Molecular marker, primer and kit for identifying rubber tree variety Yunnan research 272 and application
By developing molecular markers and primers for the rubber tree variety 'Yunyan 272', and combining PCR amplification and Sanger sequencing, the problem of unstable identification in existing technologies has been solved, enabling accurate identification of the 'Yunyan 272' variety and promoting the scientific and large-scale application of rubber tree planting and breeding.
Patent Information
- Application Number
- CN202511505541.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-21
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2045-10-21
AI Technical Summary
In existing technologies, rubber tree variety identification methods rely on morphological characteristics and physiological and biochemical indicators, which are easily affected by environmental factors, leading to unstable identification results. In addition, high-throughput sequencing methods are costly and difficult to accurately distinguish the 'Yunyan 272' variety, which can easily cause variety confusion.
A molecular marker and primers for the rubber tree variety 'Yunyan 272' were developed. The DNA sequence of 'Yunyan 272' was identified using specific primers through PCR amplification and Sanger sequencing. A simple kit was provided for the operation.
It has enabled accurate identification of the 'Yunyan 272' variety, improved identification accuracy, optimized variety selection and regional suitability assessment, promoted the scientific nature of rubber tree planting and breeding, and is suitable for large-scale application.
Smart Images

Figure CN121183016A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present disclosure relates to the technical field of variety breeding identification in molecular biology, in particular to a molecular marker for identifying rubber tree variety 'Yunyan 272', a primer, a kit and an application thereof. BACKGROUND
[0002] Rubber tree (Hevea brasiliensis) is an important source of natural rubber worldwide, and its cultivation and yield have a significant impact on economic and industrial development. As the province with the largest rubber tree planting area, yield per hectare and total yield in China, Yunnan Province plays an irreplaceable role in promoting the sustainable development of China's rubber industry. In particular, the breeding and planting strategies of high-yielding, cold-resistant, and powdery mildew-resistant varieties are particularly crucial.
[0003] The rubber tree variety 'Yunyan 272' was bred by the Yunnan Institute of Tropical Crops in 2010 and was authorized in April 2024. Its authorization number is CNA20191004725. It has the advantages of "fast growth, high yield, cold resistance, drought resistance, and powdery mildew resistance." The average stem circumference of a 6-year-old tree in Jinghong is 50 cm at 1.3 meters above ground, with a yield of 1.4 kg of dry rubber per plant. A 13-year-old plant can produce 600 mL of rubber per cut in winter. The cold resistance, drought resistance, and powdery mildew resistance of this variety in the Ruili (elevation 850 meters, dry and poor) and Gengma (elevation 1100 meters, dry and cold, high incidence of powdery mildew) planting areas have successfully passed the test.
[0004] However, due to the narrow genetic basis of the currently cultivated rubber tree varieties and the high similarity of phenotypic traits between varieties, traditional rubber tree variety identification methods mainly rely on morphological characteristics and physiological and biochemical indicators. These phenotype-based identification methods are easily affected by environmental factors, leading to instability in the identification results. The phenotype of rubber tree 'Yunyan 272' is similar to that of other rubber tree varieties, and it is difficult to distinguish them from appearance, and mistakes often occur, leading to variety confusion. The patent with the authorization publication number CN 118064428 B discloses a MNP molecular marker for constructing a DNA fingerprint of rubber tree. It can use 600 pairs of MNP primers to amplify the DNA fingerprint of rubber tree varieties, but it does not explicitly indicate the identification marker for a single variety. Moreover, this method requires high-throughput sequencing to analyze the differences between varieties, which is relatively costly.
[0005] Therefore, developing a new method for identifying a single rubber tree variety that is short in development cycle, low in cost, simple in operation, and significant for solving rubber tree variety confusion, improving rubber tree yield, and ensuring the sustainable development of natural rubber is of great significance. SUMMARY
[0006] The application aims to provide a molecular marker, primer, kit and application for identifying Hevea brasiliensis variety 'Yunyan 272'.
[0007] To achieve the above-mentioned purpose, the application adopts the technical scheme of a molecular marker for identifying Hevea brasiliensis variety 'Yunyan 272', wherein the physical position of the molecular marker is located at 10110474-10110618 bases of CM021232_1 chromosome 101, and the nucleotide sequence is shown as SEQ ID No. 1.
[0008] The second purpose of the application is to provide a primer pair for amplifying the molecular marker of Hevea brasiliensis variety 'Yunyan 272', wherein the sequence of the primer pair is shown as SEQ ID No. 2-3.
[0009] The third purpose of the application is to provide a kit for identifying Hevea brasiliensis variety 'Yunyan 272', wherein the kit comprises a primer pair for amplifying the molecular marker of Hevea brasiliensis variety 'Yunyan 272'.
[0010] The fourth purpose of the application is a method for identifying Hevea brasiliensis variety 'Yunyan 272', and the steps comprise:
[0011] (1) using a plant total DNA extraction kit to extract total DNA of all to-be-tested Hevea brasiliensis samples;
[0012] (2) using the extracted genomic DNA as a template, and respectively using the primer pair shown as SEQ ID No. 2-3 to perform PCR amplification;
[0013] (3) performing Sanger sequencing on the amplification product to obtain sequencing data, and when the sequence shown as SEQ ID No. 1 exists in the amplification product, it is the 'Yunyan 272' variety; otherwise, it indicates that the to-be-tested Hevea brasiliensis sample is not the 'Yunyan 272' variety.
[0014] Further, the PCR amplification is as follows:
[0015] The PCR amplification system is 20 μL, and comprises: 50 ng / μL DNA template 0.5 μL, 10×PCR buffer 2 μL, 25 mM MgCl2 2 μL, 10 mM dNTPs 0.5 μL, 5 U / μL Taq DNA polymerase 0.2 μL, 10 μM upstream primer 0.5 μL, 10 μM downstream primer 0.5 μL, and ddH2O 13.8 μL;
[0016] The reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; and finally 72℃ extension for 7 min.
[0017] The molecular marker, primer pair or kit provided by the application can be used for identifying Hevea brasiliensis variety Yunyan 272.
[0018] The application has the beneficial technical effect that the application provides a molecular marker primer and kit for Hevea brasiliensis variety 'Yunyan 272', the technology can specifically recognize and amplify the DNA sequence of 'Yunyan 272' variety, realize accurate identification, help to improve the accuracy of variety identification, optimize variety selection and regional suitability assessment, so as to provide a scientific basis for the planting and breeding of Hevea brasiliensis and promote the healthy development of the rubber industry. The molecular marker, primer pair or kit of the application is simple to operate and suitable for large-scale application. BRIEF DESCRIPTION OF DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only some embodiments of the application, and for those skilled in the art, other drawings can be obtained without creative labor.
[0020] Figure 1 is the sequence characteristic map of two types in embodiment 1 of the application. DETAILED DESCRIPTION
[0021] The technical solutions in the embodiments of the application will be described clearly and completely in the following with reference to the drawings in the embodiments of the application. Obviously, the described embodiments are only some embodiments of the application, not all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the application.
[0022] Embodiment 1
[0023] This embodiment is a screening and identification method of the specific molecular marker of Hevea brasiliensis 'Yunyan 272', which comprises the following steps:
[0024] (1) 123 Hevea brasiliensis germplasm of Yunyan series including 'Yunyan 272' and 24 domestic and foreign varieties in Weikhan germplasm resources planted and preserved in Jinghong Hevea brasiliensis Germplasm Resources Garden of the Ministry of Agriculture and Rural Affairs; fresh leaves without disease and pest infection are collected from 147 germplasms, and then the fresh leaves are quickly frozen in liquid nitrogen and stored at-80℃ for standby.
[0025] (2) The whole genome DNA of 147 samples in step (1) is extracted by using a plant total DNA extraction kit, and then the extracted whole genome DNA sample is sent to Beijing Baimaikes Technology Co., Ltd. for resequencing.
[0026] (3) Quality control of the raw data of resequencing to obtain clean data of each sample.
[0027] (4) The clean data is aligned to the rubber tree reference genome (the reference genome version is GCA_010458925.1) using the MEM algorithm of BWA software to obtain the intermediate result file in sam format; the sam file is converted into a bam file using samtools software and the results are merged, duplicate sequences are removed and sorted.
[0028] (5) The bam file is subjected to polymorphism site detection typing using GATK software to generate a vcf file; the sites in the vcf file are subjected to quality control using vcftools software to obtain high-quality polymorphic sites that meet the screening conditions, the quality control conditions are: minor allele frequency MAF>0.05; P-value>0.01 in Hardy-Weinberg test; site deletion rate <0.1; polymorphic information content PIC>0.2; population site heterozygosity <0.2, and the core polymorphic sites are obtained after quality control.
[0029] (6) The vcftools software is used to further screen the specific molecular markers of the rubber tree variety ‘Yunyan 272’ based on the genotype differences of the core polymorphic sites in different rubber tree germplasms, and the screening standard is: the homozygous mutation rate of the polymorphic site in the rubber tree variety ‘Yunyan 272’ is 1, and the homozygous mutation rate of the polymorphic site in other rubber tree germplasms is <0.1.
[0030] After screening, one molecular marker with significant difference in the ‘Yunyan 272’ variety is obtained, which has 5 base position polymorphisms, the 10110500th base C or T, the 10110560th T or A, the 10110561th base G or A, the 10110562th base A or C, and the 10110577th base T or C.
[0031] (7) The BioEdit software is used for sequence alignment of all sample sequences, and a total of 2 different sequence types (as shown in Figure 1 ) are statistically obtained, and the 2 different sequence types are named a (SEQ ID No. 1) and b (SEQ ID No. 4), and the nucleotide sequences of the 2 sequence types are shown in Table 1.
[0032] Table 1 Different sequences obtained after amplification and sequencing of 147 rubber tree germplasm resources
[0033] a TATTTCCCACCTGCAACTTTGCTTTCCCTGTGCTTTGCTTGATGTTGCTGATGAAGTTCTGTGGTACATGCTAAATATGATAGTGAGGGCTCTCATCTGTAGAACCTACCATGGTGGAATTCTTCAGATAGCTGGACGAAATAACT b TATTTCCCACCTGCAACTTTGCTTTCTCTGTGCTTTGCTTGATGTTGCTGATGAAGTTCTGTGGTACATGCTAAATATGATAGAACGGGCTCTCATCCGTAGAACCTACCATGGTGGAATTCTTCAGATAGCTGGACGAAATAACT
[0034] (8) The genotype of the ‘Yunyan 272’ variety is analyzed, and the genotypes corresponding to the 5 sites are C, T, G, A and T, and the sequence type is a.
[0035] Example 2
[0036] This example is to verify the reliability of the identified specific molecular marker for identifying Hevea brasiliensis variety ‘Yunyan 272’.
[0037] A specific primer is designed for the identified specific molecular marker (SEQ ID No. 1), and the design sequence is as follows:
[0038] F: 5'-CTGTGGATGTATATTCAGCTTCACA-3' (SEQ ID No. 2)
[0039] R: 5'-TTGAAGCTGCCAAAAGTTTTACCTT-3' (SEQ ID No. 3).
[0040] 44 Hevea brasiliensis Weihanchan germplasms are selected, and the developed specific molecular marker is genotyped by Sanger sequencing; specifically including:
[0041] (1) Extract the whole genome DNA of the test sample;
[0042] (2) Using the DNA in step (1) as a template and the above nucleotide sequence as a primer, the molecular marker site is PCR amplified to obtain the PCR amplification product;
[0043] (3) Sanger sequencing of the PCR amplification product obtained in step (2) to determine the genotype of the molecular marker site, as shown in Table 2:
[0044] Table 2 Genotyping of 44 Hevea brasiliensis germplasms after amplification
[0045] Pedigree name Genotype of 5 base sites Yunyan 272 C, T, G, A, T Yunyan 619 T, A, A, C, C Yunyan 624 T, A, A, C, C Yunyan 1251 T, A, A, C, C Yunyan 1433 T, A, A, C, C Yunyan 77-4 T, A, A, C, C Yunyan 190 T, A, A, C, C Yunyan 626 T, A, A, C, C Yunyan 13 T, A, A, C, C Yunyan 30 T, A, A, C, C Yunyan 341 T, A, A, C, C Yunyan 41 T, A, A, C, C Yunyan 552 T, A, A, C, C Yunyan 554 T, A, A, C, C Yunyan 77-2 T, A, A, C, C Yunyan 583 T, A, A, C, C Yunyan 609 T, A, A, C, C Yunyan 610 T, A, A, C, C Yunyan 613 T, A, A, C, C Yunyan 73-477 T, A, A, C, C Yunyan 623 T, A, A, C, C Yunyan 625 T, A, A, C, C RRIM 712 T, A, A, C, C Yunyan 644 T, A, A, C, C Yunyan 659 T, A, A, C, C Tjir 1 T, A, A, C, C Yunyan 671 T, A, A, C, C Yunyan 681 T, A, A, C, C Yunyan 682 T, A, A, C, C Yunyan 683 T, A, A, C, C Yunyan 277-5 T, A, A, C, C PB 86 T, A, A, C, C RRIM 600 T, A, A, C, C PR 107 T, A, A, C, C Yunyan 149 T, A, A, C, C Yunyan 71-662 T, A, A, C, C RRII 118 T, A, A, C, C Yunyan 98-305 T, A, A, C, C Yunyan 98-323 T, A, A, C, C Yunyan 98-376 T, A, A, C, C Yunyan 99-663 T, A, A, C, C RRIM 803 T, A, A, C, C PR 302 T, A, A, C, C RRIM 905 T, A, A, C, C
[0046] The verification results are consistent with the genotype analysis results obtained in Example 1, indicating that the developed molecular marker can effectively identify ‘Yunyan 272’ variety in Hevea brasiliensis germplasm.
[0047] Example 3
[0048] Accuracy analysis of Hevea brasiliensis molecular marker primer identification
[0049] Three reproducibility experiments are used for accuracy analysis, and in this example, three independent experiments are performed by different personnel, different batches of reagents and different laboratories, thereby simulating the identification of different batches of Hevea brasiliensis. High reproducibility means that the identification results of different laboratories can be accurately compared with each other.
[0050] Two rubber tree samples to be tested were subjected to reproducibility experiment, and the two samples to be tested were Yunyan 272 and Yunyan 77-4. Each sample to be tested was subjected to three repeated experiments, and the sequence combination of each result was recorded. The specific results are shown in Table 3.
[0051] Table 3: Results of three repeated experiments
[0052] Serial number Sample to be tested Repetition 1 experimental sequence combination Repetition 2 experimental sequence combination Repetition three experimental sequence combination 1 Yunyan 272 a a a 2 Yunyan 77-4 b b b
[0053] Table 3 further verifies that the molecular marker and amplification primer of the rubber tree can distinguish and identify Yunyan 272 and Yunyan 77-4.
[0054] Finally, it should be noted that the above examples are only used to illustrate but not limit the technical solutions of the present application. Although the present application has been described in detail with reference to the above examples, those skilled in the art should understand that the present application can still be modified or replaced equivalently without departing from the spirit and scope of the present application. Any modification or partial replacement should be covered in the scope of the claims of the present application.
Claims
1. Molecular markers for identifying the rubber tree variety 'Yunyan 272', characterized by: The molecular marker is located at bases 10110474 to 10110618 on chromosome CM021232_1, and its nucleotide sequence is shown in SEQ ID No.
1.
2. Primer pairs for amplifying molecular markers of the rubber tree variety 'Yunyan 272', characterized in that, The primer pair sequences are shown in SEQ ID No. 2-3.
3. A reagent kit for identifying the rubber tree variety 'Yunyan 272', characterized in that, The kit contains the primer pair as described in claim 2.
4. A method for identifying a rubber tree variety 'Yunyan 272', characterized by the following steps: include: (1) Total DNA was extracted from all rubber tree samples to be tested using a plant total DNA extraction kit; (2) Using the extracted genomic DNA as a template, PCR amplification was performed using the primer pairs described in SEQ ID No. 2-3 respectively; (3) The amplified product is sequenced by Sanger sequencing to obtain sequencing data. If the amplified product contains a sequence as shown in SEQ ID No. 1, it is the 'Yunyan 272' variety; otherwise, it indicates that the rubber tree sample to be tested is not the 'Yunyan 272' variety.
5. The identification method according to claim 4, characterized in that, The PCR amplification: The PCR amplification system is 20 μL, comprising: 0.5 μL of 50 ng / μL DNA template, 2 μL of 10×PCR buffer, 2 μL of 25 mM MgCl2, 0.5 μL of 10 mM dNTPs, 0.2 μL of 5 U / μL Taq DNA polymerase, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and 13.8 μL of ddH2O; The reaction procedure was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 30 s, repeated 30 times; and finally extension at 72℃ for 7 min.
6. The application of the reagent for detecting the molecular marker described in claim 1 in the identification of the rubber tree variety Yunyan 272.
Citation Information
Patent Citations
MNP molecular marker combination and method for constructing DNA fingerprint of rubber tree
CN118064428B
Molecular marker, primer and kit for identifying rubber tree variety Yunnan research 614 and application
CN119082364A
Rubber tree chloroplast SNP (Single Nucleotide Polymorphism) marker-based rubber tree B-type cultivated variety identification method
CN119614744A
Variety discrimination methods of para rubber tree, and kits for variety discrimination of para rubber tree
JP2017184651A
Cited By
Molecular marker primer group, kit and method for identifying rubber tree triploid variety Yunnan research 77-4 and application
CN121518702A