFv antibody or humanized antibody.

[0016] Furthermore, the chimeric antigen receptor also includes a signal peptide, a hinge region, a transmembrane region, and a signal transduction domain.

[0017] Furthermore, the signal peptide includes the CD8α signal peptide; the hinge region includes the CD8α hinge region; the transmembrane region includes the CD28 transmembrane domain; and the signal transduction domain includes the CD3ζ or 4-1BB intracellular region.

[0018] The present invention also provides a CAR-T cell comprising the above-described chimeric antigen receptor.

[0019] Furthermore, the CAR-T cells include at least one of universal CAR-T cells and autologous CAR-T cells.

[0020] Furthermore, the present invention also provides an isolated polynucleotide encoding the aforementioned anti-human CDH3 antibody or chimeric antigen receptor.

[0021] Furthermore, the isolated polynucleotide sequences are shown in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23.

[0022] The present invention also provides a recombinant vector containing the above-isolated polynucleotides.

[0023] The present invention also provides a host cell containing the above-described recombinant vector.

[0024] The present invention also provides an immunoconjugate or pharmaceutical composition comprising the above-described anti-human CDH3 antibody or chimeric antigen receptor.

[0025] Furthermore, the present invention also provides the use of the above-mentioned anti-human CDH3 antibody, chimeric antigen receptor, CAR-T cell, isolated polynucleotide, recombinant vector, and host cell in the preparation of a drug for the prevention or treatment of tumors.

[0026] Preferably, the tumor is a CDH3-positive tumor.

[0027] Furthermore, the tumor includes at least one of non-small cell lung cancer, breast cancer, gastric cancer, ovarian cancer, pancreatic cancer, basal cell carcinoma and squamous cell carcinoma of the skin, bile duct cancer, colorectal cancer, bladder cancer, squamous cell carcinoma of the head and neck, squamous cell carcinoma of the cervix, or adenocarcinoma of the cervix.

[0028] The present invention has the following beneficial effects:

[0029] This invention screened for highly effective anti-CDH3 antibodies and used anti-CDH3 scFv antibodies as antigen-binding domains to prepare CAR-T cells. The prepared CAR-T cells have good anti-tumor activity and can be used to prepare drugs for the prevention or treatment of tumors such as non-small cell lung cancer, breast cancer, gastric cancer, ovarian cancer, pancreatic cancer, basal cell carcinoma and squamous cell carcinoma of the skin, cholangiocarcinoma, colorectal cancer, bladder cancer, squamous cell carcinoma of the head and neck, squamous cell carcinoma of the cervix, and adenocarcinoma of the cervix. It has a wide range of applications. Attached Figure Description

[0030] Figure 1 In this embodiment of the invention, SDS-PAGE is used to detect the expression of the extracellular domain of human CDH3 protein.

[0031] Figure 2 In this embodiment of the invention, SDS-PAGE is used to detect the expression and purification of anti-CDH3 chimeric antibodies; A: SDS-PAGE is used to detect the expression and purity of human-mouse chimeric antibodies 1B5 and 5D10; B: SDS-PAGE is used to detect the expression and purity of humanized chimeric antibodies h1B5 and h5D10.

[0032] Figure 3 In this embodiment of the invention, the binding specificity of anti-CDH3 chimeric antibodies 1B5 and 5D10 is analyzed using indirect ELISA.

[0033] Figure 4 In this embodiment of the invention, SDS-PAGE was used to detect the expression and purity of anti-CDH3 scFv antibodies 1B5-scFv, 5D10-scFv (A), and humanized h1B5-scFv (B).

[0034] Figure 5 In this embodiment of the invention, the affinity activity of anti-CDH3 antibody is analyzed using indirect ELISA; A: affinity activity of human-mouse chimeric antibodies 1B5, 5D10 and humanized chimeric antibodies h1B5 and h5D10; B: affinity activity of mouse 1B5-scFv, 5D10-scFv and humanized h1B5-scFv antibodies.

[0035] Figure 6 In this embodiment of the invention, flow cytometry was used to analyze the binding activity of anti-CDH3 antibodies 1B5 and 5D10 (human-mouse chimeric antibody), humanized chimeric antibody, 1B5-scFv, and h1B5-scFv to CDH3-positive cells.

[0036] Figure 7 This is a schematic diagram of the chimeric antigen receptor structure against CDH3 in an embodiment of the present invention.

[0037] Figure 8This is an example of detecting the expression efficiency of CAR on the surface of T cells in this invention.

[0038] Figure 9 This is an example of the in vitro killing efficiency test of CAR-T cells against CDH3-positive tumor cells in this invention. Detailed Implementation

[0039] This invention provides an antibody against human CDH3, the antibody comprising a light chain variable region containing LCDR1, LCDR2, and LCDR3 and a heavy chain variable region containing HCDR1, HCDR2, and HCDR3; the amino acid sequence of CDR1 in the light chain variable region is shown in SEQ ID NO:5, the amino acid sequence of CDR2 is shown in SEQ ID NO:6, and the amino acid sequence of CDR3 is shown in SEQ ID NO:7; the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO:1 or SEQ ID NO:9, the amino acid sequence of CDR2 is shown in SEQ ID NO:2 or SEQ ID NO:10, and the amino acid sequence of CDR3 is shown in SEQ ID NO:3 or SEQ ID NO:11.

[0040] Furthermore, in the aforementioned anti-human CDH3 antibody, the amino acid sequence of CDR1 in the light chain variable region is shown in SEQ ID NO:5, the amino acid sequence of CDR2 is shown in SEQ ID NO:6, and the amino acid sequence of CDR3 is shown in SEQ ID NO:7; the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO:1, the amino acid sequence of CDR2 is shown in SEQ ID NO:2, and the amino acid sequence of CDR3 is shown in SEQ ID NO:3; or the amino acid sequence of CDR1 in the light chain variable region is shown in SEQ ID NO:5, the amino acid sequence of CDR2 is shown in SEQ ID NO:6, and the amino acid sequence of CDR3 is shown in SEQ ID NO:7; the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO:9, the amino acid sequence of CDR2 is shown in SEQ ID NO:10, and the amino acid sequence of CDR3 is shown in SEQ ID NO:11.

[0041] The heavy chain variable region of the present invention is not limited to the amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:12. Any amino acid sequence that has at least 85%, 90%, or 95% identity with the amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:12 but retains specific binding affinity to CDH3 protein can constitute the heavy chain variable region of the antibody against human CDH3 of the present invention.

[0042] Similarly, the sequence of the light chain variable region described in this invention is not limited to the amino acid sequence shown in SEQ ID NO:8. Any amino acid sequence that has at least 85%, 90%, or 95% identity with the amino acid sequence shown in SEQ ID NO:8 but retains specific binding affinity to CDH3 protein can constitute the light chain variable region of the antibody against human CDH3 of this invention.

[0043] Furthermore, the present invention also includes the addition, deletion and / or substitution of one or more amino acids in the backbone regions FR1, FR2, FR3 and / or FR4 in the heavy chain variable region or the light chain variable region.

[0044] The anti-human CDH3 antibody of the present invention can be a single-chain scFv antibody, including a light chain variable region as shown in SEQ ID NO:8, a heavy chain variable region as shown in SEQ ID NO:4, and a linker region; or a light chain variable region as shown in SEQ ID NO:8, a heavy chain variable region as shown in SEQ ID NO:12, and a linker region.

[0045] Furthermore, the amino acid sequence of the single-chain scFv antibody is shown in SEQ ID NO:13.

[0046] The anti-human CDH3 antibody of the present invention can also be humanized. The humanized antibody includes a light chain variable region as shown in SEQ ID NO:16 and a heavy chain variable region as shown in SEQ ID NO:15; or a light chain variable region as shown in SEQ ID NO:16 and a heavy chain variable region as shown in SEQ ID NO:17.

[0047] Furthermore, the amino acid sequence of the humanized antibody is shown in SEQ ID NO:14.

[0048] The anti-human CDH3 antibody of the present invention can also be a chimeric antigen receptor, the extracellular domain of which includes the above-mentioned anti-human CDH3 antibody, and also includes a signal peptide, a hinge region, a transmembrane region and a signal transduction domain; the signal peptide includes the CD8α signal peptide; the hinge region includes the CD8α hinge region; the transmembrane region includes the CD28 transmembrane domain; the signal transduction domain includes the CD3ζ or 4-1BB intracellular region.

[0049] The "chimeric antibody" described in this invention is an antibody formed by fusing the variable region of a non-human antibody with the constant region or backbone region of a human antibody, in order to reduce the immune response induced by non-human antibodies.

[0050] The present invention provides a CAR-T cell comprising the chimeric antigen receptor described above.

[0051] Furthermore, the CAR-T cells include at least one of universal CAR-T cells and autologous CAR-T cells.

[0052] The antibody sequences are shown in Table 1 below:

[0053] Table 1 Antibody amino acid sequence

[0054]

[0055]

[0056]

[0057] Furthermore, the present invention also provides an isolated polynucleotide encoding the aforementioned antibody or chimeric antigen receptor.

[0058] Furthermore, the isolated polynucleotide sequences are shown in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23.

[0059] SEQ ID NO:18 encodes the VL nucleotide sequence of antibodies 1B5 and 5D10.

[0060] GACATTGTTCTCACCCAGTCTCCAGCACTCATGACTGCATCTCCAGGGGAGAAGGTCACCATCACCTGCAGTGTCAGCTCAAGTATAACTTCCAACAATTTATACTGGTACCAGCAGAAGTCAGAAACCTCCCCCAAACCCTGGATTTATGGCACGTCCAAC CTGGCTTCTGGAGTCCCTGTTCGCTTCAGTGGCAGTGGATCTGGGACCTCTTATTCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCACTTATTACTGTCAACAGTGGAGTAGTTTCCCACTAACGTTCGGAGGGGGGACCAAGCTGGAAATAAAG.

[0061] SEQ ID NO:19 encodes the VH nucleotide sequence of antibody 1B5.

[0062] GAGGTGCAGCTGCAGGAGTCTGGACCTGAGCTGGTGAAGCCTGGAACTTCAATGAAGATTTCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACACCATGAACTGGGTGAAACAGAGCCATGGAAAGAACCTTGAGTGGATTGGGCTTATTAATCCTTACACTGGTGATACTGCCTATAATCAGAACTTCAAGGGCAAGGCCACATTAACTGTAGACAAGTCATCCAGCACAGCCTACATGGAGCTCTTCAGTCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATCGGGTGGTGACGACGGTTACTATATTATGGACTACTGGGGTCAAGGGACCTCAGTCACCGTCTCCTCAG。

[0063] VH nucleotide sequence encoding antibody 5D10 of SEQ ID NO:20

[0064] GAGGTGCAGCTGCAGGAGTCTGGACCTGAGCTGGTGAAGCCTGGAACTTCAATGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGACTACACCATGAACTGGGTGAAGCAGAGCCATGGGAAGAACCTTGAGTGGATTGGACTTATTAATCCTTACAATGGTGGTACTACTTACAACCAGAAGTTCAAGGGCAAGGCCACATTAACTGTAGACAAGTCATCCAGCACAGCCTTCATGGAGTTTTTCAGTCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATCGGGATACGGTAGTAGGGGGGGTTACTACTTTGACTACTGGGGCCGAGGCACCACGCTCACAGTCTCCTCAG。

[0065] VH nucleotide sequence encoding humanized antibody h1B5 of SEQ ID NO:21

[0066] CAGGTGCAGCTGGTGCAGTCCGGACCCGAGCTGAAGAAGCCCGGCGCTTCCGTGAAGATCAGCTGCAAGGCCTCCGGCTACTCCTTTACAGGCTACACCATGAACTGGGTGAGACAGGCCCCTGGCAAGGGCCTGGAGTGGATGGGACTGATCAACCCCTACACCGGCGATACCGCCTACAACCAGAACTTCAAGGGCAGGGTGACCCTGACCGTGGACACATCCACATCCACCGCCTACATGGAGCTGAGCTCCCTGACCTCCGAGGACACAGCCGTGTACTACTGCGCCAGAAGCGGCGGCGATGACGGCTACTACATCATGGATTACTGGGGCCAGGGCACCCTGGTGACCGTGTCTTCC。

[0067] The VH nucleotide sequence encoding the humanized antibody h5D10 of SEQ ID NO:22

[0068] CAGGTGCAGCTGGTGGAGAGCGGACCCGAGGTGAAGAAGCCTGGCGCCTCCGTGAAGATCAGCTGCAAGGCCAGCGGCTACAGCTTCACCGACTACACCATGAACTGGGTGAGGCAGGCCCCCGGCAAGGGACTGGAATGGATGGGCCTGATCAATCCCTACAACGGCGGCACAACCTACAACCAGAAGTTCAAGGGCAGAGTGACACTGACCGTGGATAAGTCCACCAGCACCGCCTTTATGGAGCTGAGCAGCCTGACCAGCGAGGACACCGCCGTGTACTACTGCGCCAGGAGCGGCTACGGCAGCAGGGGAGGATACTACTTTGACTACTGGGGCCAGGGCACACTGGTGACCGTGAGCTCC。

[0069] The VL nucleotide sequence encoding the humanized antibodies h1B5 and h5D10 of SEQ ID NO:23

[0070] GACATCGTGCTGACACAGAGCCCTGCCACCCTGAGCGTGAGCCCTGGAGAGAAGGTGACAATCACCTGCTCCGTGAGCAGCAGCATCACATCCAACAATCTGTACTGGTATCAGCAGAAGCCTGGCCAGAGCCCCAGGCTGCTGATCTACGGCACCAGCAAC CTGGCCAGCGGCGTGCCTGACAGATTCTCCGGCAGCGGCTCCGGCACCGATTTTTCCCTGACCATCAGCTCCCTGGAGGCCGAGGACTTCGCCACCTACTGTCAGCAGTGGAGCTCCTTCCCTCTGACATTCGGCGGCGGCACAAAGGTGGAGATCAAG.

[0071] The present invention also provides a recombinant vector containing the above-isolated polynucleotides.

[0072] The recombinant vector is an expression vector or a cloning vector, preferably an expression vector. It can refer to any recombinant polynucleotide construct that can directly or indirectly (e.g., packaged as a virus) introduce the target DNA fragment into host cells for target gene expression via transformation, transfection, or transduction. One type of vector is a plasmid, a circular double-stranded DNA molecule, which can ligate the target DNA fragment into the plasmid circle. Another type of vector is a viral vector, which can ligate and package the target DNA fragment into a viral genome (e.g., adenovirus, adeno-associated virus, retrovirus, lentivirus, oncolytic virus). After entering the host cell, these vectors can express the target gene.

[0073] The present invention also provides a host cell containing the above-described recombinant vector.

[0074] This invention also provides a host cell containing the recombinant vector as described in any of the foregoing embodiments. Specifically, the host cell includes at least one of prokaryotic host cells, eukaryotic host cells, and bacteriophages. The prokaryotic host cell can be Escherichia coli, Streptomyces, or Bacillus subtilis, etc. The eukaryotic host cell can be 293 cells, 293T cells, 293FT cells, CHO cells, COS cells, Per6 cells, Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces hansenii, Candida albicans, some insect cells, and plant cells. 293 series cells, Per6 cells, and CHO cells are commonly used mammalian cells for the production of antibodies or recombinant proteins and are well known to those skilled in the art.

[0075] The present invention also provides an immunoconjugate or pharmaceutical composition comprising the above-described anti-CDH3 antibody or chimeric antigen receptor.

[0076] Furthermore, the immune conjugate also includes a therapeutic agent.

[0077] The therapeutic agents include at least one of the following: immune checkpoint-related agents, antibody-drug conjugates, bispecific (multispecific) antibodies, radionuclides, toxins, factors, kinase inhibitors, and cytotoxic agents.

[0078] The term "pharmaceutical composition" as used in this invention refers to a combination of at least one drug and optionally a pharmaceutically acceptable carrier or excipient, used together to achieve a specific purpose. In some embodiments, the pharmaceutical composition includes combinations that are separate in time and / or space, provided they can work together to achieve the objectives of this invention. Some pharmaceutical compositions enhance the biological efficacy of the invention or reduce drug side effects by combining several pharmaceutically acceptable ingredients or compounds (e.g., they can be used in combination with other antitumor drugs to enhance antitumor effects). Other pharmaceutical compositions aim to promote administration to the organism, facilitate the absorption of the active ingredient, enhance stability or targeting, prolong half-life, and thus better exert the biological efficacy of the invention.

[0079] Furthermore, the pharmaceutical composition includes at least one of a pharmaceutical excipient, a carrier, and a diluent.

[0080] Furthermore, the present invention also provides the use of the above-mentioned anti-CDH3 antibody, chimeric antigen receptor, CAR-T cells, isolated polynucleotides and host cells in the preparation of a drug for the prevention or treatment of tumors.

[0081] The “treatment” described in this invention includes curing, improving, reducing the patient’s condition or pathological characteristics, or inhibiting the deterioration of the condition.

[0082] Optionally, the product includes at least one of: immune cells, reagents, kits, drugs, and drug compositions.

[0083] Optionally, the tumor treatment product includes drugs that target CDH3 to treat or adjuvant the treatment of tumors;

[0084] Optionally, the tumor includes at least one of non-small cell lung cancer, breast cancer, gastric cancer, ovarian cancer, pancreatic cancer, basal cell carcinoma and squamous cell carcinoma of the skin, bile duct cancer, colorectal cancer, bladder cancer, squamous cell carcinoma of the head and neck, squamous cell carcinoma of the cervix, and adenocarcinoma of the cervix.

[0085] The present invention also provides a method for preparing an antibody, comprising: culturing host cells as described in the foregoing embodiments to obtain an antibody. Specifically, the present invention does not specifically limit the culture conditions of the host cells; culture conditions that enable the host cells to express and produce the antibody can be obtained based on conventional technical knowledge.

[0086] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0087] Example 1: Expression, purification, and construction of a stable cell line expressing human CDH3 antigen for recombinant CDH3 protein.

[0088] 1.1 Construction of CDH3 recombinant protein expression vector

[0089] Gene encoding human CDH3 (NCBI reference sequence number: NM_001793.4 The sample (HG10305-M) was purchased from Sinocare Biotechnology Co., Ltd. PCR amplification was performed, and the sample was ligated into the pcDNA3.1-His vector using homologous recombination. The resulting vector was transformed into DH5α competent cells, plated on ampicillin-resistant plates, and incubated overnight at 37°C. Single clones were picked and sequenced for identification. Successfully constructed clones were expanded and recombinant plasmids were extracted.

[0090] 1.2 Expression and purification of recombinant CDH3 protein

[0091] HEK293T cells were transiently transfected with the successfully constructed recombinant plasmid pcDNA3.1-CDH3-His containing the CDH3 extracellular region gene, and FreeStyle was used. TM After culturing in serum-free medium for 5-7 days, the culture supernatant was collected and purified by nickel column affinity chromatography to obtain the recombinant protein CDH3-His (e.g., Figure 1 (As shown).

[0092] 1.3 Construction of stable cell lines expressing human CDH3 antigen

[0093] The full-length gene encoding human CDH3 was constructed into the lentiviral vector pLenti-EGFP and co-transfected with the lentiviral packaging plasmids psPAX2 and pMD2.G into HEK293T cells. After 48 hours of transfection, the supernatant was collected, filtered through a 0.45 μm filter, and then used to infect HeLa cells. He1a cells that stably express CDH3, i.e., CDH3-HeLa cells, were obtained by flow cytometry sorting.

[0094] Example 2: Screening and preparation of anti-CDH3 monoclonal antibodies

[0095] 2.1 Mouse Immunization

[0096] Female BALB / c mice aged 6-8 weeks were immunized at a dose of 100 μg per mouse. For the first immunization, 100 μL of Freund's complete adjuvant (Sigma) was mixed with an equal volume of CDH3 recombinant protein, thoroughly emulsified, and then injected subcutaneously at multiple sites. Every 2 weeks, an equal volume of Freund's incomplete adjuvant was mixed with the recombinant protein, thoroughly emulsified, and then injected subcutaneously at multiple sites. Hybridoma fusion was performed when the antibody titer met the requirements.

[0097] 2.2 Cell fusion and screening of positive hybridoma cells

[0098] 2.2.1 Hybridoma cell fusion

[0099] After sterile dissection of mice, the spleen was removed, ground, and prepared into a cell suspension. The spleen cell suspension was then fused with mouse myeloma cells SP2 / 0 using PEG4000. The fused cells were cultured in HAT medium, and on day 10 post-fusion, the medium was partially replaced with fresh HT medium. Positive clones were screened using ELISA, immunofluorescence, and flow cytometry on days 11-15 post-fusion.

[0100] ELISA screening: CDH3 recombinant protein was coated onto 96-well microplates at 100 ng / well and incubated overnight at 4°C. The next day, the plates were blocked with 5% skim milk powder. 50 μL of hybridoma culture supernatant was used as the primary antibody, and HRP-labeled anti-mouse IgG antibody (1:5000) was used as the secondary antibody. After TMB color development, the reaction was terminated with 2M H2SO4. The OD450nm value was read, and positive clones were screened.

[0101] Immunofluorescence: CDH3-HeLa cells and wild-type HeLa cells were seeded in 96-well plates. The next day, the plates were blocked with 2% BSA, and 50 μL of hybridoma supernatant was added as the primary antibody. The plates were incubated at room temperature for 1 hour, washed three times with PBS, and Alexa Fluor 594-labeled Goat Anti-Mouse IgG (1:500) was used as the secondary antibody. The plates were incubated at room temperature for 1 hour, washed three times with PBS, and images were collected and analyzed using a fluorescence microscope to identify positive clones.

[0102] Flow cytometry: CDH3-HeLa cells and wild-type HeLa cells were collected, blocked with 2% BSA, resuspended in 50 μL of hybridoma supernatant, incubated at room temperature for 1 hour, washed 3 times with PBS, and incubated at room temperature for 1 hour with APC-labeled Goat Anti-Mouse IgG (1:500) (Cat#405308, BioLegend) as secondary antibody, washed 3 times with PBS, and positive clones were analyzed by flow cytometry.

[0103] 2.2.2 Subcloning to screen positive hybridoma cells

[0104] Based on the results of the ELISA, immunofluorescence, and flow cytometry experiments, positive candidate clones were subcloned 2-3 times to obtain monoclonal hybridoma cells, which were then cultured and total RNA was extracted.

[0105] 2.3 Antibody VH and VL gene amplification

[0106] First, total RNA was extracted from hybridoma cells according to the instructions (Cat#74134, QIAGEN). Then, cDNA was obtained by reverse transcription using RNA as a template using a reverse transcription kit (Cat#18080051, Invitrogen). Using cDNA as a template, the VH and VL genes were amplified using mouse antibody VH and VL amplification primers. The genes were then cloned into the pMD-19T vector, transformed into DH5α bacterial competent cells, and cultured overnight at 37°C. The next day, single clones were picked and sequenced, and the VH and VL sequences were obtained by alignment with the IgBlast database.

[0107] Example 3: Preparation of anti-CDH3 protein chimeric antibody

[0108] 3.1 Preparation of anti-CDH3 protein chimeric antibody

[0109] Using the plasmid containing the anti-CDH3 antibody gene from Example 2.3 as a template, the VH and VL genes were amplified and constructed into the eukaryotic expression vectors pcDNA3.1-hCH1-hCH2-hCH3 and pcDNA3.1-hCK, respectively, via homologous recombination. After sequencing confirmed, the plasmids were extracted and transfected into HEK293T cells at a mass ratio of 1:1. After 5 days of expression, the supernatant was collected and purified using Protein G packing material via affinity chromatography to obtain the recombinant antibody (e.g., ...). Figure 2 (As shown in A).

[0110] 3.2 Preparation of humanized chimeric antibody against CDH3 protein

[0111] The VH and VL amino acid sequences were humanized using the BioPhi antibody humanization design platform (https: / / biophi.dichlab.org / humanization / humanize / ). The humanized VH and VL nucleotide sequences were synthesized by Anhui General Biotechnology Co., Ltd. and inserted into the pcDNA3.1-hCH1-hCH2-hCH3 and pcDNA3.1-hCK vectors, respectively. Plasmids were extracted and transfected into HEK293T cells at a 1:1 mass ratio. After 5 days of expression, the supernatant was collected, and the recombinant antibody (e.g., VH and VL) was purified by affinity chromatography using Protein G packing material. Figure 2 (as shown in B).

[0112] Example 4: Specificity of anti-CDH3 antibody detected by indirect ELISA

[0113] The anti-CDH3 chimeric antibody, positive control antibody W3195-p1 (patent number: CN202280034772.X), and irrelevant control antibody (anti-BCMA antibody 388, patent number: CN202211168052.0) (1 μg / mL) prepared in Example 3 were co-incubated with CDH3-His recombinant protein and other irrelevant antigens (CD5-His, CD7-His, CD47-His, FLT3-His, VISTA-His, and CD117-His) coated on an ELISA plate (200 ng / well) at 37°C for 1 h. After washing three times with PBST, 100 μL of HRP-labeled Goat anti-human antibody (1:5000) was added to each well and incubated at 37°C for 1 h. After washing three times with PBST, the reaction was developed with TMB for 5 min and then terminated with 2M H2SO4. The absorbance at OD450 nm was read. The results are as follows: Figure 3 As shown, anti-CDH3 antibodies 1B5 and 5D10 can both bind to CDH3 protein and do not react with other unrelated antigens, indicating that the above antibodies have good specific binding activity to CDH3 protein.

[0114] Example 5: Preparation of anti-CDH3 protein scFv antibody

[0115] 5.1 Construction of scFv vector

[0116] The first round of PCR used plasmids containing the anti-CDH3 antibody gene from Examples 2.3 and 3.2 as templates to amplify the VH and VL genes, respectively. The PCR products were identified and separated by agarose gel electrophoresis, and the DNA was recovered by gel extraction. The second round of PCR used the recovered products from the first round as templates to amplify the complete scFv fragment (700bp) by overlap PCR. The fragment was then ligated into the pcDNA3.1-hFc vector, which had been digested with restriction endonucleases BamHI and EcoRI, using homologous recombination. The vector was transformed into DH5α competent cells, plated on ampicillin-resistant plates, and incubated overnight at 37°C. Single clones were picked and sequenced for identification. Plasmids were extracted from successfully constructed clones through amplification culture.

[0117] 5.2 Expression and purification of scFv-hFc antibody

[0118] The plasmid from Example 5.1 was transfected into HEK293T cells using PEI. After 5 days of expression, the supernatant was collected, and the recombinant antibody was obtained by affinity chromatography using Protein G packing material. Figure 4 (As shown).

[0119] Example 6: Indirect ELISA detection of anti-CDH3 antibody binding activity

[0120] CDH3-His recombinant protein was coated into 96-well microplates at a rate of 200 ng per well. The plates were blocked with 5% skim milk powder at 37°C for 1 h. After washing three times with PBST, 100 μL of different concentrations of (10) [a specific protein] was added to each well. 2 ~10 -2 The recombinant antibodies and positive control antibody W3195-p1 prepared in Examples 3 and 5 (nM) were incubated at 37°C for 1 h. After washing three times with PBST, 100 μL of HRP-labeled Goat anti-human antibody (1:5000) was added to each well and incubated at 37°C for 1 h. After washing three times with PBST, TMB was used for color development for 5 min, and the reaction was terminated with 2M H2SO4. The OD450 nm absorbance was read. The results are as follows: Figure 5 As shown, the anti-CDH3 human-mouse chimeric antibodies 1B5 and 5D10, humanized chimeric antibodies h1B5 and h5D10, mouse scFv antibody 1B5-scFv, humanized scFv antibody h1B5-scFv, and positive control antibody W3195-p1 prepared in this invention all exhibit good binding activity with CDH3 protein. Figure 5 A), but the murine scFv antibody 5D10-scFv showed no binding activity, and the negative control antibody also showed no binding activity. Figure 5 B).

[0121] Example 7: Flow cytometry detection of the binding of anti-CDH3 antibody to tumor cells

[0122] CDH3-positive head and neck squamous cell carcinoma cells (SCC-15, KYSE-150, FADU, SNU-899) and lung cancer cells (PC-9, NCI-H1975) were collected in flow cytometry tubes. After blocking with 2% BSA, the cells were resuspended in anti-CDH3 antibodies prepared in Examples 3 and 5 and irrelevant control antibody 388 (2 μg / mL), incubated at room temperature for 1 hour, washed three times with PBS, and incubated at room temperature for 1 hour with APC-labeled Goat Anti-Mouse IgG (1:500) (Cat#405308, BioLegend) as a secondary antibody, washed three times with PBS, and the specific binding was analyzed by flow cytometry. The results are as follows: Figure 6 As shown, the anti-CDH3 antibody prepared in this invention exhibits excellent binding activity with CDH3-positive tumor cells.

[0123] Example 8 Construction of chimeric antigen receptor (CAR) lentiviral vector

[0124] Using the anti-CDH3 scFv antibody and the positive control antibody W3195-p1-scFv plasmid of this invention as templates, the antibody gene targeting CDH3 was amplified and cloned into the lentiviral vector pSLCAR-BBz via homologous recombination to construct a second-generation CAR. This CAR mainly contains the following elements: CD8α signal peptide, antigen-binding domain (αCDH3-scFv), CD8α hinge region, CD28 transmembrane domain, 4-1BB intracellular signal transduction domain, and CD3ζ signal transduction domain. Figure 7 ).

[0125] Example 9: Detection of in vitro antitumor activity of CAR-T cells

[0126] 9.1 CAR-T cell preparation

[0127] Peripheral blood was collected from healthy donors, and lymphocytes were isolated. These cells were stimulated with CD3 / CD28 magnetic beads for 48 hours to activate and expand high-purity T cells. The CAR lentiviral plasmid constructed in this invention, along with packaging plasmids psPAX2 and pMD2.G, was co-transfected into HEK293T cells. After 48 hours, the culture supernatant was collected, filtered through a 0.45 μm filter, and concentrated by ultracentrifugation to obtain the CAR lentiviral. The obtained CAR lentiviral plasmid was then used to infect and stimulate activated T cells to prepare CAR-T cells. Results are as follows: Figure 8 As shown, the expression efficiencies of 388-CAR, W3195-p1-CAR, and h1B5-CAR in T cells were 66.05%, 60.94%, and 69.17%, respectively.

[0128] 9.2 Detection of CAR-T cell antitumor activity

[0129] The anti-tumor effect of CAR-T cells was detected by in vitro co-culture assay. Two × 10⁻⁶ CDH3-positive tumor cells carrying Luciferase in logarithmic growth phase were cultured together. 4 CAR-T cells were seeded in 96-well cell culture plates at an effector-to-target ratio of 10:1. After co-culturing for 24 hours, 3 μL of fluorescein potassium salt (15 mg / mL) was added to each well. After mixing and incubation for 5 minutes, the absorbance at OD562 nm was measured using a multi-functional microplate reader. The killing efficiency of CAR-T cells was calculated based on the absorbance values ​​of different treatment groups. The killing efficiency was calculated using the formula: Killing efficiency % = (1 - Fluorescence value of experimental group / Fluorescence value of negative control group) × 100%. The irrelevant control group was supplemented with 388-CAR-T cells targeting BCMA, and the positive control group was supplemented with W3195-p1-CAR-T cells targeting CDH3.

[0130] The results are as follows Figure 9As shown, the killing efficiencies of CDH3-targeting h1B5-CAR-T, W3195-p1-CAR-T, and the unrelated control BCMA-targeting 388-CAR-T against CDH3-positive cells were 72.55%–76.33%, 75.84%–80.00%, and -5.47%–3.57%, respectively, indicating that the CDH3-targeting CAR-T cells prepared in this invention have good specific killing activity against CDH3-positive tumor cells (P<0.0001).

[0131] This invention is not limited to the specific embodiments described above. Any modifications made by those skilled in the art based on the above concept without creative effort are within the scope of protection of this invention.

Claims

1. An antibody against human CDH3, characterized in that: The antibody comprises a light chain variable region containing LCDR1, LCDR2, and LCDR3 and a heavy chain variable region containing HCDR1, HCDR2, and HCDR3; the amino acid sequence of CDR1 in the light chain variable region is shown in SEQ ID NO:5, the amino acid sequence of CDR2 is shown in SEQ ID NO:6, and the amino acid sequence of CDR3 is shown in SEQ ID NO:7; the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO:1 or SEQ ID NO:9, the amino acid sequence of CDR2 is shown in SEQ ID NO:2 or SEQ ID NO:10, and the amino acid sequence of CDR3 is shown in SEQ ID NO:3 or SEQ ID NO:

11.

2. The antibody against human CDH3 according to claim 1, characterized in that: The amino acid sequences of CDR1 in the light chain variable region are shown in SEQ ID NO:5, CDR2 in SEQ ID NO:6, and CDR3 in SEQ ID NO:7; the amino acid sequences of CDR1 in the heavy chain variable region are shown in SEQ ID NO:1, CDR2 in SEQ ID NO:2, and CDR3 in SEQ ID NO:3; or the amino acid sequences of CDR1 in the light chain variable region are shown in SEQ ID NO:5, CDR2 in SEQ ID NO:6, and CDR3 in SEQ ID NO:7; the amino acid sequences of CDR1 in the heavy chain variable region are shown in SEQ ID NO:9, CDR2 in SEQ ID NO:10, and CDR3 in SEQ ID NO:

11.

3. The antibody against human CDH3 according to claim 1, characterized in that: The amino acid sequence of the light chain variable region is shown in SEQ ID NO:8, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:4 or SEQ ID NO:

12.

4. The antibody against human CDH3 according to any one of claims 1-3, characterized in that: The antibody against human CDH3 is a single-chain scFv antibody, a humanized antibody, a chimeric antibody, or a fully human antibody.

5. The antibody against human CDH3 according to claim 4, characterized in that: The single-chain scFv antibody includes a light chain variable region as shown in SEQ ID NO:8, a heavy chain variable region as shown in SEQ ID NO:4, and a linker region; or a light chain variable region as shown in SEQ ID NO:8, a heavy chain variable region as shown in SEQ ID NO:12, and a linker region; preferably, the amino acid sequence of the single-chain scFv antibody is shown in SEQ ID NO:

13.

6. The antibody against human CDH3 according to claim 4, characterized in that: The humanized antibody includes a light chain variable region as shown in SEQ ID NO:16 and a heavy chain variable region as shown in SEQ ID NO:15; or a light chain variable region as shown in SEQ ID NO:16 and a heavy chain variable region as shown in SEQ ID NO:17; preferably, the amino acid sequence of the humanized single-chain scFv antibody is shown in SEQ ID NO:

14.

7. A chimeric antigen receptor, characterized in that: The extracellular binding domain of the chimeric antigen receptor comprises the single-chain scFv antibody of claim 5 or the humanized antibody of claim 6.

8. A CAR-T cell, characterized in that: Including the chimeric antigen receptor as described in claim 7.

9. An immunoconjugate or pharmaceutical composition, characterized in that: Includes the antibody against human CDH3 as described in any one of claims 1-6 or the chimeric antigen receptor as described in claim 7.

10. Use of the antibody against human CDH3 according to any one of claims 1-6, the chimeric antigen receptor according to claim 7, or the CAR-T cell according to claim 8 in the preparation of a medicament for the prevention or treatment of tumors.

Images