HMGCR antigen gene, recombinant antigen gene, recombinant antigen, detection reagent, preparation method, detection method and application

Abstract

The invention discloses an HMGCR antigen gene, an HMGCR recombinant antigen gene, a recombinant antigen, a reagent for detecting an anti-HMGCR antibody as well as a preparation method, a detection method and application of the reagent, the HMGCR antigen gene is obtained by modifying a gene for coding HMGCR protein by adopting a codon optimization technology, and the HMGCR recombinant antigen gene is obtained by modifying the optimized HMGCR antigen gene. The nucleotide sequence of HMGCR is optimized by using a codon optimization tool, and the sequence after ATG is subjected to recombination transformation, so that the expression quantity of HMGCR protein is improved; through further recombination transformation, the expression quantity of the HMGCR antigen is further improved, and the expression level of protein can be greatly improved by applying the sequence which is easier to express. The kit can be used for detecting the anti-HMGCR antibody in human body fluid, the detection specificity and sensitivity are improved, and compared with WB, the kit has higher sensitivity and specificity, and the specificity and sensitivity reach 100%.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and particularly relates to an HMGCR antigen gene, an HMGCR recombinant antigen gene, a recombinant antigen, and a reagent for detecting anti-HMGCR antibodies, as well as their preparation methods, detection methods, and applications. Background Technology

[0002] Idiopathic inflammatory myopathies (IIMs) are a heterogeneous group of diseases. Based on differences in clinical and histopathological features, IIMs are classified into dermatomyositis (DM), antisynthetase syndrome (ASS), immune-mediated necrotizing myopathy (IMNM), inclusion body myositis (IBM), and overlap myositis (OM). Common characteristics of different types of myositis include proximal muscle weakness, elevated muscle enzymes, and different myositis-specific antibodies. Currently identified myositis-specific antibodies associated with immune-mediated necrotizing myopathy include SRP and HMGCR antibodies. Early identification of positive antibodies is crucial for accurate diagnosis, precise treatment, and improved prognosis in patients.

[0003] Researchers discovered a novel antibody in the serum of 16 patients with necrotizing myositis that recognizes proteins with relative molecular masses of 200 kDa and 100 kDa, naming it the anti-P200 / 100 antibody. Among these patients, 94% showed muscle biopsies of necrotizing myopathy. Other researchers confirmed that the antibody's target antigen is HMGCR (3-hydroxy-3-methyl-CoA reductase), a key rate-limiting enzyme in the cholesterol biosynthesis pathway with a relative molecular mass of 100 kDa. Proteins with a relative molecular mass of 200 kDa may be dimers of HMGCR. Furthermore, the antibody was found to recognize only the C-segment (340 aa-888 aa) of HMGCR, but not the N-terminus; the positivity rate of this antibody in myositis patients was approximately 6%.

[0004] Furthermore, studies have shown that HMGCR expression in muscles increases after taking statins. In animal experiments, analysis of rat muscle cells revealed that anti-HMGCR antibodies are involved in the activation of the p38 / MAPK cell pathway and play an important role in regulating muscle cell repair and differentiation. A recent study by Werner JL et al. found that the titer of anti-HMGCR antibodies in patients with inflammatory myopathy is correlated with serum creatine kinase levels and the severity of muscle weakness. After treatment, serum antibody titers and creatine kinase levels decreased significantly compared to before treatment, and muscle strength improved, suggesting that anti-HMGCR antibodies can be used as an indicator for monitoring disease activity.

[0005] The main methods for detecting autoantibodies in autoimmune diseases include enzyme-linked immunosorbent assay (ELISA), radioimmunoprecipitation, and immunoblotting. Most laboratories use the following methods for detecting HMGCR antibodies: (1) ELISA: Purchase purified HMGCR protein to coat an enzyme-labeled reaction plate, add the serum to be tested and incubate. Use enzyme-labeled anti-human immunoglobulin antibody to detect the antibody that binds to the antigen, and then use a suitable enzyme substrate for color development. ELISA provides a highly sensitive and rapid method for detecting autoantibodies, but there is currently no commercially available ELISA kit for detecting HMGCR antibodies. This method requires highly purified antigen, and the antigen coating conditions need to be optimized. It has been reported that another myositis antibody, Cortactin, can also recognize HMGCR antigen, which leads to an increased false positive rate. Moreover, ELISA requires batch operation, which increases the cost for inflammatory myopathies with a low incidence rate; (2) Western Blot: Purchase purified HMGCR protein and perform immunoprecipitation with the serum to be tested, and use Western Blot to detect the product after precipitation. Purchasing purified HMGCR protein is expensive and not suitable for widespread use; (3) Radioimmunoassay: HeLa cells are labeled with S35, and then immunoprecipitation is performed with the serum to be tested. The precipitate is separated by SDS-PAGE electrophoresis and autoradiography. This is the gold standard for detecting MSA. As the gold standard, radiolabeled immunoprecipitation has high specificity and sensitivity. Moreover, this method precipitates antigens in their natural conformation and protein molecules that interact with the target antigen. However, radioisotopes can only be used in well-equipped laboratories and require strict control, so it is not suitable for widespread use.

[0006] Chinese patent document CN 112684172 A discloses a method for detecting immune-mediated necrotizing myopathy serum anti-HMGCR antibodies. This method first obtains the HMGCR gene and constructs a pSJMY-H-mCherry vector with red coral fluorescence properties using molecular biology methods and a recombinant fluorescent tag pSJMY-mCherry vector. This vector is then transiently transfected into HEK293T cells. The HMGCR protein antigen expressed in the transfected cells is then reacted with the test serum in an immunofluorescence assay. While this technique provides an indirect immunofluorescence detection method for anti-HMGCR antibodies in humans, its transfection efficiency and antigen expression level are not high, which may affect the sensitivity of subsequent detection.

[0007] Therefore, it is necessary to provide an HMGCR antigen gene, an HMGCR recombinant antigen gene, a recombinant antigen, and reagents for detecting anti-HMGCR antibodies, as well as their preparation methods, detection methods, and applications. By optimizing and modifying the antigen gene sequence, the expression level of HMGCR antigen is increased, the aggregation morphology and localization of the antigen are improved, and the sensitivity and specificity are further enhanced. Summary of the Invention

[0008] The first technical problem to be solved by the present invention is to provide an HMGCR (anti-3-hydroxy-3-methyl-coenzyme A reductase) antigen gene, and to optimize the HMGCR antigen gene to increase the expression level of HMGCR protein.

[0009] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: the HMGCR antigen gene is a gene encoding HMGCR protein modified by codon optimization technology, and the optimized nucleotide sequence is shown in SEQ ID NO.2; wherein, the nucleotide sequence of the gene encoding HMGCR protein is shown in SEQ ID NO.1.

[0010] Using the above technical solution, the nucleotide sequence of HMGCR is optimized using codon optimization tools, thereby increasing the expression level of HMGCR protein. The full-length human HMGCR sequence is preferred, as extensive experiments have confirmed that the detection sensitivity of the HMGCR-C-terminal sequence as an antigen is lower than that of the full-length sequence.

[0011] The second technical problem to be solved by the present invention is to provide an HMGCR recombinant antigen gene. Modifying the optimized HMGCR antigen gene not only increases the expression level of HMGCR antigen, but also greatly improves the protein expression level by using the more easily expressed sequence.

[0012] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: the HMGCR recombinant antigen gene is the nucleotide sequence of the gene encoding and recombining optimized HMGCR protein, that is, the nucleotide sequence of the optimized HMGCR protein gene is fused and recombined with the Kozak sequence and the IgK signal peptide nucleotide sequence to obtain the nucleotide sequence shown in SEQ ID NO.3; the Kozak sequence is shown in SEQ ID NO.5; and the IgK signal peptide nucleotide sequence is shown in SEQ ID NO.6.

[0013] Using the above technical solution, both the nucleotide sequences before and after ATG affect the transcriptional expression of the protein. Therefore, this modification increases the expression level of HMGCR antigen. The IgK signal peptide guides the overexpressed HMGCR antigen toward the cell membrane aggregates, rather than being specifically located on the Golgi membrane in its original state. This improves the aggregation morphology and localization of the antigen, thereby making it possible to greatly increase the protein expression level by using this more easily expressed sequence; at the same time, it further improves sensitivity and specificity.

[0014] Preferably, the fusion recombination is obtained by adding the Kozak sequence before the ATG codon and the IgK signal peptide nucleotide sequence after the ATG codon in the nucleotide sequence of the optimized HMGCR protein gene, followed by fusion expression.

[0015] Preferably, the nucleotide sequence obtained by recombining and optimizing the C segment (340aa-888aa) of the gene encoding the HMGCR protein is shown in SEQ ID NO.4. Specifically, the C segment of the optimized HMGCR protein gene nucleotide sequence is fused and recombined with the Kozak sequence and the IgK signal peptide nucleotide sequence to obtain the nucleotide sequence shown in SEQ ID NO.4.

[0016] The third technical problem to be solved by the present invention is to provide an HMGCR recombinant antigen, which is obtained by expressing the optimized HMGCR antigen gene, making it convenient for subsequent use, while avoiding the influence of EGFP fusion expression on the HMGCR conformation.

[0017] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: the HMGCR recombinant antigen is a product in which the HMGCR recombinant antigen gene is expressed on a recombinant vector, that is, using the pIRES2-EGFP series vector and the IRES element, so that the HMGCR recombinant antigen gene and the EGFP fluorescent tag are expressed simultaneously and independently in the host cell.

[0018] Preferably, the host cell is HEK293T cell; the HMGCR recombinant antigen gene is transfected into the host cell using a transfection reagent for expression, and then the recombinant antigen is obtained after culture. The transfection reagents used are Lipo3000, Lipo2000, and PEI. The EGFP may also include avGFP, mEGFP, turoGFP, etc. The host cell is HEK293T cell, preferably a mammalian cell, and more preferably an immortalized human cell.

[0019] The fourth technical problem to be solved by the present invention is to provide a detection reagent for detecting anti-HMGCR antibodies, which contains the HMGCR recombinant antigen, is used to detect anti-HMGCR antibodies, and has excellent detection sensitivity and specificity, especially for detection in the low titer range, which can ensure the accuracy of detection.

[0020] The fifth technical problem to be solved by this invention is to provide a method for preparing a detection reagent for detecting anti-HMGCR antibodies, comprising the following steps: S1: Construct a recombinant vector for the HMGCR recombinant antigen and obtain a recombinant plasmid through the recombinant vector; wherein, the gene encoding the HMGCR protein has the nucleotide sequence shown in SEQ ID NO.1; the gene encoding the optimized HMGCR protein has the nucleotide sequence shown in SEQ ID NO.2; and the gene encoding and recombining the optimized HMGCR protein has the nucleotide sequence shown in SEQ ID NO.3. S2: The recombinant plasmid obtained in step S1 is cultured and then transfected into host cells to obtain recombinant cells; S3: The recombinant cells from step S2 are sequentially fixed, washed, and sealed to prepare a recombinant cell matrix plate, which is the detection reagent for detecting anti-HMGCR antibodies.

[0021] Using the above technical solution, the nucleotide sequences before and after ATG in the HMGCR recombinant protein are optimized to construct a recombinant vector; the recombinant plasmid is transfected into cells to overexpress the target antigen in the cells; the recombinant cells carrying the recombinant plasmid are prepared into a recombinant cell matrix plate, which is the reagent for detecting anti-HMGCR antibody. The recombinant cell matrix plate can be used to detect HMGCR antibody with excellent detection sensitivity and specificity, especially for detection in the low titer range, which can ensure the accuracy of detection.

[0022] Preferably, the specific steps of culturing in step S2 are as follows: HEK293T cells carrying the recombinant plasmid are added to a 96-well cell culture plate coated with poly-L-lysine and then cultured. Diagnostically useful carriers are intended for use in microimmunofluorescence analysis. Such carriers can be cell culture plates, slides, or glass slides. The carriers can contain simulated transfected cells that have been transfected with the same vector as cells overexpressing the self-antigen of interest, but without encoding the latter's nucleic acid.

[0023] Preferably, the cell fixation in step S3 is performed using a fixation reagent when the confluence of HEK293T cells carrying the recombinant plasmid is 80%–90%. Even when using fixed eukaryotic cells, fixation is performed using a fixation reagent when the confluence of HEK293T recombinant cells carrying the recombinant plasmid is 80%–90%. As used herein, "fixed" cells refer to cells that have been treated with reactive compounds to render them metabolically inactive, but still exhibit their epitopes for immunostaining with antibodies and subsequent detection, such as by fluorescence. The purpose of fixation is to coagulate intracellular proteins, minimize or terminate reactions of exogenous and endogenous enzymes, prevent cell autolysis, and avoid the diffusion of antigens into the interstitial tissue; thus maintaining the inherent morphology, structure, and antigenicity of the cells. This also improves the stability of the reagent and extends its shelf life.

[0024] Preferably, the fixative is paraformaldehyde, formalin, glutaraldehyde, methanol, or acetone.

[0025] Preferably, a 4% paraformaldehyde fixative is used for fixation.

[0026] Preferably, the cell fixation time is 10–20 min.

[0027] Preferably, in step S3, a permeabilizing agent is used to permeate the cells. The permeabilizing agent can be Triton X-100, NP-40, saponins, Tween, etc. These can dissolve the phospholipid membrane, removing the barrier of the cell membrane to antibodies and antigens, allowing antibodies and antigens to fully contact, thereby improving detection efficiency.

[0028] Preferably, the cells are permeabilized using a PBS solution containing 0.1% Triton X-100.

[0029] Preferably, the blocking solution used in step S3 is a PBS solution containing 5% goat serum albumin and 5% goat serum, and an EDTA solution. The blocking step reduces the background signal generated when primary and secondary antibodies bind nonspecifically to non-target sites. This not only reduces background noise but also weakens stray band signals, eliminating nonspecific antibody binding and thus improving the accuracy and clarity of experimental results.

[0030] Preferably, the sealing time is 0.5 to 2 hours.

[0031] Preferably, in step S3, the reagent is preserved by adding a protective solution containing preservatives, anti-fluorescence quenching agents, and other components; specifically, it contains 0.02% Proclin 300 and 5% glycerol; the reagent is stored at 2~8℃.

[0032] The sixth technical problem to be solved by the present invention is to provide a detection reagent for detecting anti-HMGCR antibodies in body fluids.

[0033] The seventh technical problem to be solved by the present invention is to provide a kit for detecting anti-HMGCR antibodies, the kit comprising the detection reagents for detecting anti-HMGCR antibodies described above.

[0034] The eighth technical problem to be solved by the present invention is to provide a CBA detection method using the reagent for detecting anti-HMGCR antibody, wherein the CBA detection method includes primary antibody incubation and fluorescent secondary antibody incubation, and the specific steps are as follows: adding the sample to be tested to the reagent for detecting anti-HMGCR antibody and performing a first incubation; then adding fluorescent secondary antibody for a second incubation, washing, and then detecting using a fluorescence microscope to obtain the detection result and interpret the result.

[0035] Preferably, the primary antibody incubation is performed using diluted test serum at a temperature of 37°C for 30 minutes; the dilution is based on the sample diluent. The dilution method was used.

[0036] Preferably, the sample is selected from serum, plasma, or whole blood. It contains antibodies from a patient, and the sample is preferably serum; in a more preferred embodiment, the patient is a human patient.

[0037] Preferably, the fluorescent secondary antibody incubation involves incubating with Alex 594-labeled goat anti-human IgG at 37°C for 30 min in the dark. The incubation conditions are: incubation at 37°C for 30 min; and dilution based on the sample diluent. The dilution method was used.

[0038] Preferably, fluorescence microscopy analysis refers to the use of dual-fluorescence staining analysis. Extensive experimental verification has shown that the recombinant cells from this anti-HMGCR antibody matrix plate exhibit higher sensitivity and specificity compared to the BLOT method.

[0039] Compared with the prior art, the present invention has the following beneficial effects: (1) The HMGCR antigen gene was optimized to increase the expression level of the target protein; on this basis, it was modified to further greatly increase the expression level of the target protein and further improve the detection sensitivity of the reagent. (2) Using the full-length sequence of human HMGCR as the antigen for expression and detection, the detection difference between the HMGCR-C-terminus and the full-length HMGCR antigen was verified and compared, confirming the superiority of the full-length HMGCR in antigen selection; (3) The EGFP gene and the target gene are expressed simultaneously and independently. The IRES element is used to make the HMGCR target antigen and EGFP expressed simultaneously and independently, avoiding the influence of EGFP on the conformation of the target antigen protein. At the same time, it can also indicate the role of cells expressing the target antigen. Cells expressing the target antigen are also marked with green fluorescence. In the subsequent CBA detection, the dual fluorescence staining analysis method is used to further improve the specificity of the detection, thereby improving the accuracy of the detection. (4) This invention uses HEK293T cells with HMGCR as the detection matrix and optimizes the transfection process to detect anti-HMGCR antibodies in human body fluids, which improves the specificity and sensitivity of the detection. Compared with the immunoblotting method, it has higher sensitivity and specificity, with a specificity and sensitivity of 100%. Attached Figure Description

[0040] Figure 1 The double enzyme digestion verification results of the expression vector constructed for recombinant optimization of HMGCR; lane 1 shows the electrophoresis results of this expression vector; lane 2 shows the electrophoresis results after double digestion of this expression vector with Nhe I and BamH I; lane M is DNAMaker; Figure 2 The figures show the transfection efficiency before and after sequence optimization. Sequence recombination optimization significantly improved the transfection efficiency. A shows the transfection efficiency of the recombinant vector encoding the original nucleotide sequence of human HMGCR protein; B shows the transfection efficiency of the recombinant vector with the nucleotide sequence of human HMGCR optimized using codon optimization tools; C shows the transfection efficiency of the recombinant vector with the nucleotide sequence of human HMGCR after recombination optimization; and D shows the transfection efficiency of the recombinant vector with the nucleotide sequence of the HMGCR-C terminus (340 aa-888 aa) after recombination optimization. Figure 3The images show the detection results of the same positive sample on matrix plates prepared before and after sequence optimization. Sequence optimization significantly improved the signal intensity of the sample. AC represents the detection results of positive samples encoding the original nucleotide sequence of human HMGCR protein; where A is the microscopic examination result; B is the staining detection result of blood from healthy individuals; C is the image composite of A and B. DF represents the positive sample detection results of optimized human HMGCR protein; where D is the microscopic examination result; E is the staining detection result of blood from healthy individuals; F is the image composite of D and E. GI represents the positive sample detection results of recombinant optimized human HMGCR protein; where G is the microscopic examination result; H is the staining detection result of blood from healthy individuals; I is the image composite of G and H. Detailed Implementation

[0041] To enhance understanding of the present invention, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. These embodiments are only used to explain the invention and do not limit the scope of protection of the invention.

[0042] Example: The HMGCR antigen gene is obtained by modifying the gene encoding the HMGCR protein using codon optimization technology. The optimized nucleotide sequence is shown in SEQ ID NO.2; wherein, the nucleotide sequence of the gene encoding the HMGCR protein is shown in SEQ ID NO.1.

[0043] The HMGCR recombinant antigen gene is the nucleotide sequence of the gene encoding and recombining the optimized HMGCR protein. Specifically, the nucleotide sequence of the optimized HMGCR protein gene is fused and recombined with the Kozak sequence and the nucleotide sequence of the IgK signal peptide to obtain the nucleotide sequence shown in SEQ ID NO.3.

[0044] Based on this, the nucleotide sequence of the optimized HMGCR protein gene, specifically segment C (340aa-888aa), was further encoded and recombined to obtain the nucleotide sequence shown in SEQ ID NO.4. The optimized HMGCR protein gene's nucleotide sequence, segment C (340aa-888aa), was then fused and recombined with the Kozak sequence and the IgK signal peptide nucleotide sequence to obtain the nucleotide sequence shown in SEQ ID NO.4.

[0045] The aforementioned fusion recombinations were all obtained by adding the Kozak sequence before the ATG codon and the IgK signal peptide nucleotide sequence after the ATG codon in the optimized HMGCR protein gene nucleotide sequence, followed by fusion expression. The Kozak sequence is shown in SEQ ID NO.5; the nucleotide sequence of the IgK signal peptide is shown in SEQ ID NO.6.

[0046] The gene encoding the HMGCR protein has the nucleotide sequence shown in SEQ ID NO.1; SEQ ID NO.1 is: The gene encoding the HMGCR protein using codon optimization technology has the optimized nucleotide sequence shown in SEQ ID NO.2; SEQ ID NO.2 is: The nucleotide sequence of the recombinant antigen gene obtained from the gene encoding the recombinant optimized HMGCR protein is shown in SEQ ID NO. 3; SEQ ID NO.3 is: The nucleotide sequence of the optimized HMGCR, specifically segment C (340aa-888aa), is shown in SEQ ID NO.4. SEQ ID NO.4 is: SEQ ID NO.5 is: GCCACCATGG; SEQ ID NO.6 is: ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC; The HMGCR recombinant antigen is a product of simultaneous and independent expression of the HMGCR recombinant antigen gene in a host cell using a pIRES2-EGFP series vector and an IRES element. The host cell is HEK293T cell. The HMGCR recombinant antigen gene is transfected into the host cell using a transfection reagent for expression, and then cultured to obtain the recombinant antigen. The transfection reagents used are Lipo3000, Lipo2000, and PEI. The host cell is HEK293T cell, preferably mammalian, and more preferably immortalized human cells. The IRES element sequence is shown in SEQ ID NO.7; the EGFP fluorescent protein sequence is shown in SEQ ID NO.8. SEQ ID NO.7 is: CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC; SEQ ID NO.8 is as follows: ; The detection reagent for detecting anti-HMGCR antibodies contains the aforementioned HMGCR recombinant antigen and is used to detect anti-HMGCR antibodies. It has excellent detection sensitivity and specificity, especially for detection in the low titer range, ensuring detection accuracy.

[0047] The preparation method of the detection reagent for detecting anti-HMGCR antibodies includes the following steps: S1: Construct a recombinant vector for the HMGCR recombinant antigen, and obtain a recombinant plasmid through the recombinant vector; wherein, the gene encoding the HMGCR protein has the nucleotide sequence shown in SEQ ID NO.1; the gene encoding the optimized HMGCR protein has the nucleotide sequence shown in SEQ ID NO.2; and the gene encoding the recombinant optimized HMGCR protein has the nucleotide sequence shown in SEQ ID NO.3. S2: The recombinant plasmid obtained in step S1 is cultured and then transfected into host cells to obtain recombinant cells. The specific steps of culturing in step S2 are as follows: HEK293T cells carrying the recombinant plasmid are added to a 96-well cell culture plate coated with poly-L-lysine and then cultured. Diagnostically useful carriers are intended for use in microscopic immunofluorescence analysis. Such carriers can be cell culture plates, slides, or glass slides. The carriers can contain simulated transfected cells that have been transfected with the same vector as cells overexpressing the self-antigen of interest, but without encoding the latter's nucleic acids. S3: The recombinant cells from step S2 are sequentially fixed, washed, and sealed to prepare a recombinant cell matrix plate, which is the detection reagent for detecting anti-HMGCR antibodies; In step S3, cell fixation is performed using a fixation reagent when the confluence of HEK293 cells carrying the recombinant plasmid reaches 80%–90%. Specifically, fixed eukaryotic cells are used when the confluence of HEK293 recombinant cells carrying the recombinant plasmid reaches 80%–90%. As used in this invention, "fixed" cells refer to cells that have been treated with reactive compounds to render them metabolically inactive, but still exhibit their epitopes for immunostaining with antibodies and subsequent detection, such as by fluorescence. The purpose of fixation is to coagulate intracellular proteins, minimize or terminate reactions of exogenous and endogenous enzymes, prevent cell autolysis, and avoid antigen diffusion into the interstitial tissue; thus maintaining the inherent morphology, structure, and antigenicity of the cells. This also improves the stability of the reagents and extends the storage period. The fixation reagents include paraformaldehyde, formalin, glutaraldehyde, methanol, and acetone; the cell fixation time is 10–20 minutes. In step S3, a permeabilizing agent is used to permeate the cells. Suitable permeabilizing agents include Triton X-100, NP-40, saponins, and Tween. The blocking solution used in step S3 is a PBS solution containing 5% goat serum albumin and 5% goat serum, along with EDTA solution. The blocking step reduces the background signal generated when primary and secondary antibodies bind nonspecifically to non-target sites. This not only reduces background noise but also weakens stray band signals, eliminating nonspecific antibody binding and thus improving the accuracy and clarity of experimental results. The blocking time is 0.5–2 hours. In step S3, the reagent is preserved by adding a protective solution containing preservatives, anti-fluorescence quenching agents, and other components; specifically, it contains 0.02% Proclin 300 and 5% glycerin; the reagent is stored at 2~8℃.

[0048] In this embodiment, a 4% paraformaldehyde fixative is preferably used for fixation; In this embodiment, it is preferred to use 0.1% Triton X-100 PBS solution to permeabilize the cells.

[0049] The sixth technical problem to be solved by the present invention is to provide a detection reagent for detecting anti-HMGCR antibodies in body fluids.

[0050] The kit for detecting anti-HMGCR antibodies includes the detection reagents for detecting anti-HMGCR antibodies.

[0051] The CBA detection method using the reagent for detecting anti-HMGCR antibodies includes primary antibody incubation and fluorescent secondary antibody incubation. The specific steps are as follows: The sample to be tested is added to the reagent for detecting anti-HMGCR antibodies for a first incubation; then, fluorescent secondary antibody is added for a second incubation. After washing, detection is performed using a fluorescence microscope to obtain and interpret the results; the fluorescence microscopy analysis refers to the use of dual-fluorescence staining analysis. The primary antibody incubation involves incubating with diluted test serum at a temperature of 37°C for 30 minutes. The dilution is based on the sample dilution buffer. The dilution method was used. The fluorescent secondary antibody incubation was performed using Alex 594-labeled goat anti-human IgG, incubated at 37°C for 30 min in the dark. The incubation conditions were: in the dark; incubation temperature: 37°C; incubation time: 30 min; and dilution was based on the sample diluent. The dilution method was used.

[0052] In this embodiment, the sample is selected from serum, plasma, or whole blood. It contains antibodies from a patient, and the sample is preferably serum; in a more preferred embodiment, the patient is a human patient.

[0053] Specific Example 1: The construction of this recombinant cell, the specific steps are as follows: Construction of the S11 recombinant vector: (1) Optimization and design of the nucleotide sequence encoding the protein: The original nucleotide sequence of the gene encoding the human HMGCR protein is shown in SEQ ID NO.1; the nucleotide sequence of the human HMGCR was optimized using a codon optimization tool, and the optimized nucleotide sequence is shown in SEQ ID NO.2; a Kozak sequence was added before the ATG codon of HMGCR, and an IgK signal peptide nucleotide sequence was added after the ATG, so that it was fused with HMGCR for expression, and the recombinant optimized nucleotide sequence is shown in SEQ ID NO.3; based on the above, the nucleotide sequence encoding and recombinant optimized HMGCR C segment (340aa-888aa) is shown in SEQ ID NO.4; (2) The above nucleotide sequences were artificially synthesized, and the corresponding HMGCR nucleotide sequences were constructed into the pIRES2-EGFP vector by using the double enzyme digestion method, selecting the two enzyme digestion sites Nhe Ⅰ and BamH Ⅰ, and co-expressed with EGFP. (3) The recombinant optimized HMGCR expression vector was constructed and then verified by double enzyme digestion. The results are as follows: Figure 1 As shown, lane 1 is the electrophoresis result of the expression vector; lane 2 is the electrophoresis result after double digestion of the expression vector with Nhe I and BamH I. The larger band of 5000+ bp is the digested pIRES2-EGFP backbone vector, and the smaller band of 2000+ bp is the inserted recombinant optimized HMGCR fragment, which verifies the normal ligation of the target sequence. (4) After the constructed recombinant vector is correctly sequenced, it is extracted and ready for use; Preparation of S12 recombinant cells: (1) HEK-293T cell culture: DMEM high glucose medium and FBS were mixed at a ratio of 9:1 to prepare 10% FBS-DMEM high glucose medium. When the cells were fully covered, they were passaged in 100 mm cell culture dishes at a ratio of 1:5 to 1:6 and cultured overnight in a cell culture incubator at 37°C and 5% CO2. (2) Coating of 96-well cell culture plates with poly-L-lysine: The poly-L-lysine preservation solution was diluted with ultrapure water to a final concentration of 100 μg / mL and filtered through a 0.22 μm filter membrane before use. 50 μL of poly-L-lysine solution was added to each well of the 96-well plate, and the plate was placed at 37°C for 1 hour for coating. Then, the plate was washed twice with ultrapure water and dried before use. (3) Seed HEK-293T cells into coated 96-well plates. When the cell confluence reaches 80%–90%, transfect the cells. Take the recombinant vector obtained in step S11 of Example 1 and transfect different HMGCR genes according to Table 1 below. Transfect the plasmids at a mass ratio of 0.3 µg per well. Replace the culture medium with fresh medium after 6 hours. Lipofectamine 2000, lipofectamine 3000, or PEI can be used for transfection.

[0054] Table 1 Comparison of transfection results for different HMGCR genes

[0055] (4) 24-48 h after transfection, the transfection efficiency was observed under an inverted fluorescence microscope. The transfection efficiency results are as follows: Figure 2 As shown, Figure 2 In this context, A represents the transfection efficiency of the recombinant vector encoding the original nucleotide sequence of the human HMGCR protein, which is relatively low. Figure 2 B in the figure represents the transfection efficiency of the recombinant vector that uses codon optimization tools to optimize the nucleotide sequence of human HMGCR. The optimized transfection efficiency is slightly improved, but still relatively low. Figure 2 In the figure, C represents the transfection efficiency of the recombinant vector containing the recombinant optimized human HMGCR nucleotide sequence. That is, by adding the Kozak sequence before the ATG codon of HMGCR and the IgK signal peptide nucleotide sequence after the ATG, the transfection efficiency after recombinant optimization is significantly improved, which indicates that the corresponding protein expression level is greatly increased. Figure 2 In the figure, D represents the transfection efficiency of the recombinant vector with the optimized HMGCR-C-terminus (340 aa-888 aa) nucleotide sequence. The high transfection efficiency indicates that the recombinant modification of the ATG codon sequence is beneficial to subsequent protein expression.

[0056] Specific Experiment Example 2: Preparation of the cell-based matrix plates. Using the recombinant cells transfected in Table 1 above, matrix plates were prepared according to the following methods: The specific steps are as follows: (1) Washing: Cells 48 h after transfection were washed twice with PBS; (2) Fixing the top: Add 100 mL of 4% paraformaldehyde to each well and fix at room temperature for 10 min; (3) Washing: Cells fixed with paraformaldehyde were washed three times with PBS; (4) Permeation: Add 100 mL of 0.1% Triton X-100 to each well and permeate at room temperature for 10 min; the 0.1% Triton X-100 solution was prepared by diluting with 1×PBS; (5) Washing: Wash the permeabilized cells three times with PBS; (6) Blocking: Add 100 mL of blocking solution to each well to block nonspecific sites and block at room temperature for 1 h; the blocking solution contains 5% goat serum, 5% BSA, 0.1 M glycine and 10 mM EDTA, and is prepared by diluting with 1×PBS; (7) Washing: The blocked cells were washed twice with PBS; (8) Storage: Add 200 mL of protective solution (0.02% Proclin 300, 5% glycerol) to each well; store in the dark at 2-8℃.

[0057] Specific Experiment Example 3: Optimization and establishment of the CBA detection method, i.e., the method of using matrix plates. Specifically, the recombinant cells transfected in Table 1 were used to prepare matrix plates for sample detection according to Specific Example 2. The specific steps are as follows: (1) Dilute clinical samples using sample diluent. The initial dilution of the sample testing system is 1:10. Alternatively... Further dilutions can be performed on the dilution factor, such as 1:32, 1:100, 1:320, 1:1000, etc. There is no upper limit to the detection range; (2) Sample incubation: Take the reagents out of the refrigerator and warm them to room temperature; add the prepared sample and incubate in a 37°C constant temperature incubator for 30 min to allow the target antibody in the sample to fully bind to the target antigen; after incubation, wash with PBS. (3) Secondary antibody incubation: The bound antibody reacts specifically with the secondary antibody (anti-human IgG-594, red); incubate at 37℃ for 30 min, and excess secondary antibody is washed off during the washing process; after washing, add 100 μL of PBS solution and then perform fluorescence microscopy to take pictures and read the slides; (4) Microscopic examination: Microscopic examination is short for microscopic examination, which is to observe, analyze and judge the above-mentioned matrix plate under a microscope to assist in the diagnosis of diseases; (5) Result Interpretation: The evaluation of test results relies on the evaluation of positive and negative controls. Therefore, the original photographed results must be preserved for traceability; the positive control must be positive under all circumstances. The positive control ensures that the experiment is performed correctly and that all components are normal. If the positive control result is poor, the experimental data cannot be read.

[0058] Positive result: If a certain antibody shows overlapping red fluorescence (secondary antibody fluorescence) and green fluorescence (transfected plasmid), the sample is considered positive.

[0059] Negative result: If a certain antibody only shows green fluorescence (transfection plasmid) and not red fluorescence (secondary antibody fluorescence); or if the red fluorescence (secondary antibody fluorescence) and green fluorescence (transfection plasmid) do not overlap, then the sample is considered negative.

[0060] Specific Example 4: Evaluation of protein expression and detection before and after sequence optimization. This example is based on the recombinant cells obtained in Specific Example 1. Experiments were conducted using the matrix plate preparation method in Specific Example 2 and the usage method in Specific Example 3 to compare the differences in protein expression and sample detection among groups 1, 2, and 3 in Specific Example 1.

[0061] (1) Using the recombinant cells of groups 1, 2, and 3 obtained in specific example 1, the main steps include: coating a 96-well cell culture plate with poly-L-lysine, seeding HEK-293T cells into the coated 96-well plate, and when the cell confluence is 80%–90%, transfecting with recombinant vectors at a mass ratio of 0.3 µg per well, and replacing with fresh culture medium after 6 h. The recombinant vectors transfected are: a recombinant vector encoding the original nucleotide sequence of human HMGCR protein, a recombinant vector with the nucleotide sequence of human HMGCR optimized using codon optimization tools, and a recombinant vector with the optimized nucleotide sequence of human HMGCR.

[0062] (2) The experiment was conducted using the matrix plate preparation method in Specific Example 2. The main steps included: cells transfected for 48 h were washed with PBS, fixed with 4% paraformaldehyde for 10 min, washed with PBS, and then permeated with 0.1% Triton X-100 at room temperature for 10 min; the permeated cells were washed with PBS 3 times, and then blocked with blocking solution at room temperature for 1 h; after washing, 100 μL of protective solution was added to each well and stored at 2-8℃ in the dark.

[0063] (3) The experiment was conducted using the substrate plate method in Specific Example 3. HMGCR positive samples were diluted 1:10 with sample diluent and incubated in a constant temperature incubator at 37°C for 30 min. After incubation, the samples were washed with PBS. Secondary antibody (anti-human IgG-594, red) was added and incubated at 37°C for 30 min. Excess secondary antibody was washed away during the washing process. After washing, 100 μL of PBS was added and the slides were photographed and read using a fluorescence microscope. (4) In this specific embodiment 4, the results of detecting the same positive sample on a matrix plate prepared with the recombinant vector before and after sequence optimization were compared. Sequence optimization greatly improved the signal intensity of sample detection. The specific detection results are as follows: Figure 3 As shown; Figure 3 In the diagram, AC represents the positive sample detection results encoding the original nucleotide sequence of the human HMGCR protein; A represents the microscopic examination result; B represents the staining detection result of blood from a healthy person; and C represents the image stitched together from A and B. Figure 3 In the diagram, DF represents the optimized detection results of positive human HMGCR protein samples; D represents the microscopic examination results; E represents the staining detection results of blood from healthy individuals; and F represents the image stitching of D and E. Figure 3 In the diagram, GI represents the positive sample detection result of recombinant and optimized human HMGCR protein, where G represents the microscopic examination result; H represents the staining detection result of blood from healthy individuals; and I represents the image stitching of G and H.

[0064] Specific Example 5: Evaluation of sample detection results for full-length HMGCR and C-terminal protein. This example is based on the recombinant cells obtained in Specific Example 1. Experiments were conducted using the matrix plate preparation method in Specific Example 2 and the usage method in Specific Example 3, comparing the differences in protein expression and sample detection between groups 3 and 4 in Specific Example 1.

[0065] This embodiment selected 40 clinical samples, including 20 HMGCR-positive serum (PS) samples and 20 HMGCR-negative serum (NS) samples. Different groups of reagents were used to test the clinical samples, and the specific experimental results are shown in Table 2 below.

[0066] Table 2. Statistical results of clinical sample testing using different recombinant cells.

[0067] The test results in Table 2 show that the sample detection sensitivity of group 3 in specific embodiment 1 is 100% (20 / 20), and the sample detection specificity is 100% (20 / 20); the sample detection sensitivity of group 4 in specific embodiment 1 is 70% (14 / 20), and the sample detection specificity is 100% (20 / 20). In specific embodiment 1, the recombinant vector used in group 3 is a recombinant vector constructed from the recombinant optimized human HMGCR nucleotide sequence, which has good sensitivity and specificity; in specific embodiment 1, the recombinant vector used in group 4 is a recombinant vector with the recombinant optimized HMGCR-C-terminus (340 aa-888 aa) nucleotide sequence. Previous literature has reported that this segment is the target antigen of HMGCR autoantibodies, but using only this fragment would reduce the sensitivity of the reagent detection; therefore, the full-length recombinant optimized sequence in group 3 is preferred.

[0068] Specific Example 6: Comparative Evaluation of CBA Method and BLOT Reagent Detection Method.

[0069] 6-1 BLOT Reagent Detection Method: Purchase and obtain the Autoimmune Myositis Antibody Profile Detection Kit (Immunoblotting, TA-L89405G1:17S). Follow the instructions to detect the HMGCR positivity / negative status of clinical samples. Specific steps are as follows: (1) Equilibrate to room temperature: Before the experiment, equilibrate all BLOT reagent components at room temperature for 30 minutes.

[0070] (2) Preparation of washing solution (20×): If crystals appear in the reagent, please dissolve them before use. Take 1 part concentrated washing solution and add 19 parts distilled water. The washing solution should be prepared fresh for use. (3) Preparation of incubation buffer: Add 30 mL of washing solution to one bottle of blocking agent and mix well; (4) Place the fixing slot containing the detection membrane strip into the analyzer tray; place the reagents required for each reaction according to the markings on the analyzer, write the sample number on the edge of the incubation tray, and place the membrane strip of each sample into the hole of the incubation tray with the front side facing up; (5) Wet the detection strip with 1 mL of incubation buffer, and discard the buffer after 1 min. Add 1 mL of incubation buffer to wet the detection strip; add 10 μL of the sample to be tested, and incubate at room temperature for 30 min; (6) Discard the diluted sample, leaving no residue. Wash the test strip with 1 mL of washing buffer, gently shaking for 5 minutes each time. Discard the washing buffer after washing, and repeat 3 times. (7) Add 1 mL of enzyme-linked polymerase solution and incubate at room temperature for 30 min; (8) Discard the enzyme-linked polymerase solution; wash the detection membrane strip with 1 mL of washing buffer, shake gently, 5 min each time, discard the washing buffer after washing, and repeat 3 times; (9) Add 1 mL of TMB substrate solution and incubate at room temperature in the dark for 10 min; (10) Discard the substrate solution; wash with 1 mL of distilled water, and discard the distilled water after 1 min. Add 1 mL of stop solution, incubate at room temperature for 5 min, and discard the stop solution; (11) Dry the test membrane strip, interpret the results, and read the results displayed on the instrument; (12) Judgment of experimental validity: ① The three functional control bands are clearly visible; ② The weak positive control band is lighter in color than the strong positive and medium positive control bands. ③ Result interpretation: Negative: The test band cannot be clearly identified or the color of the band is lighter than that of the weak positive control band; Medium positive: The color of the test band is not significantly different from that of the medium positive control band or is higher than that of the medium positive control band and is lighter than that of the strong positive control band; Strong positive: The color of the test band is not significantly different from that of the strong positive control band or is higher than that of the strong positive control band.

[0071] 6-2 Reagent detection performance evaluation: Using the recombinant cells prepared in group 3 of specific example 1, clinical samples were tested based on the matrix plate preparation method of specific example 2 and the usage method of specific example 3, and the detection results of different cell immunofluorescence methods and immunoblotting methods were compared.

[0072] Sample Requirements: A total of 50 clinical samples were selected, including 22 positive serum samples (PS) and 28 negative serum samples (NS). Among them, the negative serum samples contained 8 samples that were positive for other autoantibodies. The clinical samples were tested using different combinations of reagents. The specific experimental results are shown in Table 3 below.

[0073] Table 3. Results of clinical sample testing using different detection methods Serial Number Sample type HMGCR Clinical Reference Values BLOT reagent test results The test results of this reagent PS1 serum Positive HMGCR (100 AU) 1:3200 PS2 serum Positive HMGCR (100 AU) 1:3200 PS3 serum Positive HMGCR (100 AU) 1:1000 PS4 serum Positive HMGCR (100 AU) 1:1000 PS5 serum Positive HMGCR (80 AU) 1:1000 PS6 serum Positive HMGCR (77 AU) 1:1000 PS7 serum Positive HMGCR (69 AU) 1:1000 PS8 serum Positive HMGCR (66 AU) 1:3200 PS9 serum Positive HMGCR (66 AU) 1:3200 PS10 serum Positive HMGCR (65 AU) 1:1000 PS11 serum Positive HMGCR (59 AU) 1:1000 PS12 serum Positive HMGCR (56 AU) 1:6400 PS13 serum Positive HMGCR (57 AU) 1:3200 PS14 serum Positive HMGCR (7 AU) 1:100 PS15 serum Positive HMGCR (6 AU) 1:100 PS16 serum Positive HMGCR (100 AU) 1:6400 PS17 serum Positive HMGCR (78 AU) 1:3200 PS18 serum Positive HMGCR (62 AU) 1:6400 PS19 serum Positive HMGCR (40 AU) 1:1000 PS20 serum Positive HMGCR (62 AU) 1:6400 PS21 serum Positive HMGCR negative 1:1000 PS22 serum Positive HMGCR negative 1:100 NS1 serum Negative HMGCR negative Negative NS2 serum Negative HMGCR negative Negative NS3 serum Negative HMGCR negative Negative NS4 serum Negative HMGCR negative Negative NS5 serum Negative HMGCR (8 AU) Negative NS6 serum Negative HMGCR negative Negative NS7 serum Negative HMGCR negative Negative NS8 serum Negative HMGCR negative Negative NS9 serum Negative HMGCR negative Negative NS10 serum Negative HMGCR negative Negative NS11 serum Negative HMGCR negative Negative NS12 serum Negative HMGCR negative Negative NS13 serum Negative HMGCR negative Negative NS14 serum Negative HMGCR negative Negative NS15 serum Negative HMGCR negative Negative NS16 serum Negative HMGCR negative Negative NS17 serum Negative HMGCR negative Negative NS18 serum Negative HMGCR negative Negative NS19 serum Negative HMGCR negative Negative NS20 serum Negative HMGCR negative Negative NS21 serum Negative PL-7 (31 AU), HMGCR negative Negative NS22 serum Negative PL-12 (33 AU), HMGCR negative Negative NS23 serum Negative Scl-70 (99 AU), HMGCR negative Negative NS24 serum Negative EJ(100 AU), HMGCR negative Negative NS25 serum Negative PL-7(96), HMGCR negative Negative NS26 serum Negative EJ(79), HMGCR negative Negative NS27 serum Negative HA(41), HMGCR negative Negative NS28 serum Negative SRP(21), HMGCR negative Negative Microscopic images of the above test results are as follows: Figure 3 As shown, the positive signals are distributed in the cytoplasm, mostly in a reticular positive form. The specific results are shown in Table 4 below.

[0074] Table 4. Statistical results of clinical sample testing using different detection methods

[0075] Table 4 shows that the sample detection sensitivity of group 3 in specific embodiment 1 was 100% (22 / 22), and the sample detection specificity was 100% (28 / 28); the sample detection sensitivity of 6-1 in specific embodiment 1 was 90.9% (20 / 22), and the sample detection specificity was 96.4% (27 / 28); the recombinant cells of the anti-HMGCR antibody matrix plate had higher sensitivity and specificity than the BLOT method.

[0076] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, such as changes in preparation parameters or the amount of raw materials. All such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.

Claims

1. An HMGCR antigen gene, characterized in that, The HMGCR antigen gene is an optimized sequence, and its nucleotide sequence is shown in SEQ ID NO.

2.

2. An HMGCR recombinant antigen gene, characterized in that, To encode and recombine the nucleotide sequence of the gene encoding the optimized HMGCR protein of claim 1, the nucleotide sequence of the optimized HMGCR protein gene is fused and recombinated with the Kozak sequence and the nucleotide sequence of the IgK signal peptide to obtain the nucleotide sequence shown in SEQ ID NO. 3; the Kozak sequence is shown in SEQ ID NO. 5; and the IgK signal peptide nucleotide sequence is shown in SEQ ID NO.

6.

3. An HMGCR recombinant antigen gene, characterized in that, The nucleotide sequence obtained by encoding and recombining segment C of the gene encoding the optimized HMGCR protein of claim 1 is shown in SEQ ID NO.

4.

4. An HMGCR recombinant antigen, characterized in that, The HMGCR recombinant antigen is the product of expressing the HMGCR recombinant antigen gene of claim 2 or claim 3 on a recombinant vector, that is, using the pIRES2-EGFP series vector and the IRES element, so that the HMGCR recombinant antigen gene and the EGFP fluorescent protein are expressed simultaneously and independently in the host cell; the IRES element sequence is shown in SEQ ID NO.7; the EGFP fluorescent protein sequence is shown in SEQ ID NO.

8.

5. The HMGCR recombinant antigen according to claim 4, characterized in that, The host cell was HEK293T cell; the HMGCR recombinant antigen gene was transfected into the host cell using a transfection reagent for expression, and then the HMGCR recombinant antigen was obtained after culture.

6. A detection reagent for detecting anti-HMGCR antibodies, characterized in that, The detection reagent for detecting anti-HMGCR antibodies contains the HMGCR recombinant antigen as described in claim 4.

7. A method for preparing a detection reagent for detecting anti-HMGCR antibodies, characterized in that, Includes the following steps: S1: Construct a recombinant vector for the HMGCR recombinant antigen and obtain a recombinant plasmid through the recombinant vector; wherein, the gene encoding the HMGCR protein has the nucleotide sequence shown in SEQ ID NO.1; the gene encoding the optimized HMGCR protein has the nucleotide sequence shown in SEQ ID NO.2; and the gene for the recombinant and optimized HMGCR protein has the nucleotide sequence shown in SEQ ID NO.

3. S2: The recombinant plasmid obtained in step S1 is cultured and then transfected into host cells to obtain recombinant cells; S3: The recombinant cells from step S2 are sequentially fixed, washed, and sealed to prepare a recombinant cell matrix plate, which is the detection reagent for detecting anti-HMGCR antibodies.

8. The application of the detection reagent for detecting anti-HMGCR antibodies as described in claim 6 in detecting anti-HMGCR antibodies in body fluids.

9. A kit for detecting anti-HMGCR antibodies, characterized in that, The kit includes the detection reagent for detecting anti-HMGCR antibodies as described in claim 6.

10. A CBA detection method using the reagent for detecting anti-HMGCR antibodies as described in claim 6, characterized in that, The CBA detection method includes sample incubation and fluorescent secondary antibody incubation. The specific steps are as follows: add serum or plasma samples of different dilutions to be detected to the reagent for detecting anti-HMGCR antibody and perform the first incubation; then add fluorescent secondary antibody for the second incubation, wash and detect using a fluorescence microscope to obtain the detection results and report the titer of the positive results.

Images